ID: 946099682

View in Genome Browser
Species Human (GRCh38)
Location 2:217309255-217309277
Sequence GCCTGGTTCCTAACTGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946099679_946099682 -9 Left 946099679 2:217309241-217309263 CCACCTGCTGTGCAGCCTGGTTC 0: 150
1: 392
2: 800
3: 1141
4: 1367
Right 946099682 2:217309255-217309277 GCCTGGTTCCTAACTGGTACTGG 0: 1
1: 0
2: 4
3: 47
4: 415
946099677_946099682 -2 Left 946099677 2:217309234-217309256 CCGCTCACCACCTGCTGTGCAGC 0: 3
1: 245
2: 498
3: 808
4: 950
Right 946099682 2:217309255-217309277 GCCTGGTTCCTAACTGGTACTGG 0: 1
1: 0
2: 4
3: 47
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946099682 Original CRISPR GCCTGGTTCCTAACTGGTAC TGG Intronic
901222662 1:7592420-7592442 GCCCGCTTCCTAACAGGAACAGG + Intronic
901516822 1:9753311-9753333 GCCTGGTTCCTAACAGGCCACGG + Intronic
905791945 1:40794386-40794408 GCCTGCTACCTAGCGGGTACTGG - Intronic
906700040 1:47851056-47851078 GCCTGGTTCCTAACAGGCTATGG + Intronic
906883036 1:49613414-49613436 GCCTGGTTCCTAACAGGGAATGG - Intronic
907150776 1:52285370-52285392 GCCTGGTTCCTAACAGGCCACGG - Intronic
909660505 1:78076652-78076674 GCCTGGTTCCTAACAGGCCAAGG + Intronic
910209501 1:84778661-84778683 GCCTGGTTCCTAACAGGCCATGG - Intergenic
911604309 1:99885495-99885517 GCCTGGTTCCTAACAGGCCATGG - Intronic
912063962 1:105712271-105712293 GCCTAGTTCCTAACAGGTTATGG - Intergenic
912232883 1:107816102-107816124 GCCTGGTTCCTAACAGGCCATGG + Intronic
912614964 1:111090101-111090123 GCCTGGTTCCTAACAGGCCATGG - Intergenic
912672818 1:111647076-111647098 GCCTGGTTCCTAACAGGCCATGG - Intronic
913094131 1:115500329-115500351 GCCTGGTTCCTAACAGGCCATGG + Intergenic
913453939 1:119011954-119011976 GCCTGCTACCTAGCTGGTGCTGG + Intergenic
913598844 1:120404094-120404116 GCCTGGTGCCTAACAGGCCCAGG - Intergenic
914088531 1:144475526-144475548 GCCTGGTGCCTAACAGGCCCAGG + Intergenic
914310082 1:146458684-146458706 GCCTGGTGCCTAACAGGCCCAGG - Intergenic
914592029 1:149114455-149114477 GCCTGGTGCCTAACAGGCCCAGG + Intergenic
916333916 1:163648706-163648728 GCCTGGTTCCTAACGGGCCATGG - Intergenic
917205597 1:172567918-172567940 GCCTGGTTCCTAACAGGCCATGG - Intronic
917543706 1:175940202-175940224 GCCTGGTTCCTAACAGGCCACGG + Intergenic
917826690 1:178829334-178829356 GCCTGGTTCCTAACAGGCCATGG - Intronic
919438046 1:197588089-197588111 GCCTGGTTCCTAACGGGAGCTGG + Intronic
922865321 1:228855786-228855808 GCCTGGTTCCTAACAGGCTGTGG - Intergenic
923223192 1:231914905-231914927 GCTAGGCTCCTGACTGGTACAGG - Intronic
923377374 1:233378064-233378086 GCCTGGTTCCTAACAGGCCACGG + Intronic
923491177 1:234485489-234485511 GCCTGGTTCCTAACAGGTCACGG - Intergenic
923504703 1:234595301-234595323 GCCTGGTTCCTAACAGGCCATGG + Intergenic
923746983 1:236710636-236710658 GCCCGGTTCCTAACAGGTCACGG - Intronic
923826127 1:237502710-237502732 GCCTGGTTCCTAACAGGCCGCGG + Intronic
924161325 1:241235411-241235433 GCCTGGTTCCTGCCTGTTCCAGG - Intronic
924893362 1:248308582-248308604 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1063170011 10:3500600-3500622 GCCTGGTGCCCTATTGGTACAGG - Intergenic
1064541110 10:16406021-16406043 GCCTGGTTCCTAACAGTAACTGG - Intergenic
1064699919 10:18008135-18008157 GCCTCGTTCCTAACAGGACCAGG - Intronic
1065849155 10:29772460-29772482 GCCTGGTTCCTAACAGGCTGTGG + Intergenic
1066612391 10:37263740-37263762 GCCTGGTTCCTAACAGGCCATGG + Intronic
1067354816 10:45514285-45514307 GCCTGGTTTCTCACTGATTCAGG - Intronic
1067374435 10:45714379-45714401 GCCTGGCTCCTAACAGGTCATGG - Intergenic
1068006596 10:51398423-51398445 GCCCGGTTCCTAACAGGTCATGG + Intronic
1068267472 10:54671870-54671892 GCCTGGTTCCTAACAGGCCATGG - Intronic
1068765575 10:60759459-60759481 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1068801004 10:61139634-61139656 GCCAAGTTGCTCACTGGTACGGG - Intergenic
1068812637 10:61273885-61273907 GCCTGGTTCCTAACCAGTCATGG - Intergenic
1068819655 10:61359598-61359620 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1068987530 10:63121003-63121025 GCCTGGTTCCTAACAGGCCGTGG - Intergenic
1070018500 10:72559785-72559807 GCCTGGTTCCTAACAGGCCCCGG - Intronic
1071136207 10:82457492-82457514 GCCTGGTTCCTAACAGGCCATGG + Intronic
1073505650 10:103986572-103986594 GCCTGGTTCCTAACAGGCCGTGG + Intronic
1074069559 10:110052342-110052364 GCCCGGTTCCTAACAGGTACTGG - Intronic
1074794822 10:116932242-116932264 GCCTGGTTCCTAACAGGCCATGG - Intronic
1075237325 10:120742506-120742528 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1075818797 10:125287558-125287580 ACCTGGGTCCTCACTGGTAGAGG - Intergenic
1076284946 10:129285721-129285743 GGCTGGTTCCTAACAGGTCATGG + Intergenic
1076728625 10:132426187-132426209 GCCTGGTTCCTAACAGGCCCTGG - Intergenic
1077025096 11:436578-436600 GCCCGGTTCCTAACTGGCCAAGG - Intronic
1077261760 11:1625638-1625660 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1077426470 11:2481531-2481553 GCCTGGTTCCTAACAGGCCATGG - Intronic
1077559020 11:3245435-3245457 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1078116994 11:8463465-8463487 GCCTGGTTCCTAACAGGCCACGG + Intronic
1078352171 11:10603568-10603590 GCCTGGTTCCTAACAGGCCATGG + Intronic
1078799409 11:14627966-14627988 GCCTGGTTCCTAACAGGCCATGG - Intronic
1079149840 11:17887882-17887904 GCCTGGTTCCTAACAGGCCGTGG - Intronic
1079165282 11:18035108-18035130 GCCTGGTTCCTAACAGGCCACGG + Intronic
1079785914 11:24672854-24672876 GCCTGGTTCCTAACAGGCCACGG - Intronic
1080031188 11:27662800-27662822 GCCTGGTTCCTAACAGGCCAGGG + Intronic
1080350429 11:31379169-31379191 GCCTGGTTCCTAACTGGCCATGG - Intronic
1080470317 11:32539078-32539100 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1081262441 11:40977253-40977275 GCCTGGTTCCTAACAGGCCAGGG + Intronic
1081701853 11:45157473-45157495 ACCTGGTTCCTAACAGGTTATGG + Intronic
1084428143 11:69096770-69096792 GCCTGGGTCCTGCCTGCTACTGG + Intergenic
1084521047 11:69663045-69663067 GCCCGGTTCCTAACTGGTCATGG - Intronic
1085381981 11:76128128-76128150 GCCTGGTTCCTAACAGGACATGG - Intronic
1085723394 11:78932906-78932928 GCCTGGTTCCTAACAGGCCACGG + Intronic
1086801888 11:91185898-91185920 GCCCGGTTCCTAACTGGCCACGG + Intergenic
1088185730 11:107167069-107167091 GCCTGGTTCCTAACAGGCCGTGG + Intergenic
1089718135 11:120383739-120383761 GCCTGGTTCCTAACAGATCATGG + Intronic
1090485359 11:127107768-127107790 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1090757375 11:129804190-129804212 GCCCAGTTCCAAGCTGGTACTGG - Intergenic
1091643778 12:2257609-2257631 GCCTGGTTCCTAACAGGCCATGG + Intronic
1091755246 12:3047065-3047087 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1091942565 12:4501404-4501426 GCCCGGTTCCTAACAGGTGATGG - Intronic
1092085884 12:5759460-5759482 GCCTGGTTCCTAACTGGACATGG - Intronic
1092776184 12:11946803-11946825 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1093810795 12:23490155-23490177 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1094053927 12:26249503-26249525 GCCTGGTTCCTAACAGGCCTAGG + Intronic
1094242776 12:28248016-28248038 GCCTGGTTCCTAACAGGCCAAGG + Intronic
1095764290 12:45877184-45877206 GCCTGGTTCCTAACAGGCCACGG - Intronic
1095915374 12:47472785-47472807 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1095950577 12:47779721-47779743 GCCTGGTTCCTAACAGGCCACGG - Intronic
1096019275 12:48308556-48308578 GCCTGGTTTCTGACAGGTACCGG + Intergenic
1096483411 12:51958840-51958862 GCCTGGTTCCTAACAGGCCGTGG + Intronic
1097032132 12:56097357-56097379 GCCTGGTTCCTAACAGGCCATGG - Intronic
1097110340 12:56653238-56653260 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1097802419 12:63929021-63929043 GCCTGGTTCCTAACAGGCCACGG + Intronic
1097924850 12:65116238-65116260 GCCTGGTTCCTAACAGGCCATGG - Intronic
1098244563 12:68502988-68503010 GCCCGGTTCCTAACAGGTCGTGG - Intergenic
1098752362 12:74310984-74311006 GCCTGCTTCATAACAGGTTCTGG + Intergenic
1099170752 12:79360888-79360910 GCCTGGGTCCCAACTTGTACCGG - Intronic
1099200335 12:79668785-79668807 GCCTGGTTCCTAACAAGTCATGG + Intronic
1099748035 12:86732724-86732746 GCCTGGTTCCTAACAGGCCATGG + Intronic
1099970626 12:89496298-89496320 GCCTGGTTCCTAACAGGCCATGG + Intronic
1099974699 12:89534169-89534191 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1100625579 12:96327986-96328008 GCCTGGTTCCTAACAGGCCATGG - Intronic
1100678016 12:96889025-96889047 GCCTGGTTCCTAACAGGCCGTGG + Intergenic
1100715678 12:97302724-97302746 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1100724645 12:97395928-97395950 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1101262432 12:103046552-103046574 GCCTGATTCCTAACAGGTCATGG - Intergenic
1101749029 12:107567626-107567648 GCCTGGTTCCTAACAGGCCATGG - Intronic
1101861083 12:108483031-108483053 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1102999837 12:117376784-117376806 GCCAGGGTCCTGACTGATACGGG + Intronic
1104176010 12:126333342-126333364 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1104617874 12:130285494-130285516 GCCTGGTTCCTAACAGGCCACGG + Intergenic
1105447187 13:20467848-20467870 GCCTGGTTCCTAACAGGCCAGGG - Intronic
1105822940 13:24096147-24096169 GCCTGGTGCCTGACTTGTTCTGG + Intronic
1105863488 13:24438395-24438417 GCCTGGTTCCTAACAGGCCAGGG + Intronic
1106985518 13:35343533-35343555 GCCTGGTTCCTAACAGGCCAAGG - Intronic
1107414848 13:40190908-40190930 GTCTGGTTCCTATCTTGTTCAGG + Intergenic
1107506618 13:41040738-41040760 GCCTGGTTCCTAACAGGCCACGG + Intronic
1107797214 13:44065080-44065102 GCCTGGTTCCTAACAGGCCACGG + Intergenic
1109002918 13:56829664-56829686 GCCCGGTTCCTAACAGGCAATGG - Intergenic
1109240727 13:59883989-59884011 GCCTGTTTTCTAACAGTTACTGG - Intronic
1109373547 13:61457983-61458005 GCCTGGTTCCTAATAGGCCCTGG - Intergenic
1109549350 13:63872979-63873001 GCCTGGTTCCTAACAGGTCTTGG + Intergenic
1109904211 13:68816977-68816999 ACTTGGTTCCTAACTGGTCATGG + Intergenic
1111454634 13:88464975-88464997 GCCTGGTTCCTAACAGGCCAGGG - Intergenic
1112222638 13:97506628-97506650 GCCTGGTTCCTAACAGGGTTGGG - Intergenic
1113058947 13:106300364-106300386 GCCAGGTTCCTAACTGGCCCTGG - Intergenic
1113885386 13:113656171-113656193 GCCTGGTGCCTCCCTGGTGCTGG + Intronic
1114598085 14:23931348-23931370 GCCTGGTTCCTAACAGGTCATGG - Intergenic
1114879107 14:26761729-26761751 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1114890467 14:26915289-26915311 GCTTGGTTCCTAAGCCGTACGGG + Intergenic
1115852075 14:37596432-37596454 GCTTGGTTCCTAATCGGTCCTGG + Intronic
1116250826 14:42481279-42481301 GCCTGGTTCCTAACAGGCCAAGG + Intergenic
1117322197 14:54634645-54634667 GCCTGGTTCCTAACAGGCTGTGG + Intronic
1119160312 14:72446974-72446996 GCCTGGTTCCTAACAGGCCAGGG + Intronic
1119345929 14:73924361-73924383 GCCTGGTTCCTAACAGGGCACGG + Intronic
1120537527 14:85715354-85715376 TCCAGGCTCCTAGCTGGTACTGG + Intergenic
1121132914 14:91465005-91465027 GCCTGGTTCCTAACAGGCTATGG + Intronic
1122833634 14:104420042-104420064 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1122833698 14:104420666-104420688 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1123800727 15:23817515-23817537 CCCTGTTTACTAAATGGTACTGG + Intergenic
1124557202 15:30736799-30736821 ACCTGGCTCCAGACTGGTACTGG - Intronic
1124674061 15:31668948-31668970 ACCTGGCTCCAGACTGGTACTGG + Intronic
1124808207 15:32907496-32907518 GCCTGGTTCCTAACAGGCCATGG + Intronic
1124842544 15:33257123-33257145 GCCTGGTTCCTAACAGGCTATGG + Intergenic
1124911293 15:33923705-33923727 GCCTGGTTCCTAACCCCTAGGGG - Intronic
1126661845 15:51040005-51040027 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1127099541 15:55551128-55551150 GCCTGGTTCCTAACAGGGCATGG + Intronic
1128963274 15:72030919-72030941 GCCCGGTTCCTAACAGGTCATGG - Intronic
1129178927 15:73859359-73859381 GCCTGGTTCCTCACTGGCCTGGG + Intergenic
1129411349 15:75352222-75352244 GCCTGCTTGCTGACCGGTACAGG - Exonic
1129713290 15:77832488-77832510 GCCTGGTTTCCAACTGGGATGGG - Intergenic
1131349924 15:91690243-91690265 GCCTGGTTCCTAACAGGCCAAGG + Intergenic
1132076489 15:98825424-98825446 GCCTGGTTCCTAACAGGCCATGG - Intronic
1135127655 16:19824454-19824476 GCCTGGTTCCTAACAGGCCATGG + Intronic
1135284564 16:21182219-21182241 GCCTGGTTCCTAACAGGCCAAGG - Intergenic
1135798682 16:25472181-25472203 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1135882112 16:26268034-26268056 GCCTGTTTACAAAATGGTACTGG - Intergenic
1138364803 16:56466209-56466231 ACCTGGTTCCTCCCTGGGACAGG + Exonic
1138620600 16:58208023-58208045 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1139589687 16:67926730-67926752 TCCTGGTTCCTTCCTGGTCCCGG + Intronic
1140707925 16:77648331-77648353 GTCCAGCTCCTAACTGGTACTGG - Intergenic
1141617659 16:85219465-85219487 GCCTGGGTCCTACCTGGTCAGGG + Intergenic
1141929739 16:87194217-87194239 GCCTGGTTCCTAACAGGTCATGG + Intronic
1142311597 16:89317387-89317409 TCCTGGGTCCCACCTGGTACAGG + Intronic
1142352604 16:89586973-89586995 GCCTGGATCCCAGCTGGCACTGG + Intronic
1143083904 17:4401579-4401601 GCCTGGTTCCTAACAGGCCAGGG - Intergenic
1144557872 17:16297878-16297900 GCCTGGTTCCTAACAGGCCACGG - Intronic
1144580946 17:16459132-16459154 GCCTGCTTCCTGCCTGGTGCAGG + Intronic
1146168486 17:30612510-30612532 GCCTGGTTCCTAACAGACCCTGG + Intergenic
1146221454 17:31026010-31026032 GCCTGGTTCCTAACAGACCCTGG + Intergenic
1147392875 17:40121482-40121504 GCCTGGATCCTGACTGGTCCAGG + Intergenic
1148709070 17:49663113-49663135 GCCTGGTTCCTAACAGGCCATGG - Intronic
1149817707 17:59742667-59742689 GCCTGGTTCCTAACAGGCCAGGG - Intronic
1150199887 17:63344047-63344069 GCCTGGTTCCTAACAGGCCACGG - Intronic
1150532848 17:66003674-66003696 GCCTGGTTCCTAACAGGCCATGG - Intronic
1150882248 17:69043355-69043377 GCCTGGTACCTAACTGGCCATGG + Intronic
1151026711 17:70685606-70685628 GCCTGGTTCTTAACAGGTCATGG - Intergenic
1151254583 17:72866054-72866076 GCCTGGTTCCTAACAGGCCATGG - Intronic
1151275795 17:73033229-73033251 GCCTGGTTCCTAACAGGCCATGG + Intronic
1151573689 17:74940492-74940514 GCCTGGTTCCTAACAGGCCATGG - Intronic
1152851961 17:82642179-82642201 GCCTGGTTCCTAACAGGCCACGG - Intronic
1153377218 18:4393986-4394008 GCCAGGTTCCTAACTGGCCAGGG + Intronic
1153507290 18:5814263-5814285 GCCTGCTTCCTAACAAGTACTGG + Intergenic
1154368845 18:13738987-13739009 GCCTGGTTCCTAACAGGCCGTGG + Intronic
1155914182 18:31539760-31539782 GCCTGGTTCCTAACAGGCCATGG - Intronic
1157449942 18:47778426-47778448 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1159153537 18:64552945-64552967 GCCTGGTTCCTAACTGGCCACGG - Intergenic
1161168888 19:2803228-2803250 GTCTGCTTCCTAACTGTTAACGG - Intronic
1161309809 19:3587235-3587257 GCCTGGCTCCAAAGTGGTTCTGG - Intronic
1163193815 19:15699736-15699758 GCCTGGTTCCTAACATGCATCGG + Intergenic
1163347988 19:16756737-16756759 GCCTGGTTCCTAACAGGCCACGG - Intronic
1163520199 19:17787620-17787642 GCCTGGTTCACAGCTGGGACGGG + Intronic
1163687460 19:18719835-18719857 GCCTGGTTTCTGACAGGTGCCGG - Intronic
1164681055 19:30133996-30134018 GCCTGGTTCCTGCCTGCCACAGG - Intergenic
1166572438 19:43806091-43806113 GCCCCGTTCCTAACAGGTACTGG - Intronic
1166857009 19:45787212-45787234 GCCTGGTTCCTAACAGGCCACGG - Intronic
925439499 2:3872166-3872188 GCCTGGTTCCTAACAGGTGAGGG + Intergenic
925529307 2:4841997-4842019 GCCTGGTTCCTAACAGGCCATGG + Intergenic
925891432 2:8438137-8438159 GCCTGGTTCCTAACAGGCCATGG - Intergenic
928734224 2:34267055-34267077 GCCTGGCTCCTAACAGGCAAAGG - Intergenic
929184598 2:39080409-39080431 GCCTGGTTCCTAACAGGCCATGG + Intronic
930130825 2:47848225-47848247 GCCCAGTTCCTAACTGGCCCCGG - Intronic
931310982 2:61080346-61080368 CACTGGTTCCTAACTGGAATGGG + Intronic
931495693 2:62804725-62804747 GCCTGGTTCCTAACAGGCCACGG - Intronic
933813924 2:86050852-86050874 GTCTGGTTCCCAACTGGAAGTGG + Intronic
934479341 2:94621056-94621078 GCCTGGTTTCTTACTGGAAGTGG - Intergenic
934625803 2:95849913-95849935 GCCTGGTTCCTAACAGGTCATGG + Intronic
934741022 2:96722617-96722639 GCCTGGTTCCTAACAGGTTGGGG + Intronic
934807770 2:97251405-97251427 GCCTGCTTCCTAACAGGTCATGG - Intronic
934829740 2:97505782-97505804 GCCTGCTTCCTAACAGGTCATGG + Exonic
935633819 2:105234399-105234421 GCCTGGTTCCTAACAGGCCAGGG + Intergenic
936666770 2:114605971-114605993 GCCTTGTTCATAACAGGTAGTGG - Intronic
937017992 2:118623716-118623738 GCCTGGTTCCTAACAAGCAATGG - Intergenic
937448108 2:121975681-121975703 GCCTGGTCCCTCCCTGGTGCAGG - Intergenic
939199524 2:139017413-139017435 GCCTGGTTCCCAACCCTTACTGG + Intergenic
941327201 2:164131195-164131217 GCCTGGTTCCTAACAGGCCATGG - Intergenic
941504932 2:166330859-166330881 GCCTGGTTCCTAACAGGCCATGG + Intronic
941841645 2:170091592-170091614 GCCTGGTTCCTAACAGGCCTTGG - Intergenic
942210783 2:173667446-173667468 GGCTGGGTCCTAACTGGTCATGG + Intergenic
943618455 2:190120074-190120096 GCCTGGTTCCTAACAGGCCACGG - Intronic
943745199 2:191454914-191454936 GCCTGGTTCCTAACAGGCCATGG + Intergenic
943979499 2:194529853-194529875 GCCTGGTTCCTAACCAGGACAGG + Intergenic
944237953 2:197457199-197457221 GCCTGGTTCCTAACAGGCCACGG + Intronic
944260762 2:197673506-197673528 ACCTGGATCCTATTTGGTACAGG - Intronic
944300884 2:198123678-198123700 GTCTGGTTCCTAACAGGTTACGG - Intronic
945057892 2:205884103-205884125 GCCTGGTTCCTAACAGGCCATGG - Intergenic
946042874 2:216797589-216797611 GTTTGTTTCCTAACTGGTACAGG - Intergenic
946099682 2:217309255-217309277 GCCTGGTTCCTAACTGGTACTGG + Intronic
947704620 2:232264249-232264271 GCCTGGTTCCTAACAGGTCATGG + Intronic
948014673 2:234678280-234678302 ACCTGGTTCCTAACGGGTACTGG - Intergenic
948926379 2:241101445-241101467 GCCTGGTTCCTAATAGGCAAGGG + Intronic
948977956 2:241475382-241475404 GCCTGGTTCCTAACAGGCTATGG - Intronic
1168732206 20:94627-94649 GCCTGGTTCCTAACAGGCCATGG + Intronic
1169471335 20:5888082-5888104 ACCAGATTCCTAATTGGTACAGG + Intergenic
1169482889 20:6001339-6001361 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1169640034 20:7741474-7741496 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1170195877 20:13689015-13689037 GCCTGGTTCCTAACAGGCCAGGG - Intergenic
1170684425 20:18556209-18556231 GCCTGGTTCCTAACAGGCCAAGG + Intronic
1172757122 20:37293546-37293568 GCCTGGTTCCTAACAGGCCATGG + Intronic
1173810368 20:45951711-45951733 GCCTGGTTCCTAACAGGCCATGG + Intronic
1174633703 20:51980431-51980453 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1174747744 20:53080738-53080760 GCCTGGTTCCTAACAGGCCACGG + Intronic
1175577672 20:60074473-60074495 AACTGGTTCCTAACCTGTACCGG + Intergenic
1179074454 21:38106940-38106962 GCCTGGTTCCTAACAGGCCAGGG - Intronic
1180098373 21:45572322-45572344 GCCTGGTTCCTACCTGGGGAGGG + Intergenic
1180212316 21:46302215-46302237 GCCCTGTTCCTAACTGGGGCTGG + Intronic
1180244842 21:46540069-46540091 GCCTGGATCCTAACAGGCACAGG - Intronic
1180257014 21:46636270-46636292 ACCTGGGTCCAAACTGGGACGGG - Exonic
1181829577 22:25549202-25549224 GCCCAGTTCCTCACAGGTACCGG - Intergenic
1183850555 22:40583552-40583574 GCCTGGTTCCTAACAGGCCATGG - Intronic
1184629695 22:45766223-45766245 GCCTGGTTCCTAACAGGCCATGG - Intronic
951553592 3:23898802-23898824 GCCCGGTTCCTAACAGGCCCTGG - Intronic
951944186 3:28115459-28115481 GCCTGGTTCCTAACAGGCCAGGG - Intergenic
952248673 3:31627152-31627174 GCCTGGTTCCTAACAGGCCACGG - Intronic
953627849 3:44585367-44585389 CCCAGGTTCCTCACTGGTAACGG - Intronic
953853067 3:46480527-46480549 GCATGGTCCCTATCTGGTGCTGG + Intronic
953973702 3:47366946-47366968 GCCAGTTTCCTAACTTGTACAGG - Intergenic
954431107 3:50471287-50471309 GCCAGGTCCCCCACTGGTACAGG - Intronic
954910612 3:54104202-54104224 GCCTGGTTCCTAACAGGCCATGG - Intergenic
955123212 3:56082755-56082777 GCCTGGTTCCTAACAGGCCCTGG - Intronic
956331796 3:68118440-68118462 GCCCGGTTCCTAACAGGTAACGG + Intronic
957016333 3:75069107-75069129 GCCCGGTTCTGAGCTGGTACTGG + Intergenic
957724246 3:84044453-84044475 GCCTGGTTCCTAACAGGCCACGG + Intergenic
957827775 3:85471035-85471057 GTTTGTTTCCTAAGTGGTACAGG - Intronic
957842319 3:85687832-85687854 GCCTGGTTCCTAACAGGTCATGG - Intronic
959043256 3:101442532-101442554 GCCTGGTTCCTAACAGGCCACGG + Intronic
959045013 3:101464337-101464359 GCCTGGTTCCTAACAGGCCATGG - Intronic
959279836 3:104323822-104323844 GCCTGGCTCCAGGCTGGTACTGG - Intergenic
960728900 3:120702487-120702509 GCCTGGTTCCTAACAGGCCATGG + Intronic
960823421 3:121758142-121758164 GCCTGGTTCCTAACAGGCCACGG + Intergenic
961230513 3:125303365-125303387 GCCGGGTTCCTAACAGGTCACGG - Intronic
961641455 3:128367251-128367273 GCCAGCATCCTAACTGTTACAGG - Intronic
962181142 3:133207324-133207346 ACCTGGCTCCTCACTGGGACTGG - Intronic
962285445 3:134082213-134082235 GCCTGGTTCCTAACAGGCCCAGG - Intronic
962332205 3:134488055-134488077 GCCTGGTTCCTAACAGGCCACGG - Intronic
962519654 3:136186428-136186450 GCCTGGTTCCTAACAGGCCAAGG - Intronic
963736691 3:149025428-149025450 GCCTGGTTCCTAACAGGCCATGG + Intronic
963820930 3:149892538-149892560 GCCCATTTCCTAACAGGTACGGG - Intronic
964613934 3:158642547-158642569 GCCTGGTTCCTAACAGGCCATGG + Intergenic
964662130 3:159131746-159131768 GCCAAGATCCCAACTGGTACAGG + Intronic
965724931 3:171705079-171705101 GCCTGGTTCCTAACAGGCTGGGG + Intronic
967786289 3:193500693-193500715 GCCTGGTTCCTAACAGGCCATGG + Intronic
968055237 3:195686683-195686705 GCCTGGTTCCTAACAGGCCATGG - Intergenic
968100665 3:195962529-195962551 GCCTGGTTCCTAACAGGCCATGG + Intergenic
968789508 4:2649803-2649825 GCCTGGTTCCTAACAGGCCATGG - Intronic
968855753 4:3120495-3120517 GCCTGGTTCCTAACAGGCCATGG - Intronic
970539867 4:17066923-17066945 GCCTGGTACGTAACAGGTGCTGG - Intergenic
972250317 4:37292932-37292954 GCCTGGTTCCTAACAGGCCACGG + Intronic
972623663 4:40774341-40774363 TCCTGTTTCCTAACTGTTTCTGG - Exonic
972718886 4:41675856-41675878 GCCTGGATCTTAGGTGGTACTGG + Intronic
973018120 4:45166780-45166802 GCCTGGTTCCTAACAGGTCATGG + Intergenic
973117279 4:46477298-46477320 GCCTGGTTCCTAACCAGCAATGG - Intergenic
973650796 4:52995395-52995417 GCCTGGTTCCTAACAGGCCGTGG + Intronic
974502525 4:62726005-62726027 GCCTGGTTCCTAACAGGCCACGG + Intergenic
975882662 4:78929113-78929135 GCCTGGTTCCTAACAGGCCACGG + Intronic
975932090 4:79537471-79537493 GCCTGGTTCCTAACAGGCCATGG - Intergenic
976122767 4:81801146-81801168 GCCTGGTTCCTAACAGGCCACGG + Intronic
976968134 4:91070513-91070535 GCCTGGTTCTTAACAGGTCATGG - Intronic
977235145 4:94499683-94499705 GCCTGGTTCCTAACAGGCCATGG - Intronic
978499680 4:109395815-109395837 GCCTGGTTCCTAACAGGTCATGG - Intergenic
978651388 4:111009840-111009862 GCCTGGTTCCTAACAGGCTATGG - Intergenic
979286179 4:118927189-118927211 GCCTGGATCCTAGCAGGTTCTGG + Intronic
979464090 4:121016607-121016629 GCCTGGTTCCTAACAGGCCACGG + Intergenic
979700893 4:123666679-123666701 GCCTGGTTCCTAACAGGCCACGG + Intergenic
980193097 4:129551055-129551077 GCCTGGTTCCTAACAGGCGATGG - Intergenic
981305929 4:143247076-143247098 GCCTGGTTCCTAACAGGCCATGG - Intergenic
981784492 4:148462144-148462166 GCCTGGTTCCTAACAGGCCATGG - Intergenic
981849865 4:149217840-149217862 GGCTGGTTCATGACTGGTGCTGG - Intergenic
981944951 4:150330715-150330737 GCCTGGTTCCTAACAGGCTGTGG + Intronic
982096772 4:151930550-151930572 GCCTGGCTCCTAACAGGAAGGGG - Intergenic
982747317 4:159118096-159118118 GCCTGGTTCCTAACAGGCCATGG - Intronic
982763722 4:159319195-159319217 GCCTAGTTCCTAACAGGTCAGGG - Intronic
983375454 4:166921967-166921989 GCCCGGTTCCTAACAGGTGACGG - Intronic
984466724 4:180109224-180109246 GCCTGGTTCCTAACAGGCCAAGG - Intergenic
985110368 4:186541556-186541578 GCCTGGTTCCTAACAGGTCACGG - Intronic
985502407 5:257256-257278 GCCTGGTTCCTAACAGGCCATGG - Intergenic
986580745 5:9263278-9263300 GCCTGGTTCCTAACAGGCCATGG - Intronic
986778126 5:11038231-11038253 GCCTGGTTCCTAACAGGCCATGG - Intronic
987222483 5:15804617-15804639 GCTTGGTTCCTAACAGGTCATGG - Intronic
988112073 5:26834810-26834832 GCCTGGTTCCTAACAGGCAATGG - Intergenic
988882276 5:35516588-35516610 GCCTGGTTCCTAACAGGCCATGG - Intergenic
989469180 5:41795293-41795315 GCCTGGTTCCTAACAGGCCATGG + Intronic
990243570 5:53839259-53839281 ACCAGGTTCCAAGCTGGTACTGG - Intergenic
990468902 5:56095269-56095291 GCCTGCTTCCTAACAGGTGATGG + Intergenic
990941773 5:61209412-61209434 GCCTGGTTCCTAACAGGCCATGG + Intergenic
991095056 5:62731195-62731217 GCCTGGTTCCTAACGGGCCATGG + Intergenic
991365591 5:65864778-65864800 GCCTGGTTCCTAACAGGCCATGG + Intronic
991672310 5:69060607-69060629 GCCTGGTTCCTAACAGGCTACGG + Intergenic
992307880 5:75462518-75462540 GCCTGGTTCCTAACAGGCCATGG + Intronic
992414839 5:76542424-76542446 GCTTCGTTCCTTACCGGTACCGG + Intronic
992428834 5:76687533-76687555 GCCTGGTTCCTAACAGGCCATGG - Intronic
994151168 5:96449286-96449308 ACCTGGTTCCTAACAGGTCACGG - Intergenic
995359641 5:111280754-111280776 GCCTGCTTCCTTTCTGGTCCTGG - Intronic
995464157 5:112433711-112433733 GCCTGGTTCCTAACAGGGGTTGG + Intergenic
996956884 5:129193870-129193892 CCCTGATACCTAACTGGTAAAGG + Intergenic
997172411 5:131736513-131736535 GCCTGGTTCCTAACAGGCCATGG - Intronic
1000105259 5:158053216-158053238 GCCTGGTTCCTAACAGGCCACGG + Intergenic
1000776591 5:165427228-165427250 GCCTGGTTCCTAACAGGCCAAGG + Intergenic
1001086473 5:168703352-168703374 GCCTGGTTCCTAACGGGGACCGG - Intronic
1001211249 5:169812093-169812115 GCCTGGTTCCTAACAGGCCATGG - Intronic
1002954161 6:1845860-1845882 GCCTGGTTCCTAACAGGCCATGG + Intronic
1003007217 6:2393097-2393119 GCCTGGTTCCTAACAGGCAATGG + Intergenic
1003143429 6:3490369-3490391 GCCTGGTTCCTAACGGGCCATGG - Intergenic
1004632665 6:17436776-17436798 GCCTGGTTCCTAACAGGGATGGG - Intronic
1004672518 6:17810933-17810955 GCCTGGTTCCTAACAGGCCACGG + Intronic
1004897117 6:20159182-20159204 GCCTGGTTCCTAACAGGCCATGG - Intronic
1004897283 6:20161015-20161037 GCCTGGTTCCTAACAGGCCATGG - Intronic
1006412616 6:33883713-33883735 GCCTGGTTCCTAATAGGTCATGG - Intergenic
1006512854 6:34531008-34531030 GCCTGGTTCCTAACAGGCCACGG + Intronic
1006777142 6:36603736-36603758 GGCTTGTTCCTAACAGGAACAGG - Exonic
1008320467 6:50105920-50105942 GCCTGATTTCTCACTTGTACAGG - Intergenic
1008586721 6:52957457-52957479 GGCTGGTTCCTGACTGGGATTGG - Intergenic
1008681669 6:53878675-53878697 TCCCGGTTCCTCACAGGTACTGG + Intronic
1008705093 6:54148159-54148181 GCCAATTTCCTCACTGGTACTGG + Intronic
1011789661 6:90885108-90885130 ACCTGGCTCCAGACTGGTACTGG + Intergenic
1012534165 6:100275667-100275689 GCCTGGTTCCTAACAGGCTAAGG + Intergenic
1013546042 6:111158601-111158623 GCCTGGTTCCTAACAGGCTCGGG + Intronic
1013586506 6:111583357-111583379 GCCTGGTTCCTAACAGGCAATGG - Intronic
1013698011 6:112727286-112727308 ACCTGGTTTCTGAATGGTACTGG + Intergenic
1014151520 6:118061942-118061964 GCCTGGTTCCTAACAGGCCACGG + Intronic
1014292343 6:119573102-119573124 GCCTGGTTCCTAACAGGTGATGG + Intergenic
1014469083 6:121792986-121793008 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1014650417 6:124029713-124029735 GCCTGGTTCCTAACAGGCAATGG - Intronic
1015465552 6:133544542-133544564 GCCTGGTTCCTAACAGTCCCAGG - Intergenic
1017260139 6:152376256-152376278 GCCTGGTTCCTAACAGGCCAGGG + Intronic
1017784848 6:157747122-157747144 GCCTGGTTCCTAACAGGCCATGG + Intronic
1018230002 6:161666209-161666231 GCCTGGTTCCTAACAGGCTACGG - Intronic
1018558177 6:165072012-165072034 GCCTGGTTCCTAACAGGTATTGG - Intergenic
1018664724 6:166125218-166125240 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1019389323 7:776811-776833 GTCTGGTTCCTAACAGGACCCGG - Intronic
1019834104 7:3363809-3363831 GCCTGGTTCCTAACAGGTCATGG + Intronic
1019866130 7:3712108-3712130 GCCTGGTTCCTAACAGGCCATGG - Intronic
1020383497 7:7570866-7570888 GCCTGGTTCCTAACAGGCCAGGG + Intronic
1020549780 7:9588629-9588651 GCCTGGTTCCGAACTATTGCTGG - Intergenic
1020962675 7:14825665-14825687 GCCTGGTTCCTAACAGGCCATGG + Intronic
1021589422 7:22244341-22244363 GCCTGGTTCCTAACAGGCCATGG - Intronic
1021951763 7:25781907-25781929 GACTGGTTCCTAGCTGATATAGG + Intergenic
1022546885 7:31198168-31198190 GCCTGGTTCCTAACAGGCTACGG + Intergenic
1023004581 7:35849512-35849534 GCCTGGTTCCTAACAGGCCACGG + Intronic
1023701332 7:42893962-42893984 GCCTGGCTCCAGACTGGCACTGG - Intergenic
1024015212 7:45307478-45307500 GCCTGGTTCCTAACAGGCCACGG + Intergenic
1024393483 7:48840823-48840845 GCCTGGTTCTTAAGCAGTACTGG - Intergenic
1024493721 7:50017446-50017468 GCCTGGTTCCTAACAGGCCATGG + Intronic
1026624406 7:71979623-71979645 GCCTGCTTCCTAACAGGTCATGG + Intronic
1026663456 7:72322402-72322424 GCCTGGTTCCTAACAGGCCATGG + Intronic
1027747022 7:82089043-82089065 GCCCGGTTCCTAACAGGTCAGGG + Intronic
1028570295 7:92279223-92279245 GCCTGGTTCCTAACAGGCCATGG + Intronic
1029531054 7:101125603-101125625 GCCTGGTTCCTAACAGGCTATGG - Intergenic
1030859999 7:114613819-114613841 GCCTGGTAACTACTTGGTACGGG - Intronic
1030939507 7:115628945-115628967 GCCAGATTCCTAACAGGTACCGG - Intergenic
1032615121 7:133460315-133460337 GCCTGGTTCCTAACAGGCCATGG + Intronic
1032903299 7:136335722-136335744 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1033292522 7:140099547-140099569 GCCTGGTTCCTAACAGGCCACGG - Intronic
1034085583 7:148319508-148319530 GCCTGGTTCCTAACAGGCCACGG - Intronic
1034595766 7:152189916-152189938 GCCGGGTTCCTAACAGGTCATGG - Intronic
1036034854 8:5007851-5007873 GCCATGTTCCTAACAGGAACTGG + Intergenic
1037096161 8:14990344-14990366 GCCTGGTTCCTAACAGGCCAGGG - Intronic
1037355963 8:18019787-18019809 GCCTGGTTCTTAACAGGCCCTGG + Intronic
1037469497 8:19193587-19193609 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1037742484 8:21618556-21618578 GCCTGGTTCCTAATAGGCCCTGG - Intergenic
1037953998 8:23039249-23039271 GCCTGGTTCCTAACAGGCCACGG + Intronic
1038676006 8:29623550-29623572 GCCTGGTTCCTAACAGGCCACGG + Intergenic
1038695007 8:29798605-29798627 GCCTGGTTCCTAATAGGTCATGG - Intergenic
1038829140 8:31037399-31037421 GCCTGGTTCCTAACAGGCCATGG + Intronic
1039042331 8:33419556-33419578 GCCTGGTTCCTAACAGGCCACGG + Intronic
1039560131 8:38505903-38505925 TCCTGGTTCTCAACTGGGACAGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1039812520 8:41062198-41062220 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1039909466 8:41812935-41812957 GCCTGGTTCCTAACAGGCCCCGG + Intronic
1039912954 8:41839120-41839142 GCATGGCTACTAACTGGTGCAGG - Intronic
1039956463 8:42210678-42210700 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1040099679 8:43487453-43487475 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1041819131 8:62009645-62009667 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1042406183 8:68407995-68408017 GCCCGGTTCCTAACAGGTCATGG - Intronic
1044067146 8:87712838-87712860 GCCTGGTTCCTAACAGGCCAAGG - Intergenic
1044246838 8:89958249-89958271 GCCTGGTTCCTAACAGGTGATGG + Intronic
1044557111 8:93575088-93575110 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1044866391 8:96575096-96575118 GCCTGGTTCCTAACAGGCCACGG + Intronic
1045006644 8:97921891-97921913 GCCTGGTTCCTAACAGGCCACGG - Intronic
1045098305 8:98821103-98821125 GCCTGGTTCCTAACAGGCCATGG - Intronic
1045175991 8:99725294-99725316 GCCTGGTTCCTAACAGGCCATGG - Intronic
1045334020 8:101182164-101182186 GCCTGGTTCCTAACAGGCCAAGG + Intronic
1045531907 8:102993227-102993249 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1046062707 8:109158201-109158223 GCCTGGTTCCTAACAGGCCACGG + Intergenic
1046259637 8:111750937-111750959 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1048117095 8:131535843-131535865 GAGTGGTTACTAATTGGTACAGG - Intergenic
1049918497 9:341745-341767 GCCTGGTTCCTAACAGGCCAAGG - Intronic
1051378638 9:16431952-16431974 GCCTGGTTCCTAACAGGCCATGG + Intronic
1051614056 9:18990612-18990634 GCCTGGTTCCTAACAGGCTACGG - Intronic
1051849956 9:21494801-21494823 CCCTGGTTCCTAACAGGCAATGG + Intergenic
1052868482 9:33481168-33481190 GGCTGGTTCCTAACAGGTCATGG - Intergenic
1053678487 9:40462511-40462533 GCCTGGTTTCTTACTGGAAGTGG + Intergenic
1053928473 9:43090868-43090890 GCCTGGTTTCTTACTGGAAGTGG + Intergenic
1054285238 9:63162432-63162454 GCCTGGTTTCTTACTGGAAGTGG - Intergenic
1054291565 9:63298049-63298071 GCCTGGTTTCTTACTGGAAGTGG + Intergenic
1054389581 9:64602591-64602613 GCCTGGTTTCTTACTGGAAGTGG + Intergenic
1054506131 9:65913784-65913806 GCCTGGTTTCTTACTGGAAGTGG - Intergenic
1055399230 9:75905634-75905656 GCCTGGTTCCTAACAGGCCACGG - Intronic
1055784302 9:79855755-79855777 GCCTGGTTCCTAACAGGCCTTGG - Intergenic
1057775570 9:98005873-98005895 GCCTGGTTTCTAACAGGTCATGG - Intronic
1058043999 9:100336290-100336312 GCCTGGTTCCTAACAGGCCGCGG - Intronic
1058068119 9:100572050-100572072 GCCTGGTTCCTAACAGGCCATGG + Intronic
1059361816 9:113749428-113749450 GCCTGGTTCCTAACAGGCCACGG - Intergenic
1059885856 9:118743897-118743919 GCCTGGTTCCTAACAGGCCATGG + Intergenic
1061590108 9:131592577-131592599 GGCTGGCTCCTACCTGGAACAGG - Intronic
1061686267 9:132282146-132282168 GGCTGGTTCCCAAGTGGTAGTGG - Intronic
1061844265 9:133378141-133378163 GCCTGGTTCCTAACAGGCCACGG + Intronic
1062187374 9:135225079-135225101 GCCTGGTTCATGCCTGGAACGGG - Intergenic
1186342005 X:8655472-8655494 GCCTGGTTCCTAACAGGCCATGG + Intronic
1187681485 X:21771401-21771423 ACCTGGCTCCAAGCTGGTACTGG - Intergenic
1188100426 X:26075940-26075962 GCCTGGTTCCTAACAGGCCATGG - Intergenic
1188283960 X:28305333-28305355 GCCTGGTTCCTAACGGGCCACGG + Intergenic
1189503311 X:41584705-41584727 GCCTGGTTCCTAACAGGCCACGG + Intronic
1193324383 X:80162367-80162389 GCCTGGTTCCTAAGAGGTCATGG - Intergenic
1193573017 X:83167333-83167355 GCCTGGTTCCTAACAGGCTATGG - Intergenic
1194282261 X:91967298-91967320 GCCTGGTTCCTAACAGGCCATGG - Intronic
1195124271 X:101790063-101790085 GCCTGGTTCCTAACAGGCCAGGG - Intergenic
1197641709 X:128975226-128975248 GCCTGGTTCCTAACAGGCCACGG + Intergenic
1199389661 X:147264173-147264195 GCCTGGTTCCTAACAGGTCATGG - Intergenic
1200599850 Y:5191949-5191971 GCCTGGTTCCTAACAGGCCATGG - Intronic
1201330079 Y:12809184-12809206 GCCTGGTTCATAACTGGAAGTGG + Intronic
1201848684 Y:18452406-18452428 GCCTGGATCCCAACTGCTGCTGG - Intergenic
1201884633 Y:18867969-18867991 GCCTGGATCCCAACTGCTGCTGG + Intergenic
1202603496 Y:26618464-26618486 GCCTGGTTCCTGACAGGTCAGGG + Intergenic