ID: 946099829

View in Genome Browser
Species Human (GRCh38)
Location 2:217310533-217310555
Sequence GGCAAATTGAGTTTCTGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946099829 Original CRISPR GGCAAATTGAGTTTCTGTAA TGG Intronic
902561762 1:17281966-17281988 GGCAAATTGAGTTCTTTTAGGGG - Intronic
903142990 1:21350793-21350815 GGGCAGTTGAGTTTCTGTGAAGG + Intergenic
905258219 1:36699267-36699289 GGCAACTTGAGTTTATGTGTGGG + Intergenic
906827711 1:48999404-48999426 TTAAAATTGAGTTTCTATAATGG - Intronic
907949927 1:59172871-59172893 GTTAAATGGAATTTCTGTAAAGG + Intergenic
908016641 1:59846015-59846037 GACAAATTTAATTTCTTTAATGG + Intronic
908874413 1:68654571-68654593 AGTAAATTGTTTTTCTGTAAAGG + Intergenic
910779719 1:90916825-90916847 AGAAAATGAAGTTTCTGTAATGG + Exonic
911315716 1:96354490-96354512 GGGAAATTGGGTTTTTGGAAGGG - Intergenic
911586313 1:99695293-99695315 GGGAAATTCAGTTTCTGTCCTGG - Intergenic
912926171 1:113915221-113915243 GGCAGATTTTTTTTCTGTAAGGG - Intergenic
914589260 1:149092072-149092094 GGTAAATGGAATTTCTGAAATGG + Intronic
919364824 1:196645457-196645479 GGCCAATTGATTTTCAATAAAGG + Intergenic
921173094 1:212566384-212566406 GGAAAATTGAGTTTCAGAGAAGG - Intronic
921197606 1:212774602-212774624 TTTAAATTGAATTTCTGTAATGG - Intronic
921949806 1:220917559-220917581 GGGAAAGTGCTTTTCTGTAAAGG - Intergenic
923463047 1:234223852-234223874 GGCAAATTTAGTTTCTGGGGAGG + Intronic
924055471 1:240119995-240120017 GGCAAACTGAAGTTCTGTAGGGG + Intronic
1064263601 10:13806354-13806376 GTAAAAATGAGTTTCTCTAAGGG + Intronic
1065138304 10:22694542-22694564 AGCAAATTGTATTTATGTAAGGG - Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1067490043 10:46689959-46689981 TGCAAATTGTGTATCTGTTAAGG - Intergenic
1067604623 10:47650424-47650446 TGCAAATTGTGTATCTGTTAAGG + Intergenic
1069470298 10:68682437-68682459 TACAAATTGACTTTCAGTAATGG + Intronic
1070524684 10:77285599-77285621 GGCAAATTGAGTTTATGGTGGGG - Intronic
1070618966 10:77992000-77992022 GACAAAAGGAGTTTCTGTAAGGG + Intronic
1071620178 10:87111855-87111877 TGCAAATTGTGTATCTGTTAAGG + Intronic
1076902140 10:133344924-133344946 GGCAACTTCAGTTCCCGTAACGG + Intronic
1078381408 11:10845103-10845125 TGCAAAGTGAGTTTCTGTTAAGG + Intronic
1079759870 11:24315597-24315619 GGCAAATTGTGTTCCTGAGATGG + Intergenic
1079828019 11:25223644-25223666 GGCAAGTTGTTTTTCTGTTATGG + Intergenic
1087283567 11:96240164-96240186 AGCTAATTGAGTTTTTGAAATGG - Intronic
1088966607 11:114728630-114728652 GGCCAATGGATATTCTGTAAAGG + Intergenic
1090864438 11:130685950-130685972 GGTCAATTGATTTTCAGTAAGGG + Intronic
1091327412 11:134701479-134701501 GGCAGATTCAGTGTCTGTGAAGG - Intergenic
1091581023 12:1789795-1789817 GGTAAATTTAGTTTTTGGAAGGG + Intergenic
1092655726 12:10683020-10683042 GGAAACTTGACTTTGTGTAAAGG - Intergenic
1093410461 12:18859005-18859027 GCCAAATTGTGTTTCTGTTTAGG - Intergenic
1093794623 12:23296773-23296795 GGCAAATTTTTTTTCTGTAAAGG - Intergenic
1094681466 12:32671068-32671090 AGCAAATTGAGTTTGTGTGAGGG + Intergenic
1097522375 12:60685545-60685567 GGGAAATAGACTTTCTGAAAAGG - Intergenic
1101623544 12:106415887-106415909 GGAAAAGTGACTTTCTGGAAAGG - Intronic
1101866673 12:108525394-108525416 GGCAAACTTCGTTTCTGTATCGG - Intronic
1104764386 12:131316992-131317014 GTCCAATTGAGTGTCTGTCATGG - Intergenic
1107772378 13:43802652-43802674 TGCTAATTGAGATTTTGTAAAGG - Intergenic
1107774512 13:43823601-43823623 GGAAACTTGAGTTTCTCTGAAGG - Intergenic
1108531254 13:51329407-51329429 TGCAAAGTGAATTTTTGTAAAGG + Intergenic
1109667143 13:65553807-65553829 GCCAAATTGAGTGTCTGTTGTGG + Intergenic
1109679042 13:65722280-65722302 GGTAAATTGACCTTGTGTAATGG + Intergenic
1109959429 13:69611615-69611637 GGGGAATTGAGTTTCAGTGATGG - Intergenic
1110147174 13:72205655-72205677 GACAACTTGAGTTTCTGAACAGG - Intergenic
1111061644 13:83027074-83027096 GGCTAAGTGATTTTCTTTAATGG - Intergenic
1111731711 13:92085242-92085264 GACAGATTGAGATTCAGTAAAGG + Intronic
1111900812 13:94197457-94197479 GGCCAATTCAGTTTCTGGGAAGG + Intronic
1112035917 13:95496586-95496608 GGCAGATTGAGTTCCTGGAGAGG + Intronic
1112072850 13:95874038-95874060 GCCAAATTGAGTTCCAGTACTGG - Intronic
1112157466 13:96833239-96833261 GGCACATTGACTTTCTGTTGAGG + Exonic
1118863028 14:69680239-69680261 GGATACTTGAGTTTCTGTCAAGG + Intronic
1120670143 14:87353850-87353872 GGCAAAGAGAGTTTGTGTAGGGG + Intergenic
1123670209 15:22649006-22649028 GACAGATTGAGATTCAGTAAAGG + Intergenic
1124526182 15:30455424-30455446 GACAGATTGAGATTCAGTAAAGG + Intergenic
1124593404 15:31073290-31073312 GGCAAATTGATTTTTGGCAAGGG - Intronic
1124772472 15:32552260-32552282 GACAGATTGAGATTCAGTAAAGG - Intergenic
1125072001 15:35566139-35566161 AACAAAAGGAGTTTCTGTAACGG - Intergenic
1125432008 15:39605028-39605050 GGCAGATTGACTTTTGGTAAGGG - Intronic
1127596981 15:60494909-60494931 AGCTAATTGAATTTCTCTAAGGG - Intronic
1130066146 15:80606550-80606572 GGCAAATAAAGTTTCTGCAGAGG - Intergenic
1130804645 15:87306770-87306792 GGTAAGTTGAGTTGCTTTAAAGG + Intergenic
1131345878 15:91647655-91647677 GGCAAATTCAGTTTCTGGTGAGG - Intergenic
1135852619 16:25978306-25978328 AGCAAACTTACTTTCTGTAAAGG + Intronic
1137309382 16:47239102-47239124 GGCAAATTCAGTGTCTGGTAAGG - Intronic
1139818771 16:69701589-69701611 GACAAATTTAGTTTATATAAAGG - Intronic
1140649268 16:77068904-77068926 GGCATATGGAGTTTTTGTTATGG - Intergenic
1143395238 17:6589330-6589352 GGCAGATTGAGTGTCTGTCGAGG - Intronic
1145810640 17:27761943-27761965 GGCAAATAGAGTCTCTGCCAAGG + Intronic
1146139723 17:30355148-30355170 GGCAACTTGAGTTTCTGCAATGG - Intergenic
1147566008 17:41536824-41536846 GACAATTTGAGTTTCTGGACGGG - Intergenic
1149714227 17:58771768-58771790 GGCAAATTAATTTTTTATAATGG + Intronic
1150944845 17:69733721-69733743 GGAAATTTGGGTTTGTGTAAGGG + Intergenic
1152562279 17:81084573-81084595 GGGAACTTGAGTCTCTGCAAAGG - Intronic
1154077472 18:11217922-11217944 TGCAACTTGAGGTTCTGAAAAGG + Intergenic
1156080377 18:33326875-33326897 GGCTAATTGAGTTTTCGCAAAGG - Intronic
1157151331 18:45221620-45221642 GACACATTGAGTATCTGTATGGG - Intronic
1157797338 18:50587337-50587359 GGCAAATTCGGTGTCTGTGAGGG - Intronic
1158226172 18:55203946-55203968 GGCAAAGTCAGTTTCTGGTAAGG + Intergenic
1158372900 18:56829850-56829872 TGCAAGTTGTGTTTATGTAAAGG + Intronic
1158426221 18:57341925-57341947 GAAAAACTGAGTTTCTATAAAGG + Intergenic
1158464215 18:57675477-57675499 TGGAAATTAAGTGTCTGTAATGG - Intronic
1160130353 18:76219695-76219717 GGTAAAGTGAGTTTCTGAATGGG - Intergenic
1160191529 18:76718359-76718381 GACAAATTGATTTTCAGCAAAGG + Intergenic
1163242460 19:16072565-16072587 GGCAAACTGAGTCTCTGAAAGGG - Intronic
1164167702 19:22697120-22697142 GGGAAATTGTATCTCTGTAAAGG - Intergenic
926470278 2:13246820-13246842 TGCAAACTGTTTTTCTGTAAAGG - Intergenic
927184085 2:20469741-20469763 GGCAAATTGAGTTGCTGTGCGGG + Intergenic
927316467 2:21688964-21688986 GGCAAATCGTGTATCTGTACAGG + Intergenic
928291708 2:30044611-30044633 GGCTAATTGATTTTCAATAAAGG - Intergenic
929471633 2:42199654-42199676 GGTAGACTGAGGTTCTGTAAAGG + Intronic
930541485 2:52712471-52712493 GGCAAATTGAGGCTCAGAAAAGG - Intergenic
930579642 2:53194922-53194944 GGCAAATTCATTTTCTGAACAGG - Intergenic
930683398 2:54281829-54281851 AACAAATTGAATTTGTGTAATGG - Intronic
931069084 2:58624028-58624050 GACAACTGCAGTTTCTGTAAAGG - Intergenic
931531297 2:63217377-63217399 GGCAATTTATTTTTCTGTAAAGG - Intronic
931645396 2:64417340-64417362 GGCAGATTCAGTTTCTGGTAAGG + Intergenic
931857741 2:66321176-66321198 GGCCAATTGATTTTCAATAAGGG + Intergenic
932362796 2:71122920-71122942 GGCAGATTGAGTTGCTGGGAAGG - Intronic
932792276 2:74664540-74664562 TGCTAATTGAGTTTCTAGAAAGG + Intronic
934483793 2:94681235-94681257 TGCCAATTGACTTTCAGTAATGG + Intergenic
934650282 2:96086930-96086952 GTCAAATTGATTTTCAGCAAAGG + Intergenic
935240226 2:101171513-101171535 GGCAAAGAGAGTTTGTGCAAGGG - Intronic
936999002 2:118445739-118445761 GGCCAATTGATTTTTGGTAAAGG - Intergenic
937490804 2:122365404-122365426 GGCACATGGAGTGTCTGTGAGGG + Intergenic
937638155 2:124180209-124180231 AGGAAATTGATTTTCTGTGATGG - Intronic
938917859 2:135961678-135961700 AGGAACTTGAGTTTCTTTAAGGG - Intronic
939304309 2:140390315-140390337 GGTCAATTGAGTTTCAATAAAGG + Intronic
939312448 2:140500468-140500490 GGCTAAATGACTTTCTTTAAAGG - Intronic
940562222 2:155313163-155313185 GAGAAATTGAATATCTGTAATGG - Intergenic
943011828 2:182459643-182459665 GGCAACTAGAGTTTCTTTAGGGG - Intronic
944924896 2:204454503-204454525 GGCAAATTTACTTTCTTTTAAGG + Intergenic
944979577 2:205100695-205100717 GGAAAATTCATTTTCTTTAAGGG + Intronic
945921709 2:215761786-215761808 AGCACATTGATTTTCTGGAAGGG - Intergenic
946099829 2:217310533-217310555 GGCAAATTGAGTTTCTGTAATGG + Intronic
946775228 2:223131723-223131745 GTAAAATTGAGTTTTTGTACTGG - Intronic
947377949 2:229516567-229516589 GGAAAATTGAGATTCTTTATTGG - Intronic
1169889027 20:10433517-10433539 GTCATATTGAGTCTCTGAAACGG + Intronic
1169935365 20:10877836-10877858 GGCAATTGGACTTTCTGTCAGGG + Intergenic
1171514438 20:25717996-25718018 GGCTTGTTGAGTTTCTGTGAAGG + Intergenic
1173835120 20:46119720-46119742 GGCAAATTGAGGCTCAGAAAGGG + Intronic
1174627883 20:51930167-51930189 GGCAAATTTAGTTTCTAAAATGG + Intergenic
1176891616 21:14326405-14326427 GGAAAATTGATTTACTGTAGGGG - Intergenic
1177338458 21:19763851-19763873 GGCAAATTTAGTTTCTGGTTAGG - Intergenic
1181448064 22:22994003-22994025 TGCAAATTAAGTTTCTGTGCTGG + Intergenic
1183186088 22:36292403-36292425 GACAAATGGAGCTTCTGCAAAGG + Intronic
1183363291 22:37394119-37394141 GGCACAGAGAGTTTCAGTAAGGG - Intronic
1185401922 22:50623350-50623372 GGCAAACTGGGTCACTGTAAGGG + Intronic
949628244 3:5892308-5892330 AGAAAATTGAGTTTCAGAAAAGG - Intergenic
951496687 3:23336392-23336414 GGCAAATTAAGTTACTTTAGTGG + Intronic
952396220 3:32922688-32922710 GGCAAATTCAGTTACTGCAATGG - Intergenic
953150929 3:40323718-40323740 GGCCAATTGATTTTCAATAAGGG - Intergenic
953575042 3:44106257-44106279 TGTAAATTGAGTTTCCGTAAAGG + Intergenic
956095238 3:65708970-65708992 GGCAAACTGAGGTTTTATAAAGG + Intronic
956190728 3:66605732-66605754 AACACATTGAGTTTCTGTGATGG + Intergenic
956679336 3:71763508-71763530 TGCAGAATGAGTTCCTGTAAGGG - Intergenic
957778268 3:84784753-84784775 GGCAAATTCAGTTTCTGGTGAGG + Intergenic
958681756 3:97340673-97340695 AGCAAATTTGGTTTCTGTTAAGG + Intronic
960522031 3:118666047-118666069 GGCAATATGAGTTTGTGTATAGG + Intergenic
960974701 3:123162806-123162828 GGCAACTTAATTTTCTTTAAAGG - Intronic
962733008 3:138300146-138300168 GGCACATTGAGATCCTGTACAGG + Intronic
964369095 3:155980966-155980988 GGCAAATTCAGTTTCTTGTAAGG + Intergenic
964442566 3:156727360-156727382 GGCAAAATGAGCATTTGTAAGGG - Intergenic
965659670 3:171028347-171028369 GGCAAATTCCGTTTCTGAAAAGG - Intergenic
965756433 3:172032440-172032462 GTCAATTTGGGCTTCTGTAACGG - Intergenic
966714367 3:183000758-183000780 GCCAAATTGAGTATCTGTGGTGG + Intergenic
970453414 4:16195583-16195605 AGCTAATTTGGTTTCTGTAAGGG - Intronic
970863865 4:20737008-20737030 GGCCAATTGATTTTCGATAATGG + Intronic
971758886 4:30737961-30737983 GGCAAATTCAGTTTCTGATGAGG + Intronic
973558511 4:52110203-52110225 GGCAGATTCAGTTTCTGGTAAGG - Intergenic
974010495 4:56602345-56602367 GGCAAATTTATTTTTTTTAAAGG - Intronic
974588130 4:63907495-63907517 TGAAAATTTAGTTTCTGTACAGG + Intergenic
975102721 4:70532778-70532800 AGGAAATGTAGTTTCTGTAAGGG - Intergenic
975499149 4:75065954-75065976 GGCAAATTGAGATTGGGAAAGGG + Intergenic
976531019 4:86151924-86151946 GTTAAACTGAGTTTCTGTCATGG + Intronic
981115276 4:140982837-140982859 GGCATACTTAGTTTCTGTACAGG + Intronic
981174753 4:141668031-141668053 CACAAATTAAATTTCTGTAAAGG - Intronic
982699081 4:158639184-158639206 AATAAATTGAGTTTCTGTGAAGG - Intronic
984733652 4:183090881-183090903 GGCAGATTTAGTTCCTGTGAGGG - Intergenic
985465403 4:190189876-190189898 GGCAAATTGATTCACTGTGATGG - Intergenic
986880210 5:12160647-12160669 GGCCAATTCAGTTCCAGTAAGGG - Intergenic
987874977 5:23669611-23669633 GGAAAATTGTATTTATGTAAAGG + Intergenic
988125099 5:27022265-27022287 CACAAATTGAGTTTTTTTAAAGG + Intronic
988888196 5:35582348-35582370 GGCAAAAAGAGCTTCTGTAGGGG + Intergenic
989342711 5:40394037-40394059 GGCAATTCAAGTTTCAGTAATGG - Intergenic
989494663 5:42098794-42098816 GGCAAAGTGAGTTTCTTGTAGGG + Intergenic
989735788 5:44703559-44703581 TGCAAATTAAATTTCTGAAAAGG - Intergenic
990065317 5:51706013-51706035 GGCAAATTGTCTTTCTCAAAGGG - Intergenic
990209379 5:53466054-53466076 TGCAGATTGAGTTTCAGGAAGGG - Intergenic
990821061 5:59840745-59840767 GGCAAATAGAGTTCTTGAAAAGG + Intronic
990863965 5:60359704-60359726 GGCAAACTGACTGTCTATAAAGG - Intronic
991533188 5:67637818-67637840 GGCTAATGGGGTTTCTGGAAGGG - Intergenic
991616597 5:68503128-68503150 GGCATATCGAGTTTTTGTAAGGG + Intergenic
993067789 5:83121640-83121662 TGCAAATTGTGTATCTGTTAAGG - Intronic
994029592 5:95126806-95126828 GGCACATTGAGTTTATTAAAAGG - Intronic
994305478 5:98198832-98198854 GGCTAATTCAGTTTCTTTGAAGG + Intergenic
994502556 5:100598449-100598471 GGCAAATGGAGTTCATCTAAAGG - Intergenic
994881050 5:105496954-105496976 GGCAATTTGCATTTCTCTAATGG - Intergenic
996790404 5:127287955-127287977 GGCCAATTGATTTTCAATAAAGG + Intergenic
996986441 5:129571863-129571885 GGCCAATTGATTTTCTACAAAGG + Intronic
998724368 5:144992866-144992888 GGTCAATTGAGTTTTAGTAAAGG - Intergenic
999656347 5:153814356-153814378 AGCAAAATGGCTTTCTGTAAAGG + Intergenic
1000231323 5:159317923-159317945 GGCAGATTGAGTTTATGTCTTGG + Intronic
1000315716 5:160088603-160088625 GGCAAATTTAGTTTTTGTTTTGG - Intronic
1000905047 5:166955697-166955719 GGCCAAGTGATTTTCTGTACAGG + Intergenic
1002436599 5:179235509-179235531 GGCCAGGTGAGTTTCTTTAAGGG - Intronic
1003969984 6:11290118-11290140 GGCAAATGGAGTCTCCTTAACGG - Intronic
1004649572 6:17595870-17595892 GACAATTTGAGTTTCAATAAAGG - Intergenic
1008169984 6:48192997-48193019 AACAAATTGAGTTGCTGAAAAGG - Intergenic
1010234904 6:73567186-73567208 GACAAATTGAGGTTGCGTAAGGG + Intergenic
1011411279 6:87069229-87069251 TGCAAAGTGGGTTTCTGTAATGG - Intergenic
1011561883 6:88627690-88627712 GGCAAATTGAGTGATTTTAAAGG - Intronic
1014397517 6:120944420-120944442 GGCAAATTCAGTTTCTGGTGAGG + Intergenic
1014503468 6:122223573-122223595 GCCAAATGGAATTTGTGTAAGGG - Intergenic
1014554874 6:122833636-122833658 TTTAAATTGAGATTCTGTAATGG + Intergenic
1014900287 6:126955148-126955170 TGCAAATGAAATTTCTGTAAAGG - Intergenic
1014966705 6:127762270-127762292 GACAAATTAAGTTTCAGTCAAGG + Intronic
1015851155 6:137574049-137574071 GGCAAAAGGAGTTTCTGTTAAGG + Intergenic
1016229109 6:141780676-141780698 GGCAAATTGATTTTCAACAATGG - Intergenic
1016678877 6:146804839-146804861 GGCAGACTTATTTTCTGTAAAGG + Intronic
1019866637 7:3717749-3717771 TGCAAATTAAGTTTCTCTAAGGG - Intronic
1020473092 7:8561699-8561721 GGCATAATGAGGTTTTGTAAAGG + Intronic
1020738167 7:11978404-11978426 GGCAAAGTGAGTTTCTTGTAAGG - Intergenic
1023556063 7:41424149-41424171 TGCAAAGAGAGTCTCTGTAAGGG + Intergenic
1027991316 7:85364883-85364905 GGTAAATTGATTTTCAGGAAAGG - Intergenic
1029677371 7:102079689-102079711 GGCAAACTGAGGATTTGTAAAGG - Intronic
1032532008 7:132629734-132629756 GCCAACTTGATTTTCAGTAAGGG + Intronic
1034502138 7:151457655-151457677 GTCAATTTGCGTTGCTGTAAAGG + Intergenic
1034523848 7:151641808-151641830 GCCAATTTTAGTTTCTGTTAAGG + Intronic
1041334665 8:56767896-56767918 GGCAAATTTAGTTTCTGATGAGG + Intergenic
1041963093 8:63642566-63642588 GGGGAAGTGAGTTACTGTAAAGG - Intergenic
1042268261 8:66930496-66930518 GGCAAATTGAAATTTTGTACTGG - Intergenic
1043038329 8:75226755-75226777 GGGTAATTCAGTTTCTGAAAAGG - Intergenic
1043698480 8:83251879-83251901 GCCAACTTGAGTGTCTGTGAAGG + Intergenic
1044141572 8:88660330-88660352 TGAAAATTGAGTTCCTGAAAGGG + Intergenic
1044216682 8:89620174-89620196 GGCAAATTCAGTTTCTAGAAAGG + Intergenic
1044926267 8:97211382-97211404 GGCAGATTCAGTGTCTGTTAAGG + Intergenic
1045771409 8:105744556-105744578 GGAAAAATGAGTTTTTTTAATGG + Intronic
1046034552 8:108824711-108824733 GGCCAATTCAGTTTCTGGTAAGG - Intergenic
1050567326 9:6899940-6899962 GGCAAATTTACTTTCTTTTAAGG - Intronic
1051407191 9:16750442-16750464 GGCAAAAGTAGGTTCTGTAAGGG - Intronic
1053229747 9:36397794-36397816 GGCAAATTTAGATTTTGGAAGGG - Intronic
1054814345 9:69460703-69460725 GGCAAACTGAGTTTCATGAAAGG + Intronic
1055474340 9:76646647-76646669 GGGAAATTGAGTTCCAGGAAGGG - Intronic
1058362972 9:104171961-104171983 GGCAAAGTGAGTCTCTGCAGCGG - Intergenic
1059320876 9:113468336-113468358 GGGCAATTGATTTTCAGTAAAGG - Intronic
1059598448 9:115748535-115748557 GGAAAACTGAGTCTCAGTAACGG + Intergenic
1187296105 X:18002284-18002306 TGATAATTGAGTTTCTGCAATGG - Intergenic
1188421851 X:29999774-29999796 GGCAAATATTTTTTCTGTAAAGG + Intergenic
1189295625 X:39915478-39915500 GGCCAATTGCGCTTCTGAAAAGG - Intergenic
1189950181 X:46221652-46221674 TGCAATTAGAGTTTCTGAAATGG + Intergenic
1190689085 X:52898627-52898649 GGGAAATTCAGGTTCTTTAAGGG + Exonic
1190696898 X:52957165-52957187 GGGAAATTCAGGTTCTTTAAGGG - Intronic
1191029587 X:55953677-55953699 GGCCAATTGATTTTCATTAAAGG + Intergenic
1192792595 X:74397948-74397970 GGCAAAATCAGTATCTGTTATGG - Intergenic
1193942519 X:87693364-87693386 AGCAAGTTAAGTGTCTGTAAGGG + Intergenic
1194376204 X:93136733-93136755 AGCAAATTTAGTGTCTGTTAAGG - Intergenic
1194423139 X:93701856-93701878 TGCAAATTTAGTTTCTCTGAGGG + Intronic
1195315887 X:103677444-103677466 GGCAAAATGAGTAACAGTAAAGG + Intronic
1195648440 X:107259429-107259451 GGCCAATTGATTTTCAATAAGGG - Intergenic
1195861124 X:109384434-109384456 GGCACATTGTGATTCTGTAGTGG + Intronic
1195930313 X:110067914-110067936 GGCAAATAGTGTTTCTCTGAAGG + Intronic
1196196947 X:112846633-112846655 AGCAGCTTGAGTTTCTGGAAAGG + Intergenic
1197415655 X:126168688-126168710 GGGAAATTGAGGCTCAGTAAAGG + Intergenic
1197469145 X:126846390-126846412 GGTAGATTGAGTTTCAGTATCGG - Intergenic
1198455346 X:136812155-136812177 GGCAAATTCAGTGTCTGGTAAGG + Intergenic
1199029730 X:142982679-142982701 GGCCAATTGATTTTCTACAAAGG + Intergenic
1199507596 X:148583274-148583296 GGAAACTTCAGTTTTTGTAATGG - Intronic
1199974805 X:152887280-152887302 TGCAAATTGCTTTTCTTTAAAGG + Intergenic