ID: 946100205

View in Genome Browser
Species Human (GRCh38)
Location 2:217314119-217314141
Sequence CAGAACAAGAGGAAGGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 645}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946100205_946100214 24 Left 946100205 2:217314119-217314141 CCAGCCCCCTTCCTCTTGTTCTG 0: 1
1: 0
2: 2
3: 56
4: 645
Right 946100214 2:217314166-217314188 TGCTCTACTCCACCCATAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946100205 Original CRISPR CAGAACAAGAGGAAGGGGGC TGG (reversed) Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900577539 1:3390760-3390782 CAGAACAAGATGATGGGTGTTGG - Intronic
900876650 1:5347709-5347731 AAGAACAAGAGGACAGGGGCTGG + Intergenic
901058850 1:6462362-6462384 GGGGACAAGAGGAAGGAGGCGGG - Intronic
901141146 1:7032259-7032281 CAGAAAAAGAGAAAAGGGGCCGG - Intronic
901372804 1:8815031-8815053 CAGACGAAGAGGATGGGGGAGGG - Intronic
901761091 1:11472077-11472099 CAGGACAAGATGCAGGGGCCAGG - Intergenic
902435943 1:16398168-16398190 CACAGCAAGAGGTAGAGGGCAGG - Intronic
902974616 1:20080007-20080029 AGGAACAAGAGGAAGAGGACGGG + Intronic
903711290 1:25326654-25326676 CCAAGCAAGAGGAGGGGGGCAGG + Intronic
903715658 1:25364775-25364797 CCAAGCAAGAGGAGGGGGGCAGG - Intronic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
904434692 1:30486723-30486745 TATAAGAAGAGGAAGAGGGCTGG + Intergenic
904567736 1:31437781-31437803 CAGAAAAATAGGAAGTTGGCTGG + Intergenic
904698110 1:32341852-32341874 CACAACCAGGGGAAGGGGGAGGG - Intergenic
904853328 1:33475962-33475984 CAGAAAGAGAGAAAGAGGGCCGG - Intronic
904855070 1:33491571-33491593 ATGAGCAGGAGGAAGGGGGCTGG + Exonic
905298749 1:36971813-36971835 CAGAAGAAAAGGAAGGTGTCAGG - Intronic
905357071 1:37392009-37392031 GAGCAAGAGAGGAAGGGGGCTGG - Intergenic
905875904 1:41432005-41432027 GAGAACACCAGGAATGGGGCTGG - Intergenic
905977348 1:42186212-42186234 TAAAACAAGAGGAAGCAGGCTGG + Intronic
906142204 1:43540493-43540515 CAGCCCCAGAGGAAGGGGCCTGG + Intronic
906532943 1:46533758-46533780 CAGAGGCAGAGGCAGGGGGCTGG - Intergenic
907621674 1:55987588-55987610 CAAAACAAGGGTAAGGGGGGAGG + Intergenic
907753657 1:57288299-57288321 CAGATGAAGAGGATGGGGGATGG + Intronic
908796311 1:67833640-67833662 GAGAATTAGAGGAAGGGGGATGG - Intergenic
908894931 1:68888118-68888140 TAGAAAAAAAGCAAGGGGGCTGG + Intergenic
910669550 1:89759321-89759343 CAGAACACAAGGAAGGAGACTGG + Intronic
911642752 1:100306426-100306448 CAGAGCAGGAGGAATGGGGGGGG - Intergenic
911811198 1:102284316-102284338 CAGAGCAGGAGGAAGTGGGTGGG + Intergenic
912796202 1:112695012-112695034 CAGAAAGAGAGGTAGGGGCCGGG + Intronic
912843149 1:113057140-113057162 CAGAACAAGAAGAACCAGGCAGG - Intergenic
914064454 1:144233889-144233911 CAGAACAAGACTCAGGGGGTGGG - Intergenic
914114696 1:144732465-144732487 CAGAACAAGACTCAGGGGGTGGG + Intergenic
914746698 1:150506440-150506462 TAGAGCAAGTGGAAGGTGGCAGG - Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
916560348 1:165929547-165929569 CAGAACACGAGCCAGGGGGTGGG + Intergenic
916931070 1:169578572-169578594 CAGGAAAAGAGGATTGGGGCCGG - Intronic
917682861 1:177385256-177385278 AAGAACAAGAGGAGTGGGGAGGG - Intergenic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918300570 1:183200092-183200114 TAGAACAATAGAAAGAGGGCCGG + Intronic
918394364 1:184098563-184098585 CTGAACCAGAGGAAGGGGAACGG + Intergenic
919311795 1:195918409-195918431 CAGAAAAAGAGGAAGGGTCTGGG - Intergenic
919552098 1:199003559-199003581 CAGAACAAAAGGGAAAGGGCAGG - Intergenic
920258261 1:204671306-204671328 CAGAACCAGAGGAACGTGGTAGG + Intronic
920826390 1:209427470-209427492 CAGACCAATAGGAGGAGGGCAGG - Intergenic
920886054 1:209929107-209929129 CAGAAAAAGAGGAAGGGAGGAGG - Intergenic
921067184 1:211631358-211631380 CGGATCCAGAGGCAGGGGGCAGG + Intergenic
921260453 1:213381459-213381481 CTGAATGAGAGGAGGGGGGCAGG + Intergenic
923099592 1:230801716-230801738 CAGATCAAGATGAAGGGAGAAGG - Exonic
923211135 1:231805474-231805496 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
923371084 1:233313571-233313593 CAGAAAAAGAGAAAGTGGGGAGG + Intergenic
923523406 1:234753836-234753858 CAGAACAATTAAAAGGGGGCAGG - Intergenic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062951050 10:1503799-1503821 CAGAGTAGGAGCAAGGGGGCGGG - Intronic
1063057224 10:2518964-2518986 AAGAAGAAGAAGAAGGGGGGGGG + Intergenic
1063472326 10:6298053-6298075 CAGAACAGAAAGAAGGGGGGAGG + Intergenic
1063547604 10:6997587-6997609 CAGAAAAATTGCAAGGGGGCCGG + Intergenic
1063857924 10:10275594-10275616 AAGAACAAGGGGAAGGGGGAAGG - Intergenic
1065013966 10:21444431-21444453 CGGAACAGGAGGAAGAGAGCGGG - Intergenic
1065825516 10:29567121-29567143 TAGAAGCAGAGGAAGGGGGGTGG - Intronic
1065892287 10:30131687-30131709 CAGACAAAGTGGAAGAGGGCAGG - Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067541936 10:47161122-47161144 AAGAAGAAGAGGAGGGGGCCGGG - Intergenic
1067734598 10:48839606-48839628 CAGATCAAGAGAAAGCAGGCTGG + Intronic
1068891355 10:62151295-62151317 CAGAGCAGGAGGAAGGGGATGGG - Intergenic
1069486276 10:68826137-68826159 TAAAAGAAGAGGAAGGGGCCAGG - Intergenic
1069629927 10:69891438-69891460 CAGAACCGGAGGAAGGGCACTGG + Intronic
1069777929 10:70937665-70937687 CAGAACCAGAGGGAGGGCGGTGG + Intergenic
1070495307 10:77015930-77015952 GAGAATGAGAGGAATGGGGCAGG - Intronic
1070685919 10:78480995-78481017 CAGGACAAAAGGTGGGGGGCAGG + Intergenic
1070728480 10:78808633-78808655 CCGAACAGGAGGAGGGTGGCAGG - Intergenic
1071530180 10:86384437-86384459 CAGAAAAAGAGGAACCAGGCAGG + Intergenic
1072112512 10:92336640-92336662 AAGAAGAAGAGGAAGGGGCATGG + Intronic
1073186763 10:101619669-101619691 AAAAAGAAGAGGAAGGGGGAAGG + Intronic
1073448883 10:103597667-103597689 GAGAGCAAGAGGCAGGGAGCGGG - Exonic
1074032469 10:109702482-109702504 CAGCACAAGAGGATGGGGGTGGG - Intergenic
1074145997 10:110717712-110717734 CAAAACCAGAGGAAGAGGGATGG - Intronic
1074784802 10:116829478-116829500 AAGACCAAGAGGAAGGGCTCTGG + Intergenic
1075565464 10:123500481-123500503 CAGAAGCAGAGGAAGGAGGAAGG - Intergenic
1075607635 10:123825238-123825260 GAGACAGAGAGGAAGGGGGCAGG + Intronic
1075920630 10:126210125-126210147 CAGCCCAGGAGGAAGGGAGCAGG - Intronic
1076902700 10:133347724-133347746 CTGCCCAAAAGGAAGGGGGCTGG + Intronic
1077075921 11:702136-702158 GATAACAAGAGGAAGGGTGGGGG - Intronic
1077368077 11:2169321-2169343 CAGCACAAGAGGCAGGGGCAGGG - Intronic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1077973750 11:7224150-7224172 CAGACCAAGTGGAATGGGGGCGG - Intergenic
1077993526 11:7433124-7433146 CAGAGCAGGAGCAAGGGGGGTGG - Intronic
1078042302 11:7879119-7879141 CAGAGCAGGAGGAAGAGGGTGGG + Intergenic
1078329444 11:10407782-10407804 CAGACCAAGAGGGATGGGGCCGG - Intronic
1078398995 11:11007725-11007747 GAGAACAAGAGGAAGCAGGAGGG - Intergenic
1078717517 11:13854126-13854148 CAGAACAAGAGGTAGAAGGAAGG + Intergenic
1079279952 11:19078098-19078120 CAGCACAAGAGGAATGGGTCAGG + Intergenic
1079443335 11:20536753-20536775 CAAAACAAGAGAAAGGGGTGGGG + Intergenic
1080386069 11:31811817-31811839 TGGAAGAAGAGGAAAGGGGCGGG + Intronic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080787376 11:35487759-35487781 AAGAACAAGAGTAAGGGGTCTGG + Intronic
1081265278 11:41013875-41013897 CAGAACAAGAGGGAGAGAGATGG + Intronic
1081745418 11:45469451-45469473 GAGAAAATGAGGAAGGGGTCTGG - Intergenic
1082034824 11:47636433-47636455 CAGAAAAAAAGAAAAGGGGCCGG + Intronic
1083061659 11:59879223-59879245 CAGGACAGGAGGCAGGTGGCAGG - Intergenic
1083227309 11:61293449-61293471 CAAAAGAAGAGGAAGGGAGAGGG + Intronic
1083826126 11:65205054-65205076 CCGAAAGAGAGGAAGGGGGTTGG + Intronic
1083904188 11:65659603-65659625 CTGAATAGGAGGAAGGGGGTTGG - Intronic
1084126633 11:67103379-67103401 AAAAAAAAGAGAAAGGGGGCCGG - Intergenic
1084171754 11:67404345-67404367 CAGAGCCAGGGTAAGGGGGCAGG + Exonic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084561441 11:69907762-69907784 CAGAAGCAGAGGAAGCAGGCAGG + Intergenic
1085255206 11:75168775-75168797 CAGAAAAAGAGGGAGGGGAGGGG - Intronic
1085502648 11:77037953-77037975 AAGAAGAAGAGGAGGGGGGAAGG + Intronic
1087737467 11:101851252-101851274 CAGTAGAAGAGGTAGGGAGCAGG - Intronic
1088186945 11:107181094-107181116 CAGAGCTAGAGGAAGGAGGAGGG + Intergenic
1089290930 11:117437631-117437653 CAGTAGAGGAGGAAGGGAGCTGG + Intronic
1089487905 11:118861359-118861381 CAAAACAAGAGGATTGGGTCAGG - Intergenic
1089666263 11:120021938-120021960 CAGAGCCAGCGGAAGAGGGCAGG - Intergenic
1089951819 11:122535039-122535061 AAGAGCAAGAGCAAGAGGGCGGG - Intergenic
1090407002 11:126482337-126482359 CAAAGCAAAAGGAAAGGGGCAGG - Intronic
1090481736 11:127074949-127074971 CACAACAAGCTGAAGAGGGCAGG - Intergenic
1090502236 11:127272765-127272787 CAGAGCAAGAGGAAGAGAGATGG + Intergenic
1090772346 11:129932212-129932234 CAGAACAAGAGGCAGAGGAAGGG - Exonic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1091136027 11:133190316-133190338 CAAAAAAAGAGGAAGGGAGAAGG + Intronic
1091202897 11:133795763-133795785 CAGAACAAGAGGAAGAGGCAGGG + Intergenic
1091217904 11:133914733-133914755 CAGAACAGGAGGGAGGAAGCAGG + Intronic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1092120007 12:6037363-6037385 CAGAACTAGAGTCTGGGGGCTGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092255626 12:6925493-6925515 TAGAGCAAGAGGAAGGGAGTCGG + Intronic
1092629312 12:10361342-10361364 AAGAACAGGAAGAAGAGGGCAGG + Intergenic
1092739847 12:11616893-11616915 CAGAACAGGAGGAAGATGGTGGG + Intergenic
1092864263 12:12746124-12746146 GAGAACAAAAGGAAGGGTGGTGG + Intronic
1092883379 12:12905270-12905292 CAAAACAAGAGGAAGGACTCGGG - Intronic
1093394968 12:18669962-18669984 TATAAGAAGAGGAAGAGGGCCGG - Intergenic
1093704816 12:22262881-22262903 CAGAACAAGAGATTGCGGGCAGG + Intronic
1095662282 12:44751185-44751207 CAGACTAAGTGGAAGGGGGAAGG + Intronic
1095842017 12:46703675-46703697 CAGAGCAAGATAAAGAGGGCTGG - Intergenic
1096109657 12:49021263-49021285 CAGATCAAGAGGGAGGGGGATGG + Exonic
1096150088 12:49304114-49304136 GAGAGCCAGAGGTAGGGGGCAGG + Intergenic
1096422085 12:51467418-51467440 CAGAACCAGAGGAAAAGAGCAGG + Intronic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1097697177 12:62786237-62786259 CTGAACAAGAGGCCAGGGGCTGG + Intronic
1097726283 12:63079162-63079184 CAGAACAAGAGGCAGAGGAAGGG + Intergenic
1097987434 12:65798758-65798780 AAGAAGGAGAGAAAGGGGGCAGG + Intergenic
1098391099 12:69970917-69970939 CAGAGCAGGAGGAAGGGAGGGGG - Intergenic
1098558957 12:71851174-71851196 TAGAGCAGGAGGAAGGGGGAGGG + Intronic
1101367725 12:104090908-104090930 CTTAACAAGAGTAAGTGGGCGGG + Intronic
1101387169 12:104268149-104268171 GAGAGAAAGAGGAAGGGGCCGGG - Intronic
1101655001 12:106712443-106712465 CAGAAACACAGGAAGGGGGCAGG - Intronic
1101695537 12:107122306-107122328 GAGAAGAAGAGGAAGGAGGTTGG + Intergenic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102226873 12:111235013-111235035 CAGAAAGAGAGGAAGTGGGCTGG - Intronic
1102467465 12:113138199-113138221 CAGAACAACAGGAAATGGCCGGG - Intergenic
1102717367 12:114986110-114986132 GAGAAAGAGAGGAAGGAGGCAGG - Intergenic
1103013362 12:117475106-117475128 AAGAAGGAGAGGATGGGGGCCGG - Intronic
1103200131 12:119081492-119081514 GAGAACAAGGGGAAAGGAGCAGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103896676 12:124277899-124277921 CAGAAGAGGAGGAAGAGGGAAGG - Intronic
1103949467 12:124543113-124543135 CAGACCAAGGCCAAGGGGGCTGG + Intronic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104538085 12:129637540-129637562 CAGACCAGGAGGAAGGGGGTGGG - Intronic
1104542199 12:129676197-129676219 CACATCAAGATGATGGGGGCAGG + Intronic
1104777701 12:131400971-131400993 CAGAAGAGGATGAAGGGGGCGGG - Intergenic
1106946865 13:34837890-34837912 GAGAAGAATAGGGAGGGGGCAGG + Intergenic
1107164172 13:37265790-37265812 CAGAGCGACAGGAAGGGGGAGGG - Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1108425110 13:50291572-50291594 GAGAGCAAGAGGTAGGGGGAAGG + Intronic
1108463577 13:50692377-50692399 CAGAAAAGGAGGAAAGGGGTTGG - Intronic
1108672799 13:52708966-52708988 CAGACCAAAAGAAAGGGGGGAGG - Intronic
1108950753 13:56088794-56088816 CAGAACAGGAGGAAGAGAGGGGG - Intergenic
1109220915 13:59640021-59640043 CAGAGCAGGAGGAAGAGAGCAGG - Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1110520694 13:76472536-76472558 CAGAAAAGGAGGCGGGGGGCAGG + Intergenic
1110964823 13:81680128-81680150 CAGGAAAAGAGGAAGGGAGGTGG - Intergenic
1111635654 13:90900382-90900404 GAGAGCAAGAGGAAGGGGAAAGG - Intergenic
1111772917 13:92622103-92622125 CAGAACCAGAGCCAGAGGGCTGG - Intronic
1111905958 13:94256463-94256485 CAGACCAAGAGCAAGGAGACTGG + Intronic
1112105095 13:96231499-96231521 CAGAGCAGGAGGAAGGCGGGAGG + Intronic
1112608276 13:100929536-100929558 TAGAATAAGAGGCAAGGGGCCGG - Intergenic
1113903869 13:113810586-113810608 CACAACCACAGGGAGGGGGCAGG + Intronic
1114297657 14:21344390-21344412 CAGAACAAGAGGATGGAGAGAGG - Intronic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115755314 14:36522468-36522490 CAGAACGAGACGTGGGGGGCTGG - Intergenic
1116139242 14:40968513-40968535 CAGAACAAGAGGAAGAGACAGGG - Intergenic
1116598470 14:46885610-46885632 CAGAACCAGAGGATTGGGGTGGG + Intronic
1117348582 14:54858686-54858708 AAGAACAAGATGAAGGGGTCGGG - Intronic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1117735281 14:58762804-58762826 AAGCAAAAGAGGAAGGGGGAAGG - Intergenic
1118620427 14:67609785-67609807 GAGAAGAAGGGGAAGGGGGTGGG + Intergenic
1118935228 14:70282098-70282120 CTTAACAAGAGGAAGCTGGCTGG - Intergenic
1119266451 14:73265520-73265542 CAGAATAGGAGGAAGGGGAGAGG - Intronic
1120369728 14:83617660-83617682 TGGAGCAGGAGGAAGGGGGCTGG + Intergenic
1121330990 14:93049737-93049759 CAGAACAGAAGGACGGGGGTGGG + Intronic
1121347098 14:93144239-93144261 CAAAACAAAAAGAAGGGGGTTGG + Intergenic
1121438514 14:93934301-93934323 CAGAACAAGTGGAGGGGCACAGG + Exonic
1121613387 14:95296225-95296247 AAGACAGAGAGGAAGGGGGCTGG + Intronic
1121807531 14:96843299-96843321 CAGAACTAGAGGCAGAGGTCAGG + Intronic
1122056575 14:99102468-99102490 CAGAGCAGGAGGAAGAGGGAGGG - Intergenic
1122716327 14:103698851-103698873 AGGAACAGGAGGAGGGGGGCAGG + Exonic
1122781944 14:104147419-104147441 CAGCAGAGGAGGAAGGGGGTAGG + Intronic
1123975456 15:25549394-25549416 CATAATAAGAGGATGGGGGTGGG + Intergenic
1124108077 15:26759681-26759703 CAGATCAAAAGGAAGAGGACAGG - Intronic
1124196427 15:27634652-27634674 AAGAAAAAGAGGAAGAGGACAGG - Intergenic
1125428670 15:39575183-39575205 CAGAAGAAGAGAATGTGGGCTGG - Intergenic
1125729771 15:41886588-41886610 TAAAACAAGAGGAAGAAGGCAGG - Intronic
1125937085 15:43646692-43646714 AAGAAAAAGAGGAAGTGGGTAGG - Intronic
1125949937 15:43743792-43743814 AAGAAAAAGAGGAAGTGGGTAGG - Intergenic
1127313868 15:57776639-57776661 GAGAACAAGGGGTTGGGGGCAGG + Intronic
1127885330 15:63194079-63194101 CCTAACAGGAAGAAGGGGGCAGG - Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128511391 15:68315981-68316003 CAAAAGAAGAGGAAGAGGGAGGG - Intronic
1130601766 15:85280254-85280276 CAGAGCCAGAGGAAGGTGGGGGG - Intergenic
1130709112 15:86261971-86261993 CAGAATAAGAGGAAGATTGCAGG - Intronic
1130763846 15:86850384-86850406 GTGAAAAACAGGAAGGGGGCAGG - Intronic
1130904218 15:88228520-88228542 CTGACCAAGAGGAAGGGAGTTGG - Intronic
1131518784 15:93098017-93098039 CAAAACAAAAGGCAGGGGGGTGG - Intergenic
1131747308 15:95462981-95463003 TATAACAAGGGGGAGGGGGCTGG - Intergenic
1132026632 15:98409151-98409173 CAGGAGAAGAGGAAGGGGAAGGG + Intergenic
1132399313 15:101495782-101495804 AAGAACAAGAGGGAAGGGGAAGG + Intronic
1132707990 16:1254736-1254758 CAGAAGCAGAGGAGGTGGGCTGG + Intergenic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1134044865 16:11093669-11093691 CAGCACAGGTGGAAGAGGGCAGG + Intronic
1135174297 16:20214567-20214589 GAGAAGAAGAGGAAGGGGTGGGG + Intergenic
1135943554 16:26843665-26843687 CAAAAGAAGCTGAAGGGGGCTGG - Intergenic
1136081536 16:27855421-27855443 CAGAAAAAGACCAACGGGGCCGG + Intronic
1137871542 16:51954637-51954659 CAGAAGAAAAGGAAGGAGGAAGG - Intergenic
1138370862 16:56525257-56525279 CAGAGCAGGCGGAACGGGGCTGG + Intergenic
1138790032 16:59892869-59892891 CAGAGAAAGAGGAACAGGGCTGG - Intergenic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139851590 16:69953828-69953850 AAAAAGAAGAGGGAGGGGGCGGG + Intronic
1139880567 16:70176735-70176757 AAAAAGAAGAGGGAGGGGGCGGG + Intronic
1140112546 16:72016312-72016334 AAGAGGAAGAGGAAGGGGACTGG + Intronic
1140371942 16:74418782-74418804 AAAAAGAAGAGGGAGGGGGCGGG - Intronic
1140943955 16:79749833-79749855 CAGCCCAGGAGGAAGGGGACTGG - Intergenic
1141606111 16:85154267-85154289 CAGACCAAGGGGAAGGGGCTTGG + Intergenic
1141678980 16:85532980-85533002 CAGAACAGGAGGTAGGGAGCGGG - Intergenic
1141806757 16:86347110-86347132 CAGCAGGACAGGAAGGGGGCTGG - Intergenic
1142173684 16:88635312-88635334 AAGAAAGAGAGGAAGGGGGAGGG - Intergenic
1142467625 17:145276-145298 CAGACCAAGAGGGAAGGGACTGG + Intergenic
1142598427 17:1040643-1040665 CAGAACCACTGGAAGGGGGTGGG + Intronic
1143363263 17:6388397-6388419 CAGATGAAAAGGAAGGGGTCAGG + Intergenic
1143410856 17:6707532-6707554 AAGAAAGAGAGGAAGGGGGATGG + Intronic
1143908216 17:10226727-10226749 CAGGAGGAGAGGAAGGGAGCAGG - Intergenic
1144618304 17:16797322-16797344 AAGAACTAGAGGGAAGGGGCAGG + Intronic
1145974881 17:28978159-28978181 CAGAACAGAAGGCAGGGAGCAGG + Intronic
1147003130 17:37379389-37379411 TTGGAAAAGAGGAAGGGGGCAGG + Intronic
1147327453 17:39676304-39676326 AAGGAGAAGAGGAAGGCGGCAGG + Intronic
1147650650 17:42059954-42059976 CACACCAAGATGAAGGGAGCAGG - Intronic
1147746765 17:42699430-42699452 CAAAACAAAAGGAGGGGGGCAGG - Exonic
1148014218 17:44509688-44509710 AAGAAAGAGAGGAAGGGGCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148785816 17:50145755-50145777 CAGAAGAGGAGGAGGGGAGCAGG + Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150133422 17:62681147-62681169 CAGCAGATGTGGAAGGGGGCTGG + Intronic
1150437257 17:65163766-65163788 CAGAACCAGAGGCTGGAGGCAGG + Intronic
1150457334 17:65317366-65317388 CAGAAGATGAGGAAGGGGAAGGG + Intergenic
1150931584 17:69590557-69590579 AAGAACAAGAGGCAGGAGGGTGG - Intergenic
1151283256 17:73092214-73092236 CAGAGCAAGTGGGAGGGGCCTGG + Intronic
1151347294 17:73509966-73509988 CCGAAGAAGAGGAAGGGGCTAGG + Intronic
1152077360 17:78168098-78168120 CAGACCAGGAGGAATGGGGAGGG + Intergenic
1152326391 17:79641869-79641891 CAGAGCAAGAGGAAGAGAGAGGG - Intergenic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1152722839 17:81931326-81931348 CAGAGCAAGACGAGGGGCGCGGG - Intergenic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1152885216 17:82845462-82845484 CAGACGGAGAGGAAGGGGCCGGG - Intronic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1153655799 18:7281046-7281068 TAGACAAAGAGGAAGGAGGCAGG + Intergenic
1154073469 18:11176946-11176968 CAGGAGAGGAGGAAGGAGGCAGG - Intergenic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1155174768 18:23292417-23292439 CAGAACCTGAGGGAGGAGGCTGG + Intronic
1155865238 18:30956627-30956649 GAGAAAAAGAGGAAGGGGCAAGG + Intergenic
1157651570 18:49337844-49337866 AAGAACAAGAAGAAGGGGAAGGG + Intronic
1157972460 18:52285944-52285966 CAGAACACCAGGAAGGAGGGAGG + Intergenic
1158403233 18:57139710-57139732 AAGAAAAAGAGGAGAGGGGCAGG + Intergenic
1158934670 18:62353767-62353789 CAGAAAAACTGGAAGGGGCCAGG + Intronic
1160039933 18:75336436-75336458 CAGGACGCCAGGAAGGGGGCAGG - Intergenic
1160081157 18:75728535-75728557 CTGAACATGAGGCAGGGGACAGG - Intergenic
1160087802 18:75794834-75794856 CACAACTAGAAGAAAGGGGCTGG + Intergenic
1160540583 18:79618006-79618028 TAGAAAACGAGGAAGGAGGCGGG + Intergenic
1160664284 19:316608-316630 TAGCACAAAAGGCAGGGGGCAGG + Intronic
1160821846 19:1062603-1062625 CAGAAGAGGAGCAAGTGGGCAGG - Intronic
1161643452 19:5437758-5437780 CAAAACAAGAGGCAGTGGACTGG - Intergenic
1161684251 19:5695245-5695267 CAGCACATGAGGAAGGGGACTGG + Intronic
1162301378 19:9847020-9847042 CAGAGCAAGAGGATTGGGGTAGG + Intronic
1162647796 19:12062851-12062873 CAGAACCAGCAGAAGGGAGCCGG - Intergenic
1163061259 19:14763875-14763897 GAGGACAAGAGGAAGAGGACGGG - Intronic
1163611324 19:18303414-18303436 CAGAGCAAGAGGAGGCCGGCTGG - Intergenic
1163746668 19:19052785-19052807 CAGAACCAGAGTGACGGGGCAGG - Intronic
1163796413 19:19340820-19340842 CAAAACAAGAGGCAGGGGTCAGG - Intronic
1163887167 19:19976197-19976219 AAGCACAAGAGGAATGGAGCTGG - Intergenic
1163895180 19:20052262-20052284 CAGCACTAGAGGAAGGGGCAGGG + Intergenic
1164073838 19:21794821-21794843 CAGAGCAAGAGGAAGAGAGTAGG + Intergenic
1164423291 19:28116802-28116824 CTGAACAAGTGGAAGGGGCAGGG - Intergenic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164871438 19:31647580-31647602 CAGAGCAGGAGGAAGAGGGTGGG + Intergenic
1165158756 19:33803676-33803698 CAGGACACCAGCAAGGGGGCCGG - Intronic
1165348677 19:35265141-35265163 CACAACAAGAGGGAGGGGATGGG - Intronic
1165409651 19:35651424-35651446 CAGAATAAAAGGGAGGAGGCTGG - Intronic
1165613626 19:37179131-37179153 GGGAACAAGAGGAATGTGGCAGG - Intronic
1165961784 19:39540773-39540795 AAGAAGAAGAGGAAGGGTTCTGG - Intergenic
1166136558 19:40780688-40780710 AAGAAAAAGAGGTAGGGGCCAGG + Intronic
1166932854 19:46311994-46312016 CAGAACAAGAGGAGTGTGGTGGG - Intronic
1167417868 19:49386684-49386706 CAGAAAGAGAGGAGGGGGGAGGG + Intergenic
1167882413 19:52471029-52471051 CAGAACAGGAGGAAGTGGGTGGG - Intronic
924971880 2:135898-135920 CAGAGCAGGAGGAAGGGAGGAGG - Intergenic
925256739 2:2496283-2496305 AAGAACTAGAGGGAGGAGGCGGG + Intergenic
925436884 2:3846196-3846218 AAGAACAGGAGGACGGGGGTGGG - Intronic
926643518 2:15263517-15263539 CAGAAAGATAGGAAGGGGCCTGG - Intronic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926777385 2:16435973-16435995 CAGAAAAACAGGCAGGTGGCTGG - Intergenic
927866188 2:26589195-26589217 AAGAAGAAGAGGAAGGGGAAGGG - Intronic
927876055 2:26655849-26655871 AACAGCAAAAGGAAGGGGGCAGG - Intergenic
927880067 2:26684050-26684072 GAGAAGAAAAGGAAGGAGGCAGG - Intergenic
928102622 2:28448305-28448327 TTCAACAAGAGGAAGGAGGCTGG - Intergenic
928925938 2:36579553-36579575 TGGAGCAGGAGGAAGGGGGCTGG - Intronic
929018004 2:37520567-37520589 GAGAACCAGAGGAAGGGTGATGG - Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929769841 2:44882669-44882691 AGGAAGATGAGGAAGGGGGCAGG - Intergenic
930135871 2:47904757-47904779 CTGCACACGAGGGAGGGGGCTGG + Intronic
930392385 2:50778547-50778569 ATGAACAAAAGGAAGGTGGCAGG + Intronic
930403983 2:50930383-50930405 GAGAAAAAGAGAAAGGGGGCAGG + Intronic
930791909 2:55341441-55341463 CAGAAAAAAAAAAAGGGGGCGGG - Intronic
931428347 2:62191035-62191057 TATAACAGGAGGAAGGAGGCTGG - Intergenic
931622648 2:64226757-64226779 CAGAGCAAGAGGAAGGCGAGAGG - Intergenic
931947337 2:67324797-67324819 AAGAAGAAAAGGAAGGGGGAAGG + Intergenic
933260053 2:80122384-80122406 GAGAAAGAGAGAAAGGGGGCTGG - Intronic
933260297 2:80124757-80124779 CAGAGGAAGAGGAAGGGGAGGGG - Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933850721 2:86364549-86364571 CAGAGCAGGAGCAAGGGGGTGGG + Intergenic
934028079 2:88017358-88017380 CTGAAAAAGAGGAGGTGGGCTGG - Intergenic
934557895 2:95297042-95297064 CAGAGAAAGAGGCAGCGGGCAGG + Intergenic
934574480 2:95391518-95391540 CAGTAGAAGAGGGAGGAGGCTGG - Intergenic
934618983 2:95792647-95792669 CAGAAGCAGAGGCATGGGGCAGG - Intergenic
934641908 2:96031910-96031932 CAGAAGCAGAGGCATGGGGCAGG + Intronic
935046852 2:99490206-99490228 CAGAACAACAGGGCGGGGCCGGG - Intergenic
935096758 2:99952251-99952273 CAGAGCAGGAGGAAGGGGTTTGG - Intronic
935324739 2:101925823-101925845 CAGAGCAAGAGGAAGGGTGTTGG - Intergenic
935571432 2:104664976-104664998 AAGAGAAAGAGGCAGGGGGCCGG + Intergenic
936658225 2:114513009-114513031 AAGAAAAGGAGGAAGGGGGAGGG + Intronic
937298876 2:120826422-120826444 CAGCAGCAGAGGGAGGGGGCTGG - Intronic
937862773 2:126723909-126723931 CAGAAGCAGAGGAGGGGAGCAGG + Intergenic
937937040 2:127254452-127254474 CAGAACAAAAGGATGGAGGAAGG - Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
940325811 2:152423892-152423914 CAAAAGAAGAGGAAGGAGGTGGG - Intronic
940705933 2:157105067-157105089 GGGAACAAGAGGAATGGAGCAGG + Intergenic
940908362 2:159188789-159188811 CAGGAAAACAGGAAGGGAGCTGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
943151160 2:184115390-184115412 CAGAGCAAGATGAAGCAGGCTGG + Intergenic
943699844 2:190977808-190977830 CAGGATAAGAGGAAAAGGGCAGG + Intronic
943772497 2:191733481-191733503 CAGAACCAGTGGAAGGAGGGTGG + Intergenic
944863305 2:203835993-203836015 GAGAACCAGAGCAAGTGGGCAGG + Intergenic
945122240 2:206468929-206468951 CAGAACAGGAGGAAGAGAGATGG + Intronic
945155166 2:206830432-206830454 AAGAAGAAGAAGAAGGGGGGAGG + Intergenic
945243701 2:207699177-207699199 TATAAGAAGAGGAAGGTGGCTGG - Intergenic
946062963 2:216960755-216960777 CATAACACGAGAAAGGAGGCTGG - Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946148571 2:217749013-217749035 CAGAACAAAAGGGAGGGGGGTGG - Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947720785 2:232368110-232368132 CAGAGCTACAGGAAGGGGGTGGG - Intergenic
947828202 2:233120653-233120675 CTGAACAGGAGCAAGGGGTCAGG - Intronic
947895910 2:233671954-233671976 CACACATAGAGGAAGGGGGCTGG - Exonic
948033136 2:234836088-234836110 GAGAACAAGAGGAAAGAGGGTGG - Intergenic
948227033 2:236319165-236319187 CAGAACAAGTGCCATGGGGCAGG - Intergenic
948909898 2:240997887-240997909 CAGCCCAAGAGACAGGGGGCAGG + Intergenic
949035882 2:241815596-241815618 AAGAATAAGAGGAAGGGGTGGGG - Intronic
1169894626 20:10489643-10489665 TAGCACAAGAGTAAGGGGTCAGG + Intronic
1169899009 20:10534265-10534287 CAGAAAGAAAGGAAGGAGGCAGG - Intronic
1170835341 20:19878979-19879001 CTGAACAAGAGGATGGGGTGAGG + Intergenic
1171184520 20:23115422-23115444 AAGAAAAAGAGGTAGGGGTCAGG - Intergenic
1171478945 20:25437820-25437842 CAGAATAAGAGAAAAGGGGCCGG + Intronic
1172228935 20:33323965-33323987 TAGAAGAAGGGGAAAGGGGCGGG + Intergenic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1172695094 20:36816968-36816990 AAGAAAATGAGCAAGGGGGCCGG + Intronic
1172785465 20:37465465-37465487 GAGAAGAGGAGGAAGGAGGCGGG - Intergenic
1172914833 20:38435756-38435778 CAGAAAAAAAGGAATGGGGCGGG - Intergenic
1172979143 20:38927793-38927815 TAGAAAAAGCGGCAGGGGGCCGG - Intronic
1173134812 20:40430128-40430150 TAAAACAAGAGGAAAGAGGCCGG + Intergenic
1173545351 20:43893655-43893677 CAGAACCAGAGGGAGGGAGTAGG - Intergenic
1173621975 20:44443645-44443667 CAGAATAGGAGGAAGTGGGTTGG + Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174301557 20:49585913-49585935 CAGAGAAAGAGGAAGGGGACAGG + Intergenic
1174373497 20:50110329-50110351 CAGAACCAAAGGAAGTGGGAAGG + Intronic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174921158 20:54703970-54703992 CAGAACGACAGGAAGGAGGAGGG - Intergenic
1175171595 20:57084999-57085021 CAGAACAGGAGGTGGGGGGTGGG + Intergenic
1175174559 20:57103119-57103141 CAGGAATAGAGGCAGGGGGCTGG - Intergenic
1175194951 20:57236651-57236673 CAGATTCAGAGAAAGGGGGCAGG + Intronic
1175387507 20:58606531-58606553 CAGAAGAGGAGGAGGGGGTCAGG + Intergenic
1175452110 20:59077982-59078004 GAGAAGAAGAGGAAGGGGAAAGG + Intergenic
1175529953 20:59667762-59667784 CAGCACAAGAGAAAGGAAGCAGG - Intronic
1175534841 20:59702323-59702345 CAAAAGAACAGGAAGGAGGCTGG - Intronic
1175709669 20:61209259-61209281 CAGAAGTGGAGGAAGGGGTCGGG - Intergenic
1175738527 20:61404246-61404268 AACAAGCAGAGGAAGGGGGCGGG - Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176276997 20:64278257-64278279 CAGAACAACAGGCCTGGGGCAGG - Intronic
1177070068 21:16493814-16493836 TAGAAGAAGAGAGAGGGGGCCGG + Intergenic
1177475210 21:21611537-21611559 GAGAGCAAGAGTAAGGGGGTGGG - Intergenic
1178076090 21:29014331-29014353 CAGAAGAAGAGAAAGAAGGCAGG - Intronic
1178642074 21:34352765-34352787 CAGAGCAAAAGGAAGAGAGCTGG - Intergenic
1178904386 21:36624453-36624475 GAGAAAAAGAGCAAGAGGGCTGG + Intergenic
1179213835 21:39349316-39349338 CAGACCCAGGCGAAGGGGGCGGG + Intronic
1180905836 22:19410655-19410677 CAGGAGAAGAGCAAGGTGGCAGG + Intronic
1181027674 22:20135237-20135259 CAGAAACATAGGAAGGGGCCGGG - Intronic
1181040483 22:20190137-20190159 ACGAAAGAGAGGAAGGGGGCTGG + Intergenic
1181389218 22:22567500-22567522 CAGAACAAGAGGGAGAGGAGAGG + Intergenic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1181614909 22:24047314-24047336 CAGAACAAGAGGCAGTCCGCAGG - Intronic
1181959853 22:26615351-26615373 AAGAAGAAAAGGAAGTGGGCTGG - Intronic
1182146923 22:28002214-28002236 CAGAACAAGGCTAAGGGCGCGGG + Intronic
1182265794 22:29114185-29114207 CATAAGGAGAGGAAGAGGGCTGG + Intronic
1182352516 22:29706786-29706808 CAGTCCAAGAGGCAGGGGCCAGG + Intergenic
1182476458 22:30579173-30579195 CAGAAAAGGAGGAAGAGGCCCGG - Exonic
1182542796 22:31054133-31054155 CAGAAAAAGAGGAGGTGGCCAGG + Intergenic
1182586808 22:31348084-31348106 CAGAGAAAGAGAAAGGGGCCGGG + Intergenic
1182744390 22:32594459-32594481 CAAAACAAAAGGAATGGGTCAGG - Intronic
1182903271 22:33916746-33916768 CAGAAGTAGAGGCAGGAGGCTGG - Intronic
1183288501 22:36982916-36982938 AAGAACAAGAGGAAAAAGGCTGG - Intergenic
1183516487 22:38269838-38269860 GACAACAAGAGAAAGGCGGCGGG + Intronic
1183602394 22:38847511-38847533 CAAAACAAGAGGAAGTAGGGGGG + Intergenic
1184111360 22:42397454-42397476 CACAAAAAGAGGAAGAGGTCAGG - Intronic
949872522 3:8601499-8601521 CAGAAGTGAAGGAAGGGGGCAGG + Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950548371 3:13652480-13652502 CAGTTCATGAGGAGGGGGGCGGG - Intergenic
951237100 3:20249474-20249496 CAGAGCAAGAGGTTGGGGGGAGG + Intergenic
951428712 3:22581306-22581328 CAGAACAAGAGAAAAGTAGCAGG + Intergenic
951472075 3:23067355-23067377 CAGAGCAAGAGGAAGAGAGAAGG - Intergenic
951651900 3:24959786-24959808 AAGAACAAGGGGAATGAGGCAGG + Intergenic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952708255 3:36401877-36401899 CAGAACAAGAGAAAGGGAAGGGG + Intronic
952712924 3:36449852-36449874 CAGGACAAGAGGAAGTGAGGAGG + Intronic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
953732492 3:45462284-45462306 CAGAACAGGAAGAAAAGGGCTGG + Intronic
953810108 3:46104863-46104885 CAGAACAAGAAGCAGTGGGTTGG - Intergenic
954036974 3:47856093-47856115 GAGACCAAGGGGAAGGGTGCGGG + Intronic
955025524 3:55163923-55163945 CAGAAGAAGAGGAAGGCAGGAGG - Intergenic
956198820 3:66684063-66684085 AAGAAAAAGAGGAGGGGGGAAGG - Intergenic
956671284 3:71693396-71693418 GAGAACAAGACGAAGGGGTTAGG + Intronic
957239420 3:77639124-77639146 AAGAACTAGGGGAAAGGGGCCGG - Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
958119887 3:89271906-89271928 CTGAAAAAGAGGAAGGGGAAGGG - Intronic
960868066 3:122222141-122222163 CAAAACAAGATAAAGGGGACTGG + Intronic
961011641 3:123440348-123440370 CAGAGCAAGAGGTAGTGGGCAGG + Intronic
961022367 3:123519022-123519044 CAGAGCAAGAGGAAGTGAGAGGG + Intronic
961347991 3:126277191-126277213 CAGAGCAGGAGGAAGAGGGGTGG + Intergenic
961602978 3:128075388-128075410 GGGAACAGGAGGCAGGGGGCAGG + Intronic
961603502 3:128077368-128077390 CAGAACAAATGGAAGGGGAGTGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962978817 3:140469603-140469625 CAGAACAGTAGGAATGGGGATGG - Intronic
962982254 3:140501147-140501169 GAGAACAAGAGCAAGGTGGGTGG - Intronic
963057799 3:141201629-141201651 CAGCTCAAAAGGAAGGGGCCTGG - Intergenic
963255876 3:143144572-143144594 CAGCATAAGAGGTATGGGGCAGG + Intergenic
963480353 3:145865467-145865489 CAGAAGAGGAGAAAGGGGGAGGG + Intergenic
963921949 3:150914350-150914372 CAGAGCAAGAGCAGGAGGGCTGG - Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964817517 3:160732405-160732427 CAAAGCAGGAGGAAGGGGCCTGG - Intergenic
964906677 3:161726405-161726427 CAGAAAAGCAGGAAGGGGGTTGG + Intergenic
965254630 3:166389831-166389853 GAGAAGGAAAGGAAGGGGGCAGG - Intergenic
965519103 3:169655212-169655234 CAGAACAAGAGGGAGTGGCGGGG - Intronic
966207663 3:177421473-177421495 AGGAAGAAGAGGAATGGGGCAGG + Intergenic
966314036 3:178625285-178625307 CAGGACAAGGGGGTGGGGGCGGG + Intronic
966386487 3:179404523-179404545 CAAAACAAAACAAAGGGGGCGGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967870866 3:194227857-194227879 CAGAAAAGGAGGAAGTTGGCAGG - Intergenic
968654231 4:1771759-1771781 CAGAACTGGAGGGCGGGGGCGGG - Intergenic
968737710 4:2305959-2305981 CAGGACACGAGGAAGAAGGCAGG + Intronic
968933517 4:3597247-3597269 CCGGACAAGAGGAAGGTGGCAGG + Intergenic
968957316 4:3725972-3725994 CAGGACATAATGAAGGGGGCGGG + Intergenic
969122201 4:4918922-4918944 CAGACAAGGAGGAAGAGGGCAGG + Intergenic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969538427 4:7770750-7770772 CAGAACCAGAGGACGGGGGCGGG + Intronic
972059551 4:34852335-34852357 TAGAAAAAGAGGAAGACGGCCGG - Intergenic
972337906 4:38124296-38124318 CAGAATAAGAGGGAGGGCACCGG - Intronic
972590687 4:40483373-40483395 CAGAACAACAAGAAAGGGGCGGG + Intronic
973752267 4:54033008-54033030 CAGAGCAGGAGCAAGGGGGTTGG - Intronic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975783357 4:77862722-77862744 AAGAGAAAGAGGAACGGGGCGGG - Exonic
976367021 4:84244046-84244068 CAAATCAGGAGGAAGTGGGCTGG + Intergenic
976382672 4:84418121-84418143 GAGAACAACAGGCAGGTGGCAGG + Intergenic
977941113 4:102860586-102860608 CAGAACAAGAGGAATGGAATGGG - Intronic
978393070 4:108247912-108247934 CAGAGTCAAAGGAAGGGGGCAGG + Intergenic
978529778 4:109702101-109702123 AGGAAGAAGAGGAAGGGAGCAGG + Intronic
980027151 4:127781373-127781395 CAAACCAAGAGGGAGGGCGCTGG + Intergenic
980875135 4:138654240-138654262 CAGAACAAGAGTTAGGGCTCAGG - Intergenic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
982668326 4:158292343-158292365 CAAAACCAGAAGCAGGGGGCAGG - Intergenic
983307930 4:166017671-166017693 AAGAACAAGAGGAAGGGAGGGGG - Intronic
983676690 4:170302842-170302864 GAGAACAGGAGGTAGGGTGCTGG + Intergenic
984436280 4:179714017-179714039 CAGAACAAGAGGAAGACAGAGGG - Intergenic
984680718 4:182606225-182606247 GAGAACAAGAGGTAGCAGGCCGG + Intronic
984734474 4:183098008-183098030 CAGAAGAAGATGACGGGGGACGG + Intergenic
985475836 5:78558-78580 CAGGACAAGAGGAAATGGGTTGG - Intergenic
985573988 5:665304-665326 AGGAGCAGGAGGAAGGGGGCAGG + Intronic
986170773 5:5312752-5312774 GAAAACAAAAGGAAGGGGGCTGG - Intronic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
987811419 5:22840960-22840982 AAGAACAAGGGGAAGGATGCAGG + Intronic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
988487342 5:31677881-31677903 CAGCAGAGGAGGAAGGGGGGAGG + Intronic
989541312 5:42622140-42622162 CAGAGCAAAAGGAGGGGGCCTGG + Intronic
989547854 5:42695240-42695262 GTGAACAAGAGGAAAAGGGCAGG + Intronic
990276814 5:54205956-54205978 CAGAAGAAGAATAAGGGGGAAGG - Intronic
990435215 5:55783610-55783632 CAGACCAAAAGGAAGGAGGGAGG + Intronic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990624633 5:57597630-57597652 AAGAACTGGAGGAATGGGGCCGG + Intergenic
990879967 5:60528273-60528295 CAGGACAATAGGAAAGGAGCAGG + Intergenic
991962203 5:72056448-72056470 CTGAACAAAAGAAAGGGTGCTGG - Intergenic
992501298 5:77346800-77346822 TAAAACAAGAGGAAGGAGGAAGG + Intronic
993551123 5:89275215-89275237 GAGAACAAGAGAAAAGGGGGAGG - Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
994997205 5:107079025-107079047 CAAAAAAAGAGGAAAGGGGGAGG + Intergenic
995418781 5:111939089-111939111 AAGACCAAGAGCAAGGGGGACGG - Intronic
995495556 5:112738130-112738152 CAGAAGAGGAAGAAGGGGGAGGG + Intronic
996786076 5:127237820-127237842 CAGAAATAGAGGAAGGGAGCAGG - Intergenic
997288245 5:132699856-132699878 AAGAAGAAGAGGGAGCGGGCCGG - Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997727118 5:136131334-136131356 CAGAGTGAGAGGAAGGGAGCGGG + Intergenic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
997963751 5:138341554-138341576 CAGCCCAAAAGGAAGGGGGCAGG + Intronic
998176740 5:139905803-139905825 CAGAACCAGAGCCAGGGGCCAGG + Intronic
998397454 5:141827867-141827889 CTCAACAAGAGGAGGGTGGCTGG - Intergenic
998475892 5:142421525-142421547 CAGATAATGAGGAAGGGGCCAGG + Intergenic
998506227 5:142674864-142674886 CAGAATAAGAGGGAGAGGCCTGG + Intronic
998771785 5:145553999-145554021 CAGAAAAGAAGGAAGAGGGCTGG + Intronic
998848013 5:146329679-146329701 CAGAACAAGAGGGAGAGGAAAGG - Intronic
998857572 5:146408322-146408344 GAGAATAAGAGGAGTGGGGCTGG - Intergenic
1000154252 5:158535086-158535108 CAGAACCAGGGAAAAGGGGCAGG - Intergenic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1001588389 5:172849005-172849027 CAGAACAGGAGTAAGGCAGCCGG + Intronic
1002900170 6:1404450-1404472 CATCCCAAGAGGAATGGGGCAGG + Intergenic
1002923004 6:1586482-1586504 GAAAACAAGAGGAAGGAGGAAGG - Intergenic
1002968021 6:1986855-1986877 CAGAATGAGAGTAAGGGGGCTGG + Intronic
1003192491 6:3886835-3886857 CACGACATGAGGAAGGGGGAAGG + Intergenic
1003253586 6:4455074-4455096 CAAAACAGTAGGAAGGAGGCTGG - Intergenic
1003637062 6:7842099-7842121 CACAACAAGGGAAAGGGGGATGG - Intronic
1003838353 6:10094680-10094702 CACAAGAAGAGCAAGGGGGATGG + Intronic
1004117979 6:12789918-12789940 AAGAAAAAGAGGGAGGGGGGAGG - Intronic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005838014 6:29722682-29722704 GAGAAGAAGAGGAGGGGGGCGGG + Intergenic
1005972304 6:30770934-30770956 CAGAATAAGAGGAGAGGGGAGGG - Intergenic
1006171915 6:32097943-32097965 CACAGCCAGTGGAAGGGGGCAGG + Intronic
1006183912 6:32169662-32169684 CAAACCCAGAGGAGGGGGGCTGG - Intronic
1006207586 6:32361993-32362015 CATAAGAAGAGGAACGGGCCGGG + Intronic
1006303741 6:33207310-33207332 GAGAGCAGGAGGGAGGGGGCTGG + Intergenic
1007198968 6:40089023-40089045 CAGAACAAGATGAAGGAGGAGGG + Intergenic
1007258534 6:40545590-40545612 CAGAGGAAGAGGAAGAGGGGAGG + Intronic
1007391750 6:41553413-41553435 CAGAAAAAAAGGAATGGGGGAGG - Intronic
1007698226 6:43747271-43747293 CAGAACAAAAGGAAGATGGAGGG + Intergenic
1007908687 6:45490601-45490623 CAGAACAAGAGGAATGTATCAGG - Intronic
1008280375 6:49589023-49589045 AAGAGCAAGAGGAGGGGGGAGGG - Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008613463 6:53205035-53205057 CAGAGAGATAGGAAGGGGGCAGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1013171290 6:107638505-107638527 CAAAAAAACAGGAAGGGGCCTGG - Intronic
1013610603 6:111791111-111791133 CTGAACAAGAGGAACAGGGCTGG + Intronic
1013611734 6:111802249-111802271 CAGAGCAAGAGGAAGAGGAGAGG - Intronic
1013656885 6:112255189-112255211 CAGGCCAAGAGGAAGAGGCCGGG - Intergenic
1013760274 6:113510275-113510297 CAGAACAGGAGGAAGGGACCGGG - Intergenic
1014270626 6:119331901-119331923 CACAAGAAGAGGGTGGGGGCAGG + Intronic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1014700883 6:124686445-124686467 CAGAGCAGGAGGAAAGGGGAGGG + Intronic
1015111454 6:129596449-129596471 CAGAACAAGGGGAATTGGGAAGG - Intronic
1015506357 6:133992783-133992805 CAGTACTTGAGGAAGTGGGCTGG + Intronic
1015582032 6:134736118-134736140 CAGATCAAGAGGAAGGGAGTGGG - Intergenic
1015835156 6:137412840-137412862 CAGAACCAGAGGAACACGGCAGG + Intergenic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1016608767 6:145964390-145964412 CAGCGCAGGAGAAAGGGGGCGGG - Intronic
1017033051 6:150241129-150241151 TCCAAAAAGAGGAAGGGGGCTGG + Intronic
1017052785 6:150408947-150408969 CAGCACTAGAGGGACGGGGCTGG + Intergenic
1017894526 6:158667785-158667807 CAGAACAAGAGGCCTGTGGCAGG + Intronic
1018275284 6:162123942-162123964 GAAAACAAGAGGAAGGGAGAAGG + Intronic
1018392248 6:163349580-163349602 TAGGACCAGAGGAAGGAGGCAGG - Intergenic
1018469302 6:164082022-164082044 CACAAACAGAGGAAAGGGGCGGG - Intergenic
1018564566 6:165137619-165137641 CAGAGCAAGAGGAAGGAGTAGGG - Intergenic
1019105373 6:169663144-169663166 CAGAACCAGAGCAAGGGAGTGGG + Intronic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019664229 7:2243375-2243397 CAGATGATAAGGAAGGGGGCAGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020047144 7:5048843-5048865 CAGAGCAGGAGGAAGAGGGAGGG + Intronic
1020784620 7:12557650-12557672 GAGAAAAAGAGAAAGGGGGGAGG + Intergenic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1022035431 7:26529578-26529600 CAGAACAAGAGGTTGGAGGAAGG - Intergenic
1022555855 7:31295186-31295208 CAGACCAAGAGAAAGGAGGCAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023528922 7:41133573-41133595 CAGAAGAAGGGGGTGGGGGCGGG + Intergenic
1023853328 7:44163020-44163042 CAGAGCATGAGTAAGGGTGCAGG + Intronic
1024605630 7:51020371-51020393 CTCAGCCAGAGGAAGGGGGCAGG - Intronic
1026154548 7:67815735-67815757 AAAAAGAAGAGGAAGGGGGCTGG + Intergenic
1026530910 7:71196433-71196455 CAGAAGCAGAAGAAGGGGCCAGG - Intronic
1026638776 7:72106565-72106587 GAGAAAAAGAGGAAGGTGGAAGG + Intronic
1026686115 7:72511679-72511701 TATAAAAAGAGGAAGAGGGCCGG + Intergenic
1027265779 7:76494562-76494584 CAAGAGCAGAGGAAGGGGGCAGG - Intronic
1027317150 7:76992679-76992701 CAAGAGCAGAGGAAGGGGGCAGG - Intergenic
1028877425 7:95839325-95839347 AAGAAAAAGAGAAAGGAGGCTGG - Intronic
1029423663 7:100484107-100484129 CAGGACAAGGGGAAGGGGAGGGG + Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1031371682 7:120975512-120975534 CAGTTCATGAGGGAGGGGGCGGG + Exonic
1031537150 7:122948962-122948984 GAGAACAAGAGGGAGAGGGAGGG - Intergenic
1031955385 7:127937414-127937436 CGGAAAGAGAGGAAGGGGGAGGG - Intronic
1031995528 7:128227899-128227921 CAGAAGAGCAGGAAGGGGGAGGG + Intergenic
1032720450 7:134547082-134547104 TAGACAAAGAGGAAGGGGGAGGG + Intergenic
1033354201 7:140586220-140586242 AAGAAATGGAGGAAGGGGGCTGG + Intronic
1033599231 7:142876963-142876985 CAGAACCAGAGGAAGGGTCGTGG + Intronic
1033994488 7:147328974-147328996 CAGACCAAGAGGAAAGGTGAAGG + Intronic
1034455423 7:151167535-151167557 CCGAACAAGATGCAGCGGGCCGG - Exonic
1034861065 7:154595223-154595245 CAGAAAAGGAGGAAGCTGGCAGG - Intronic
1034996583 7:155581135-155581157 CAGAACAATAGGCAGGTGCCCGG - Intergenic
1035066545 7:156109335-156109357 TAGATCAGGAGGAACGGGGCAGG - Intergenic
1035227313 7:157440859-157440881 CACAACATGATGATGGGGGCAGG + Intergenic
1035949998 8:4009798-4009820 GAGAACAGGAGGGAGGGGGATGG - Intronic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1037260598 8:17002707-17002729 TAGAAGAAGAGGAAGGGAGGAGG + Intergenic
1037334641 8:17780218-17780240 GAGAGCAAGAGCAAGGGGACGGG - Intronic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1038005242 8:23424351-23424373 TAGAACATGAGCCAGGGGGCAGG - Intronic
1040011085 8:42661671-42661693 CAGAGCAAGAGCATGTGGGCAGG + Intergenic
1040491711 8:47929349-47929371 CAGAACAAGAGGAGGGAAGGTGG + Intronic
1040881310 8:52207810-52207832 CCTAATTAGAGGAAGGGGGCTGG + Intronic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041598667 8:59689124-59689146 CGTAATAAGAGGAAGGGGCCTGG - Intergenic
1042164680 8:65934032-65934054 GAGAACAAAATGTAGGGGGCAGG + Intergenic
1044580813 8:93824479-93824501 CAGAATAAGAGGAATGGGTTTGG - Intergenic
1045987403 8:108264567-108264589 GAGAGCAGGAGGAAGGTGGCAGG - Intronic
1046520672 8:115321053-115321075 TAGAGCAGGAAGAAGGGGGCTGG - Intergenic
1046710617 8:117506940-117506962 CACACCACAAGGAAGGGGGCAGG - Intergenic
1046869841 8:119193729-119193751 CAGAAAGAGAGAAAGGGGGGGGG + Intronic
1046893635 8:119449795-119449817 CAGATGAAAAGGAAGAGGGCCGG - Intergenic
1048400767 8:134067242-134067264 GATAACAAGAGGAAGCTGGCTGG - Intergenic
1048891220 8:138949298-138949320 CAGAACCAGAGGAAAGGAGGAGG + Intergenic
1048972573 8:139653515-139653537 GAGAACAAGAGGAAAGGCGGCGG - Intronic
1049198895 8:141330311-141330333 GAGAAGAAGAGGAAGAGGGAAGG - Intergenic
1049310646 8:141931962-141931984 CAGAACCACAGGAGGGGTGCAGG + Intergenic
1050267478 9:3906088-3906110 GGGAGCAAGAGGAAGGGTGCAGG + Intronic
1050517621 9:6461387-6461409 CAGAACAAGGGGCGGGGGGGAGG - Intronic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1051662121 9:19435416-19435438 AGGAAAAAGAGGAAGGGGGCAGG + Intronic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1052821945 9:33144532-33144554 CAGAAAAAGAGAAAATGGGCTGG - Intronic
1053144865 9:35705506-35705528 AGGAACAAGGGGCAGGGGGCAGG + Intronic
1053440212 9:38109800-38109822 CAGAAGAAGCGCAAGGGGCCAGG + Intergenic
1054456625 9:65434570-65434592 CCGGACAAGAGGAAGGCGGCAGG - Intergenic
1054907139 9:70421172-70421194 CAGGAGGAGAGGAAGGGGGAGGG - Intergenic
1057037099 9:91818918-91818940 CTGCAGAAGAGGGAGGGGGCAGG - Intronic
1057138227 9:92710130-92710152 CAGAAGATGAGGATGGGGGAGGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1057983236 9:99683016-99683038 CAGAGCAAGAGGAAGAGAGATGG + Intergenic
1058115297 9:101078177-101078199 AAGAAGAAGAGGAGGGGGGGAGG + Intronic
1058394018 9:104528885-104528907 AAGCACAAAAGGAATGGGGCAGG + Intergenic
1059267683 9:113051004-113051026 GAGAAATAGAGGAAGGGGGAAGG + Intronic
1059324755 9:113497441-113497463 CAGGAAAGGAGGGAGGGGGCAGG - Intronic
1059723038 9:116980117-116980139 GAGAACAAGAGGATGGGACCGGG - Intronic
1059777377 9:117489054-117489076 CAGAAGAAGAGGAACTGGGCTGG - Intergenic
1059949127 9:119443441-119443463 AAGAAAAAGAGAAAGGGGCCAGG + Intergenic
1060389322 9:123266293-123266315 CAGTAAATGAGGAAGGGGGAAGG - Intronic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061144702 9:128790848-128790870 CAGAACAGGAGGAAGAAGCCAGG - Intronic
1061309808 9:129754826-129754848 CAGAACCCGGGGAAGCGGGCAGG - Intergenic
1061329662 9:129884661-129884683 CAGAACCACAGGCAGGCGGCAGG - Intergenic
1061581401 9:131538979-131539001 AAAAACAAGAGGAAGGGGCTGGG - Intergenic
1062129944 9:134886902-134886924 AAGAACAGGAGGCAGGGGTCAGG - Intronic
1062413786 9:136437990-136438012 CAGAAAAAAACAAAGGGGGCAGG + Intronic
1062430185 9:136523447-136523469 CACGGCAGGAGGAAGGGGGCAGG + Intronic
1062479210 9:136743721-136743743 CAGGACAAGAGAGAGGTGGCTGG - Intergenic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062676044 9:137744611-137744633 CAGAACAAGTTCAAGAGGGCGGG - Intronic
1185509070 X:649332-649354 CAGAAAAAGAGAGAGGAGGCCGG - Intronic
1185543198 X:920555-920577 CAGAACATGAGGCAGGGAGCCGG - Intergenic
1185671220 X:1811608-1811630 CAGCAGAAAAGGAAGGTGGCAGG + Intergenic
1187148328 X:16657907-16657929 CAGAAAAATAGAAAGGTGGCCGG + Intronic
1187275088 X:17810066-17810088 CAAAACAAGAGGGGTGGGGCCGG - Intronic
1188348099 X:29093323-29093345 CAGAGCAGGAGGAGGGGGGTGGG + Intronic
1188661524 X:32765365-32765387 CAGAACAGGAGCAAGAGGGGTGG - Intronic
1189269365 X:39740137-39740159 CAGAGGAAGAGGCAGGGGCCCGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1190165800 X:48071867-48071889 AGGAACAATAGGAAGGCGGCAGG - Intergenic
1190395221 X:49975544-49975566 CAGAACTCCAGGAAGAGGGCAGG - Intronic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1191201739 X:57790560-57790582 CAGAACAACTCGAAGTGGGCAGG - Intergenic
1193189159 X:78548964-78548986 CTGAACAATAGGAAAGTGGCAGG + Intergenic
1193278506 X:79620467-79620489 CAGAGCAGGAGGTAGGCGGCAGG + Intergenic
1193547427 X:82846920-82846942 CAGAGCAGGAGGAAGTGGGAGGG - Intergenic
1193656648 X:84206466-84206488 CAGTACATGAGGAAGGGGAGGGG + Intergenic
1193906203 X:87247499-87247521 CTGAACAAAAGGAAAGGAGCTGG - Intergenic
1194868562 X:99099138-99099160 CAGGACAAAAGGAGTGGGGCTGG - Intergenic
1195206537 X:102605121-102605143 CAGTAAAAGAGGCAGGGGGTAGG - Intergenic
1195477682 X:105304994-105305016 CAGAGCAGGAGGAAAGGGGGAGG + Intronic
1195907267 X:109856768-109856790 CAGAGAGAGAGGATGGGGGCAGG + Intergenic
1197464131 X:126783038-126783060 GAGAACAACAGCATGGGGGCAGG - Intergenic
1198423137 X:136487845-136487867 CATAAGGAGAGGGAGGGGGCTGG - Intergenic
1200691700 Y:6311843-6311865 CAGAAAAAAAGAGAGGGGGCTGG - Intergenic
1201043572 Y:9862880-9862902 CAGAAAAAAAGAGAGGGGGCTGG + Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic
1201973065 Y:19817058-19817080 TAGACAAAGAGGAAGGGGGAGGG - Intergenic
1202169301 Y:22024094-22024116 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202222060 Y:22562271-22562293 GAGAACCAGAGGAAGGAGGGAGG + Intergenic
1202321055 Y:23633396-23633418 GAGAACCAGAGGAAGGAGGGAGG - Intergenic
1202549712 Y:26036660-26036682 GAGAACCAGAGGAAGGAGGGAGG + Intergenic