ID: 946100833

View in Genome Browser
Species Human (GRCh38)
Location 2:217320226-217320248
Sequence TTACATAAATACATGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 311}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946100833 Original CRISPR TTACATAAATACATGGAGTT AGG (reversed) Intronic
901672564 1:10864797-10864819 TTACAGAAACACAAGGAGCTAGG + Intergenic
905032401 1:34895580-34895602 TTGCATATACACATGGATTTTGG - Intronic
907879111 1:58527915-58527937 TCACATAAATACAAGTAATTAGG - Intronic
908011619 1:59784312-59784334 TTACTTAAGTACTTGAAGTTTGG + Intergenic
908798518 1:67854970-67854992 TTAAAAAAATATATAGAGTTGGG - Intergenic
909774608 1:79467898-79467920 TTGCAGAAATGCATGGAGATTGG + Intergenic
909971218 1:81992507-81992529 TTTCATATATCCATGGACTTTGG - Intergenic
909973847 1:82022499-82022521 TGACATCAATACCTGGAGCTGGG + Intergenic
910538733 1:88330611-88330633 TGACATAGAAAAATGGAGTTTGG - Intergenic
911782471 1:101899526-101899548 GGACATAAATACAAGGAATTTGG + Intronic
911819754 1:102402813-102402835 CTAAATAAATACATGAAATTGGG + Intergenic
912057193 1:105617594-105617616 ATACATAAATATACAGAGTTAGG - Intergenic
912090561 1:106069648-106069670 TTGCATAGAAACATGAAGTTAGG + Intergenic
912155459 1:106913479-106913501 TTAAATAAATTCATGGTGATAGG - Intergenic
912308233 1:108593175-108593197 ATACATAAATAAAAGGAGTTTGG + Intronic
915697330 1:157757253-157757275 GTACTTCAATATATGGAGTTTGG - Intronic
916232907 1:162558015-162558037 GTGCATAAATACATGGGGGTAGG - Intergenic
916858109 1:168772831-168772853 TTACATAATTTGAAGGAGTTTGG - Intergenic
917387956 1:174498237-174498259 TTCTATAAATATATGTAGTTAGG - Intronic
918544762 1:185670024-185670046 TTACAAAACTACTTTGAGTTGGG + Intergenic
919312747 1:195932101-195932123 TTACATAACTGAATGTAGTTTGG - Intergenic
919328843 1:196143185-196143207 TTATTCAAATAAATGGAGTTTGG - Intergenic
921017075 1:211201933-211201955 TTACATAAATATATATATTTAGG - Intergenic
921552871 1:216560028-216560050 TTAAATAAAAACATTCAGTTAGG - Intronic
921772536 1:219059240-219059262 TTAAATAAATACCTGGAAGTGGG - Intergenic
922513507 1:226188680-226188702 TCACATAAAAACATGAAGTATGG + Intergenic
922920537 1:229298842-229298864 TTACAGAAATATATGGTTTTAGG + Intronic
923218539 1:231872362-231872384 TTAAATCAATAAAAGGAGTTAGG - Intronic
924292846 1:242555589-242555611 TTAAATAAATTCAGGGATTTTGG + Intergenic
924822559 1:247507497-247507519 TTACATAAATGCATAAAGTCTGG - Intronic
1062820017 10:527930-527952 CTACATAATTACGTGGAGCTGGG - Intronic
1064889492 10:20154070-20154092 TTTCTTAAATACATGGAGTTTGG + Intronic
1066673842 10:37867245-37867267 TTACATGATCACATGGAGCTTGG - Intergenic
1067134156 10:43593569-43593591 TTAGAGAAATTCCTGGAGTTGGG - Intergenic
1067551793 10:47241574-47241596 TTCCATAGAGACATGGAGTCGGG + Intergenic
1068586420 10:58804757-58804779 CAACATAAATACATCGAGTTAGG - Intronic
1069179198 10:65334655-65334677 TTAACTAAATACAAGGAGGTAGG + Intergenic
1070300068 10:75197067-75197089 TTACACAAAGACATATAGTTTGG - Intergenic
1070334420 10:75441417-75441439 ATACATAATAACATGGTGTTGGG - Intronic
1071464661 10:85928301-85928323 TTACATAAATACATAAAGTTTGG + Intronic
1072005878 10:91246481-91246503 TTATATAAACACATGAAGTCAGG + Intronic
1072988905 10:100170640-100170662 TTTTATTAATACATGGATTTTGG + Intronic
1073551234 10:104403618-104403640 TTATATAAAAAGTTGGAGTTAGG - Intronic
1074094904 10:110303354-110303376 TTACATATATACATAGGGTGGGG + Intronic
1075756554 10:124816718-124816740 CTCAATAAATACATGGATTTGGG - Intronic
1078064680 11:8070633-8070655 TTAAAGAAATACAAGTAGTTGGG + Intronic
1079054169 11:17191081-17191103 TCTTATTAATACATGGAGTTAGG + Intronic
1079061034 11:17249049-17249071 TTACTTAGATCCATGGACTTGGG - Intronic
1079228478 11:18628870-18628892 TTTTTTAAATACATGGAGCTTGG + Intronic
1079948843 11:26776842-26776864 TTACATAAATACAAGCTCTTGGG + Intergenic
1080292515 11:30687142-30687164 TTATATGTATATATGGAGTTAGG + Intergenic
1081708225 11:45199140-45199162 TAACATAAAAGCATGGAGTTTGG - Intronic
1087955603 11:104283252-104283274 TTAATTAAATACATGAAGTTAGG + Intergenic
1089245106 11:117113479-117113501 ATCCATAAATACCTGGTGTTTGG - Intergenic
1090537428 11:127659058-127659080 ATACATATATATATGGAGATAGG + Intergenic
1090836289 11:130456530-130456552 TTACAAACAGACATGGATTTTGG + Intronic
1091023420 11:132121472-132121494 TTACTTAAATAAATGGAGCTGGG - Intronic
1091479002 12:807384-807406 GTACATAAAAACAAAGAGTTAGG - Intronic
1092021116 12:5202932-5202954 TTCCATCAATAAATGGACTTTGG - Intergenic
1092397458 12:8140674-8140696 TTACATCAATATCTGGATTTGGG - Intronic
1092667902 12:10825681-10825703 TTAAAAAAATACATGTAATTAGG + Exonic
1093126359 12:15333507-15333529 TTGAATAAATAAATGGAGTGAGG + Intronic
1094188142 12:27667445-27667467 TTATATAAATAAATTGACTTTGG + Intronic
1094586857 12:31784969-31784991 TTAAATAAATATATGTATTTTGG - Intergenic
1097570713 12:61327505-61327527 TTTGATATATACATGGAGTAGGG - Intergenic
1097783504 12:63734156-63734178 TTATAGAAATAGATGGACTTGGG - Intergenic
1099513745 12:83570022-83570044 TTATTAAAATCCATGGAGTTGGG + Intergenic
1100566845 12:95803817-95803839 TTATATGGAAACATGGAGTTAGG - Intronic
1102540723 12:113617442-113617464 TTGGATACATACATGGAGGTAGG + Intergenic
1104100829 12:125607492-125607514 TTACTAAAATACCTGAAGTTAGG + Intronic
1104119127 12:125781836-125781858 TTAGATAAAATCAAGGAGTTCGG - Intergenic
1105042610 12:132972227-132972249 TCTCACAAATAAATGGAGTTCGG - Intergenic
1105575417 13:21646580-21646602 TTACAAAACTTCATGGAGGTGGG + Intergenic
1105637016 13:22225391-22225413 TTGCAAAAATGCATGGATTTAGG + Intergenic
1108406372 13:50107046-50107068 ATACATATTTAGATGGAGTTTGG - Intronic
1108814573 13:54274065-54274087 TAAGATAAATATATTGAGTTTGG + Intergenic
1109172094 13:59109074-59109096 TCTCATATATGCATGGAGTTAGG + Intergenic
1109383556 13:61597863-61597885 GTAAATAAATATCTGGAGTTTGG + Intergenic
1109785698 13:67172065-67172087 TAACATACATTCATGGATTTAGG - Intronic
1110067999 13:71133249-71133271 TGACTTAAATACATGGATTTGGG + Intergenic
1110391448 13:74979745-74979767 TTATACAAATAAATGGATTTAGG + Intergenic
1110391476 13:74980066-74980088 TTATACAAATAAATGGATTTAGG + Intergenic
1111356544 13:87113317-87113339 TTACATAAATATATTATGTTTGG + Intergenic
1111516526 13:89339401-89339423 ATGAATAAATACATGTAGTTAGG - Intergenic
1111595092 13:90401369-90401391 TGACATATATGCATGAAGTTGGG + Intergenic
1111715992 13:91879374-91879396 TTAAATAAATATCTGGAATTGGG + Intronic
1112068997 13:95827230-95827252 TTTCAAAAATACATGAATTTTGG + Intronic
1112089981 13:96072815-96072837 TTACATCAACACATGTGGTTGGG + Intergenic
1112181341 13:97084043-97084065 TTTAATAAATGCATGGAGTCAGG - Intergenic
1113572036 13:111365027-111365049 TTTCATAAATTCACAGAGTTGGG - Intergenic
1113601336 13:111570749-111570771 GTATATATATATATGGAGTTAGG - Intergenic
1113635854 13:111918676-111918698 ATACACAAATACATGGAGATAGG + Intergenic
1114629574 14:24150527-24150549 CAACAGAAATACAGGGAGTTGGG - Intronic
1114754021 14:25238154-25238176 TTAAATAACCACATGGGGTTAGG - Intergenic
1114980116 14:28152835-28152857 GTAAATATATACATGGACTTTGG - Intergenic
1115159878 14:30381843-30381865 TTATAAAAATACATGCATTTGGG + Intergenic
1115495294 14:33998180-33998202 TTATATAAATACATGAAATCAGG - Intronic
1116271727 14:42779060-42779082 TCACATAAATACCTGGAGGGTGG - Intergenic
1116313026 14:43350444-43350466 TGACATAAATACCTGAGGTTGGG + Intergenic
1116667279 14:47793834-47793856 TTAAATTAATAGATGGAATTGGG + Intergenic
1117769167 14:59114915-59114937 TTAGAGAAATACTTGAAGTTGGG - Intergenic
1118179782 14:63480744-63480766 ATACATAAAAAAATGGAGTCTGG - Intronic
1118416198 14:65538965-65538987 CTAGATAAATCCATTGAGTTTGG + Intronic
1119086546 14:71744389-71744411 TTACATAAAGATAGGGAGTAAGG - Intergenic
1119443666 14:74646662-74646684 TTACATAAAAAACTGGAGTTTGG + Intergenic
1120511287 14:85418278-85418300 TTATATAAATAGATGCAGATAGG + Intergenic
1124248465 15:28092133-28092155 TTTTATATATACATGGAGTCAGG - Intronic
1125308402 15:38349822-38349844 TTTCCTAGATACATGGAATTAGG - Intronic
1125487470 15:40122296-40122318 TTTTATAAATAGATGAAGTTGGG - Intergenic
1126500415 15:49339253-49339275 GTACATAAATCCATGAAGATGGG - Intronic
1127936476 15:63644546-63644568 TAACATAAATTCATGAAGCTAGG - Intronic
1128600905 15:68994673-68994695 TTACTAAAATTCCTGGAGTTTGG - Intronic
1129918012 15:79291916-79291938 TTATATACTTACATGTAGTTTGG + Intergenic
1133049519 16:3109223-3109245 ATAAATAAATAAATAGAGTTGGG + Intergenic
1133624181 16:7554895-7554917 TAACATAAATCCAAGGTGTTGGG + Intronic
1138704399 16:58899394-58899416 TTGCATAAATTGATGGATTTGGG - Intergenic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1140694206 16:77516070-77516092 ATCCATCAATAAATGGAGTTTGG - Intergenic
1140736740 16:77904803-77904825 TTACATAAAAATATGGATTAAGG - Intronic
1141043723 16:80695161-80695183 TTACATAGATGCATGGACATGGG - Intronic
1141292840 16:82736253-82736275 TTATATAAATATATTTAGTTAGG - Intronic
1142481697 17:222856-222878 TTATAAAAATATATGGAATTAGG - Intronic
1144568134 17:16377087-16377109 TTACATAAATACATGAAAGATGG - Intergenic
1145055100 17:19697483-19697505 TTACATAAACATATGAACTTCGG + Intronic
1149223852 17:54445310-54445332 TTCCATAAATGCTTGGAGCTAGG - Intergenic
1151112625 17:71696961-71696983 ATAAATAAATATATGGAGTGGGG + Intergenic
1154078409 18:11228916-11228938 TTACATAATTATATGGGTTTTGG - Intergenic
1155000498 18:21681468-21681490 CTACAGACCTACATGGAGTTTGG - Intronic
1155999318 18:32367481-32367503 TTCTATAAATCAATGGAGTTTGG - Intronic
1157329799 18:46695330-46695352 GTAACTAAATACATGGATTTTGG + Intronic
1157619355 18:49007159-49007181 TTAGAAAAAAACATGGAGTGTGG - Intergenic
1157703923 18:49785134-49785156 TTATAGAAATGCATGGATTTAGG - Intronic
1157705458 18:49801212-49801234 TAACATAAATATTTGGGGTTAGG - Intronic
1157709557 18:49840851-49840873 TTGGATAAATGCATGGAGCTGGG + Intronic
1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG + Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158256352 18:55553568-55553590 ATACATAAACACAGGGAGTTGGG - Intronic
1158529545 18:58246785-58246807 GTCTATAAATACATGGAGATAGG - Intronic
1159120310 18:64161439-64161461 TTAAATAAAAACATTGAGATTGG + Intergenic
1159334777 18:67048231-67048253 ATACATACATACATGGTGCTGGG - Intergenic
1159546743 18:69849124-69849146 TTATATTAAAAGATGGAGTTAGG - Intronic
1159912992 18:74164189-74164211 ATATATTAATGCATGGAGTTTGG - Intergenic
1161540797 19:4850237-4850259 TTAAATAAATACATGCAGCTGGG - Intronic
1162333249 19:10043507-10043529 GTAAATAAATATACGGAGTTGGG + Intergenic
1162634598 19:11957498-11957520 TTAAATAAATACATAAAGTGGGG + Intronic
1164314317 19:24073374-24073396 TGACTCAAATACATGGACTTAGG + Intronic
926254763 2:11181956-11181978 TTATATAAATACACAGAGTTTGG - Exonic
926464731 2:13174399-13174421 TATCATAAATATAAGGAGTTGGG - Intergenic
927229362 2:20805334-20805356 CTTTATAAATACATGGAATTAGG - Intronic
928329892 2:30349654-30349676 ATTCATAGGTACATGGAGTTAGG + Intergenic
930714297 2:54578267-54578289 TTACCCAGAAACATGGAGTTAGG + Intronic
931499612 2:62850681-62850703 TTATATAAATATATTGGGTTGGG + Intronic
931582032 2:63786741-63786763 TTACATCAATGCATGCAATTTGG - Intronic
931933959 2:67174797-67174819 TTACATATTTGCATTGAGTTAGG - Intergenic
934085690 2:88507345-88507367 ATACATATATATATAGAGTTGGG + Intergenic
935008842 2:99111721-99111743 GAACATAATTACATAGAGTTTGG + Intronic
937464909 2:122124274-122124296 TTAAATAAATCCATGAAGATGGG - Intergenic
937644572 2:124251815-124251837 TTTCATAAATACAGGCAGGTAGG - Intronic
939299870 2:140321599-140321621 TTGAATAAATAAATGGATTTTGG + Intronic
939768360 2:146282653-146282675 TAACATAGATACTTGGAGATGGG + Intergenic
940649089 2:156423051-156423073 TTACAGTAATCCATGGAGGTAGG + Intergenic
943621459 2:190152366-190152388 TTAAATAAATAAATAGTGTTGGG - Intronic
944152495 2:196574935-196574957 TCATTTAAATACATGGTGTTGGG + Intronic
945233781 2:207615820-207615842 TTACATAAACACATATAGATTGG + Intronic
945261712 2:207849849-207849871 TTACATAAATACTTACTGTTTGG - Intronic
945533647 2:210986339-210986361 GTAGATAAATTCATGGAGATGGG - Intergenic
946100833 2:217320226-217320248 TTACATAAATACATGGAGTTAGG - Intronic
946373209 2:219293157-219293179 ATAAATAAATAAATGCAGTTTGG - Intronic
946821621 2:223635653-223635675 ATAGATAAATTCATAGAGTTAGG + Intergenic
946977791 2:225173026-225173048 TGAAATAAATATATGGATTTGGG - Intergenic
947529154 2:230897766-230897788 ATAGATAAATAGATGGAGTCTGG - Intergenic
1172159315 20:32854770-32854792 TTATATATATATATGCAGTTTGG + Intergenic
1172870664 20:38133625-38133647 GTAAATAAATACAAGTAGTTGGG + Intronic
1176741335 21:10606148-10606170 TTACACACAGACATGGAGGTTGG + Intergenic
1177368124 21:20165384-20165406 TTTCATAAATACATCTAGTGTGG + Intergenic
1177689601 21:24488223-24488245 TTCCATGTATACATGGAATTGGG - Intergenic
1177844523 21:26273043-26273065 TTAGATGAGTACAAGGAGTTTGG + Intergenic
1178790071 21:35691707-35691729 TTACTGAAATACAAGGGGTTTGG - Intronic
1179554925 21:42166605-42166627 GTACATAAATATTTGTAGTTGGG - Intergenic
1180125771 21:45789444-45789466 GTGCATACATACATGCAGTTGGG + Intronic
1183030860 22:35103681-35103703 TGAAATAAATACATGGATTTAGG + Intergenic
1184543296 22:45145176-45145198 ATACAGAAATGCATGGAGATAGG - Intergenic
949997516 3:9629943-9629965 CTAAATAAATACATGAACTTTGG + Intergenic
951246740 3:20350011-20350033 TTACATAAGTGCAAAGAGTTGGG - Intergenic
952266663 3:31793642-31793664 TTACAAAATAACATGGAATTAGG + Intronic
953593888 3:44288998-44289020 TTTGTTAAATACATGGAGTATGG - Intronic
956156099 3:66299159-66299181 TTAAATACATACATGGAAATGGG - Intronic
956361796 3:68455961-68455983 TGAATTAAATACATGGTGTTTGG + Intronic
956521714 3:70111152-70111174 TTACATAATGACATGGTGTTGGG + Intergenic
956539051 3:70313719-70313741 GTACATAAAGAAATGAAGTTAGG - Intergenic
957341700 3:78907006-78907028 CTTCATAAAGACATCGAGTTGGG + Intronic
957774345 3:84736494-84736516 TTAAACAAATACATGTAGTATGG - Intergenic
960217299 3:115057476-115057498 TTACATAAATAATTGGAGCAGGG - Intronic
960404617 3:117244767-117244789 ATATATATATACATGGGGTTAGG - Intergenic
960805123 3:121576326-121576348 ATAAATAAATAAATTGAGTTTGG - Intronic
961802435 3:129462137-129462159 TTGTATAAATACATGGAGAAAGG + Intronic
962574476 3:136744026-136744048 GTACAAAAATACAAGGATTTTGG + Intronic
963294865 3:143534793-143534815 TTGGATAAATACATTCAGTTTGG + Intronic
963990063 3:151642714-151642736 TTGAATAAGTACATGGAGGTTGG - Intergenic
964346618 3:155760282-155760304 ATACATAAATAAATAAAGTTGGG + Intergenic
964372986 3:156020462-156020484 TTACATGACAACTTGGAGTTAGG - Intergenic
966109810 3:176386178-176386200 TTTAAAAAATATATGGAGTTAGG - Intergenic
967708673 3:192680953-192680975 TTACATAAAGACATTTAGTAAGG + Intronic
968385442 4:132226-132248 ATAAATAAATAAATGTAGTTTGG + Intronic
969386228 4:6850465-6850487 TTACAAAAATATATAGAGTATGG - Intronic
969801199 4:9566892-9566914 TTACATAAGTCCATGGAGAAGGG + Intergenic
970212270 4:13721996-13722018 TTAGATGATTCCATGGAGTTTGG + Intergenic
970762316 4:19505647-19505669 TTAAATAAATTCATGGATTCAGG - Intergenic
970928457 4:21481428-21481450 TTAACTAAATACATGAAGGTGGG + Intronic
971304035 4:25464780-25464802 GTACATGAAGACATGGAGTATGG + Intergenic
972009915 4:34165281-34165303 TTACATACAAACATGTTGTTAGG - Intergenic
972030550 4:34451860-34451882 TTACAAAAATATAATGAGTTTGG - Intergenic
973117201 4:46476551-46476573 ATAAATAAATGCATGGAGATAGG - Intergenic
973331585 4:48914930-48914952 TTATATAAAGATATGGAGTGGGG - Intergenic
974680641 4:65157064-65157086 TTAGATATATACATGAAATTAGG - Intergenic
974770811 4:66409888-66409910 TTTCATGAATAAATGAAGTTAGG - Intergenic
975346495 4:73298378-73298400 TTACTTCAATAAATGGTGTTGGG + Intergenic
975367921 4:73550342-73550364 TAAAATAAATAAATGGATTTTGG - Intergenic
975397234 4:73890892-73890914 TTAGATAAATAAATGAAGTATGG - Intergenic
976489500 4:85652845-85652867 TCACATAAATATTTGGATTTTGG - Intronic
977733217 4:100379925-100379947 GTACATAACTCCATGGACTTGGG + Intergenic
979700652 4:123663689-123663711 TTAAATAAATCCTTGGAGTGAGG - Intergenic
979927623 4:126587343-126587365 TTAAATAAATAAATAAAGTTGGG + Intergenic
980068769 4:128219819-128219841 ATAAATAAATAAATGGAATTAGG + Intronic
980616540 4:135233891-135233913 TTGCATAAATATATGCTGTTTGG - Intergenic
981227608 4:142314972-142314994 TTAGATAAATAGATGGAGTGAGG - Intronic
981955780 4:150471597-150471619 ATAAATCAATACATGGAATTAGG + Intronic
982418788 4:155168971-155168993 TTATATAGATACATGTATTTTGG + Intergenic
982469677 4:155773172-155773194 TCACAAAAATACATGGAGCTTGG - Intronic
983495039 4:168434195-168434217 AGACACAAATACCTGGAGTTAGG - Intronic
983943709 4:173563535-173563557 TCACATAAATACATGTTGTGGGG - Intergenic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
985393967 4:189521774-189521796 TTACACAAAGACATGAAATTCGG - Intergenic
985945375 5:3178033-3178055 CTTCATAAACACATGGATTTTGG + Intergenic
986580236 5:9258231-9258253 TTACATGAAAATATAGAGTTAGG - Intronic
987532934 5:19144366-19144388 TTAAATAAATGCATAAAGTTTGG - Intergenic
987725797 5:21698256-21698278 TTACATAAATATATGAGCTTAGG + Intergenic
987894070 5:23921766-23921788 CTACATAAATACATAGCATTAGG - Intergenic
988627259 5:32890812-32890834 GTACATAAATACCTGGCCTTTGG + Intergenic
990524908 5:56615673-56615695 TTACATAAATATTTGAAGGTTGG + Intergenic
992505954 5:77388199-77388221 GTAGATAAATACATGAAGATGGG - Intronic
993810803 5:92473577-92473599 TTATAGAAATACATGTAGTAAGG + Intergenic
994743633 5:103652085-103652107 TCAGATAACTACATGGAGTCGGG + Intergenic
995945688 5:117642882-117642904 ATGCATAGATACAGGGAGTTTGG + Intergenic
996421641 5:123269275-123269297 TTACCTATATACATAGAATTGGG + Intergenic
996491440 5:124102642-124102664 ATACATAAACAAATGGAGTGTGG + Intergenic
996705755 5:126496558-126496580 TTTCATAAATTCATGGAGTCAGG + Intergenic
997901097 5:137765369-137765391 TTATACAAATACATGGAAATTGG + Intergenic
998306886 5:141087089-141087111 TTACATAAATACAAAGTGTTTGG + Intergenic
1000171748 5:158708901-158708923 TTACATAAATACTCACAGTTTGG + Intronic
1000895554 5:166850863-166850885 TTAAATAAATAAATGGATGTAGG - Intergenic
1000961602 5:167607351-167607373 TTACATAAAAGCCTGGATTTTGG - Intronic
1001880733 5:175241889-175241911 CTACATAAATGACTGGAGTTTGG + Intergenic
1002858425 6:1058308-1058330 TGACATAACTACAAGGGGTTGGG - Intergenic
1003053515 6:2800011-2800033 ATACATAAGTAAATGGAGCTGGG + Intergenic
1004627157 6:17387641-17387663 ATACACAAATACATGCTGTTAGG + Intergenic
1005355346 6:24977847-24977869 TTAGATGAATACATGGAGGTAGG - Intronic
1006715751 6:36118915-36118937 TTACATAAACACTTGGAGGGGGG - Intergenic
1009271505 6:61620890-61620912 TAACATATATAAATGGAGTGAGG - Intergenic
1009304882 6:62076110-62076132 TGACAGAAATATATGGGGTTGGG - Intronic
1009790269 6:68392840-68392862 TTACATTAATTTATTGAGTTGGG - Intergenic
1009905374 6:69864594-69864616 TTAGATAAATAAAAGGTGTTTGG + Intergenic
1010107457 6:72186758-72186780 GTACATATATACATGCAGTTCGG - Intronic
1010784546 6:79985062-79985084 TTTCAGAAATGCATGGAGTGTGG + Intergenic
1011175075 6:84551239-84551261 ATAAATAAATAAATGGAATTGGG - Intergenic
1012064450 6:94532593-94532615 TTACTTAAAGACATGCACTTAGG - Intergenic
1012701983 6:102469812-102469834 TTGGATAAATACAAGGAGTGTGG + Intergenic
1012836027 6:104269645-104269667 TTATAAAAATACATGATGTTTGG - Intergenic
1013831389 6:114276864-114276886 TTACATAAATACAAGGATATAGG - Intronic
1013837733 6:114352304-114352326 TTTCATAGCTACATGGGGTTAGG - Intergenic
1014419452 6:121223567-121223589 TTACATACATACATGAAATTTGG + Intronic
1015196773 6:130532224-130532246 TTGAAAAAATAGATGGAGTTAGG - Intergenic
1015750876 6:136557569-136557591 TTATAGAAATAGATGTAGTTAGG + Exonic
1015971730 6:138749229-138749251 TTTGATAAATATATGGATTTTGG - Intergenic
1016152481 6:140759716-140759738 TTACAAAAATACATGGGGGCTGG + Intergenic
1016346833 6:143122885-143122907 TTAAAGAAAAACATGGAGTCAGG - Intronic
1016755928 6:147686721-147686743 TTAAATAAATACGTTGAGTGAGG - Intronic
1016951514 6:149585382-149585404 TTACATTAATACATAGAATTTGG - Intronic
1017060261 6:150477112-150477134 TTAGATGAATACATGGTTTTTGG + Intergenic
1017872616 6:158499974-158499996 CCACATAAATACCTGTAGTTTGG + Intronic
1018072493 6:160177540-160177562 ATAAATAAATACATGGTCTTGGG - Intronic
1020896673 7:13949272-13949294 TTATACAAATATATGTAGTTAGG + Intronic
1021864339 7:24940014-24940036 ATACATAAATAAATAAAGTTGGG + Intronic
1022904082 7:34838969-34838991 TTAATTAAAAACATGGAATTTGG - Intronic
1023251959 7:38273721-38273743 TTACATAAATACATAAAAATTGG + Intergenic
1023324555 7:39039005-39039027 ATATATAAATACATGGATTTAGG + Intronic
1025076398 7:55947232-55947254 TTAAATAAATACACAGAGTTAGG - Intergenic
1025979892 7:66396708-66396730 GAACATAAAAACCTGGAGTTTGG + Intronic
1027512246 7:79097470-79097492 TCACATAAATCCACAGAGTTAGG + Intronic
1027580511 7:79988708-79988730 ATACATAAATACTTGTTGTTAGG - Intergenic
1027641465 7:80738477-80738499 TTACATAATTAAATGGAGATGGG - Intergenic
1027730653 7:81867904-81867926 ATTCACAAATACCTGGAGTTGGG + Intergenic
1028313422 7:89368576-89368598 TGAGATAAAAAAATGGAGTTTGG - Intergenic
1028598278 7:92570932-92570954 TTACATAAATACCTGCTGTCTGG + Intronic
1029815874 7:103094367-103094389 TTAAACAAATATATGGATTTTGG - Intronic
1033523586 7:142187129-142187151 TTACTTAAATGCAAGGAGTAGGG - Intronic
1033804295 7:144937112-144937134 CTACATTGAGACATGGAGTTAGG + Intergenic
1035885075 8:3282819-3282841 TTACATAAGAAAATTGAGTTAGG - Intronic
1037061248 8:14512450-14512472 ATAAATAAATAAATGGATTTGGG - Intronic
1037236398 8:16724612-16724634 TTACAAAAACACATGTATTTGGG + Intergenic
1040893582 8:52341908-52341930 TTCCTTAAATACAAGGAGGTGGG - Intronic
1042415660 8:68514809-68514831 TTACCCAAATAGTTGGAGTTGGG + Intronic
1042693082 8:71525531-71525553 GTACATGAATACATGAAATTAGG - Intronic
1042817103 8:72889755-72889777 ATATATATATAAATGGAGTTTGG - Intronic
1042985931 8:74582882-74582904 TTACAAAAACAGATGGAGGTGGG + Intergenic
1043068856 8:75612778-75612800 CTATATAAATAGATGGGGTTGGG - Intergenic
1043626194 8:82261819-82261841 TTACATTAAGTCATGAAGTTAGG + Intergenic
1044164176 8:88960148-88960170 TTTCATAATTACTTGTAGTTTGG - Intergenic
1044391258 8:91654778-91654800 ATACATAAATACATAAAATTAGG - Intergenic
1045958421 8:107937359-107937381 TTACAGCAATACATGCTGTTTGG + Intronic
1046499095 8:115052648-115052670 TTAGATAAATACCTGGAAGTAGG - Intergenic
1052243950 9:26310814-26310836 TTAAATATGTACATGGTGTTTGG + Intergenic
1052662984 9:31459844-31459866 TTTCACAGATACTTGGAGTTAGG - Intergenic
1052783671 9:32807988-32808010 TTATATTAATACAATGAGTTAGG - Intergenic
1053754579 9:41292514-41292536 ACACATATATAGATGGAGTTAGG + Intergenic
1054260100 9:62856820-62856842 ACACATATATAGATGGAGTTAGG + Intergenic
1055332914 9:75202561-75202583 TTAGATAATTACATTGAGTATGG + Intergenic
1055567275 9:77581845-77581867 TTAAATAAATACAGGGAGGACGG + Intronic
1055852133 9:80644574-80644596 TTACACAAATGCAAGGGGTTCGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056001634 9:82223389-82223411 TTACATATATTTATGGATTTTGG + Intergenic
1057860731 9:98638897-98638919 TTACACATAGACATGTAGTTAGG + Intronic
1058301290 9:103376301-103376323 TTACATGAATACTTGTATTTGGG + Intergenic
1059931127 9:119262242-119262264 TTATATAAATTCATAGACTTGGG - Intronic
1060073651 9:120572595-120572617 TTACATAAATAAATTCAGTGAGG + Intronic
1060184815 9:121557913-121557935 ATAAATAAATGCCTGGAGTTGGG - Intergenic
1061653449 9:132069392-132069414 GAACATAAAGACATGGAATTGGG + Intronic
1186050944 X:5594563-5594585 TGACAAAATTACATGGAGCTAGG - Intergenic
1192699495 X:73452763-73452785 TTACATAATTTCCTAGAGTTTGG - Intronic
1194336756 X:92657508-92657530 TTACCTAAATAAATAGCGTTTGG + Intergenic
1194700329 X:97105908-97105930 TTACACAAATATATGAAGTTGGG + Intronic
1194931519 X:99893714-99893736 GTATATAATTTCATGGAGTTTGG - Intergenic
1197315280 X:124958228-124958250 TTCCACATATACATGGAGTAGGG + Intronic
1197802862 X:130370407-130370429 TTACATAACTACAGTGTGTTAGG - Intronic
1198393693 X:136202025-136202047 TTACAGAATTACATGTACTTAGG - Intronic
1200272807 X:154702269-154702291 GCACATAAATAAATGGTGTTGGG + Intronic
1201465011 Y:14270624-14270646 GTAGATAAATCCATGAAGTTGGG + Intergenic
1201599286 Y:15710298-15710320 TAATAATAATACATGGAGTTAGG + Intergenic
1201728800 Y:17184276-17184298 TTACTGAAATATAAGGAGTTCGG - Intergenic
1201866752 Y:18664106-18664128 TTAAATAAATCCATGGTGTCAGG + Intergenic
1201890297 Y:18936417-18936439 TGACATAAATTCATGATGTTTGG - Intergenic