ID: 946101079

View in Genome Browser
Species Human (GRCh38)
Location 2:217324059-217324081
Sequence AAGACTTCTCACAGCAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946101079_946101082 29 Left 946101079 2:217324059-217324081 CCATTGTTGCTGTGAGAAGTCTT 0: 1
1: 0
2: 0
3: 9
4: 201
Right 946101082 2:217324111-217324133 TTAGTTTAGTGTCTTCTCTCTGG 0: 1
1: 0
2: 0
3: 26
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946101079 Original CRISPR AAGACTTCTCACAGCAACAA TGG (reversed) Intronic
903642007 1:24866717-24866739 GACACTGATCACAGCAACAACGG + Intergenic
903950843 1:26994928-26994950 AAGACTGCTCACAGCTCCGAGGG - Intronic
905385032 1:37596761-37596783 ATGAGTTCTCACAGCAGGAAGGG - Intergenic
906769374 1:48471096-48471118 AAGTCTTCTGAGATCAACAAGGG + Intronic
911575609 1:99573846-99573868 AAAACTTCTGACAGCAAGTAAGG + Intergenic
911762413 1:101631496-101631518 AAGACTTCTGAGGGCACCAAGGG + Intergenic
911898822 1:103474434-103474456 AAGACTATTCACAGCAAAATAGG - Intergenic
912441030 1:109698325-109698347 AAGATTTCTCTCAGCAATGAAGG + Intronic
915860076 1:159434750-159434772 TTGACTTCTCACAGCAACCCTGG - Intergenic
917542435 1:175927275-175927297 ACCAGTTCTCACAGGAACAAAGG + Intergenic
920971497 1:210747045-210747067 AAGATTTCACACTGCAACAGGGG + Intronic
921982012 1:221269175-221269197 AAGACTTGCCAAAGAAACAATGG + Intergenic
923361116 1:233211992-233212014 AAGTCTCATCACTGCAACAAGGG + Intronic
923747177 1:236712199-236712221 CAGACTTTTCACAGAAACAGGGG + Intronic
1064562029 10:16602998-16603020 GAGACTTCTCACAGGAATTAGGG - Intronic
1064750706 10:18525481-18525503 TGTACTTCTCAAAGCAACAATGG - Intronic
1065760255 10:28975296-28975318 AAGACTTCTCACAGCCATGGGGG - Intergenic
1066366374 10:34780928-34780950 ATGACTTCACACAGCTATAACGG + Intronic
1067377128 10:45737897-45737919 AAGAATTCACACAGTAACTAAGG - Intronic
1067884836 10:50078589-50078611 AAGAATTCACACAGTAACTAAGG - Intronic
1068383824 10:56296770-56296792 CAGCCTTGACACAGCAACAATGG - Intergenic
1073033162 10:100544267-100544289 AACACTTCTTAAAGCAACATTGG - Intronic
1073184794 10:101609430-101609452 AAGACAGCCCACAGCAACGATGG + Exonic
1073273403 10:102286979-102287001 AAGGCTTGTCACAGCCAAAAAGG - Intronic
1073860595 10:107733651-107733673 AAGACTTCTAAAATGAACAAAGG + Intergenic
1076148725 10:128146077-128146099 AAGGCTGCTCACAGCACAAAAGG + Intergenic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1079329665 11:19523073-19523095 CAGACTTCTCACTGCAAAATGGG - Intronic
1079628574 11:22646565-22646587 AGGACTTCTGACAGCATTAAAGG + Intronic
1081005728 11:37735599-37735621 ATAACTTCTCACAGCTGCAAAGG - Intergenic
1081310072 11:41560029-41560051 AAGACCTCTCAGAGAATCAAGGG + Intergenic
1081631973 11:44695503-44695525 AAGTCTTCCCACAGCACCACAGG + Intergenic
1085523476 11:77151388-77151410 AAGTCTTCCTACAGCCACAAAGG - Intronic
1086403661 11:86481819-86481841 AAGGCTCCTCACAGCTCCAAAGG + Intronic
1088031532 11:105257207-105257229 AGCACTTCTAACAGCAGCAATGG - Intergenic
1089867439 11:121643913-121643935 AAAACTGCTCACAGGGACAAAGG - Intergenic
1089892594 11:121896381-121896403 AGGACTTTTCACAGCAACACTGG - Intergenic
1092834706 12:12476624-12476646 AATACTTCTCTCAACAAAAATGG - Exonic
1093067966 12:14678627-14678649 GATACTTCTCACAGCATGAATGG - Intronic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1097287096 12:57886812-57886834 AAGGCCACTCTCAGCAACAAGGG + Intergenic
1097693766 12:62758184-62758206 AAGAGATCTCACAACTACAATGG - Intronic
1098285407 12:68902018-68902040 AAGGATTCTTAAAGCAACAAAGG - Intronic
1098304646 12:69090348-69090370 AAGACATCTCACAGAACCCAAGG - Intergenic
1106011493 13:25828330-25828352 AGGATGTTTCACAGCAACAAAGG - Intronic
1106480263 13:30132516-30132538 AAGTCTTCTCATTGCAAAAATGG - Intergenic
1106644507 13:31617750-31617772 ATGGCTTCTTACTGCAACAAGGG - Intergenic
1108910124 13:55538627-55538649 CTGATTTCTCACAGAAACAATGG + Intergenic
1109325069 13:60857829-60857851 AAAATTTCTAACAGCAAAAAGGG - Intergenic
1109782523 13:67130641-67130663 ATGACATCTCACGGGAACAAGGG + Intronic
1112181286 13:97083575-97083597 GAGACTTTCCACAGAAACAAGGG - Intergenic
1112734157 13:102399483-102399505 AAGACTTCTCAAAGTGAGAAAGG - Intronic
1113350058 13:109520243-109520265 AAGACTTCTATGAGCAAAAAGGG - Intergenic
1116654754 14:47638317-47638339 AAGTTTTCTCACAGCAAAACTGG - Intronic
1116989636 14:51261897-51261919 GAGACTTCTGCCAGCAAGAATGG - Intergenic
1118027292 14:61782376-61782398 AAGATGTCTCTCAGAAACAAAGG + Exonic
1119345838 14:73923540-73923562 ATGAATTGTCACAGAAACAAAGG - Intronic
1125195501 15:37041363-37041385 AGGCCTTCAGACAGCAACAAAGG - Intronic
1126491802 15:49245346-49245368 AAGGCTTATAACAACAACAAAGG - Intronic
1126513419 15:49506017-49506039 GAGAATTATCACAGCTACAAAGG + Intronic
1130687412 15:86050917-86050939 AAGACTTCTCTCTGCAGCTATGG + Intergenic
1130772412 15:86938156-86938178 AAGTCTTCCCACAGAAGCAAGGG - Intronic
1130806207 15:87326240-87326262 AGGACTTTTCACAGCCCCAATGG + Intergenic
1136316564 16:29457919-29457941 GTGACTTCTCACAGCTACCAAGG - Exonic
1136431140 16:30197261-30197283 GTGACTTCTCACAGCTACCAAGG - Exonic
1137017195 16:35389480-35389502 GAAACTACTGACAGCAACAAAGG - Intergenic
1137664365 16:50240746-50240768 TAGACTTCTCACAACAACGCTGG - Intergenic
1141500554 16:84441442-84441464 AGGACTCATCACAGCAACAGGGG - Intronic
1143416166 17:6752392-6752414 GAGACTTCTCAAAGAAAGAAAGG + Intergenic
1145129427 17:20329885-20329907 CAAACATCTGACAGCAACAACGG + Intergenic
1145785207 17:27588973-27588995 ATTACTTCTCACATCAACACTGG - Intronic
1146265410 17:31449526-31449548 AACACTTCTCACAGTCACCAGGG + Intronic
1149011809 17:51864666-51864688 AATTCTTCTCTCAGTAACAAAGG + Intronic
1149695915 17:58615979-58616001 AGGACTACTCCCAACAACAAAGG + Intronic
1150671359 17:67201128-67201150 AACACTTCTCTCAGAAACAGAGG - Exonic
1153522500 18:5965982-5966004 AAGGCCTCTCCCAGCAGCAAGGG + Intronic
1154301706 18:13199344-13199366 ATGACTTATCACAGAAACGATGG - Intergenic
1156600806 18:38603833-38603855 CAGTCTGCTCACAGCAAGAATGG - Intergenic
1156946087 18:42833413-42833435 AAGACTATTCACAACAGCAATGG - Intronic
1159341786 18:67143273-67143295 AAAACTTGCCAAAGCAACAAGGG - Intergenic
1159373210 18:67556342-67556364 ATGACTTCTTAGAGCGACAAGGG - Intergenic
1165526732 19:36362188-36362210 TAGACTTCTCACAGGAAGAATGG - Exonic
1166943195 19:46380753-46380775 CTGAGTTCTCACAGAAACAATGG - Intronic
925207154 2:2016456-2016478 AAGAGTTCTCACAGCCGCCATGG + Intronic
927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG + Intergenic
927928444 2:27028577-27028599 AAGACTTCCCTGAGCAACATAGG + Intergenic
931089474 2:58869934-58869956 ATAAATTCTCACAGCACCAATGG + Intergenic
932439099 2:71720601-71720623 AAGAGGTTTCAAAGCAACAAAGG - Intergenic
934979650 2:98829380-98829402 AAGATCTCTCAGAGCAACAGTGG - Intronic
938111991 2:128574032-128574054 AAGACCGCTTAGAGCAACAATGG + Intergenic
938299826 2:130202363-130202385 AAGATTTCACACAGCAGCTACGG + Intergenic
938456884 2:131472122-131472144 AAGATTTCACACAGCAGCTACGG - Intronic
940168964 2:150806039-150806061 GAGACTTCTCACAGAAATAAAGG - Intergenic
941953323 2:171178517-171178539 AAGACACCTCATAACAACAATGG + Intronic
942524268 2:176836980-176837002 ATGACTTCTCAGATCAACAAAGG + Intergenic
942689387 2:178569335-178569357 CAGAACTCTCACAGTAACAAAGG + Exonic
946101079 2:217324059-217324081 AAGACTTCTCACAGCAACAATGG - Intronic
1169398513 20:5258919-5258941 AATACTTCTCAGAGTAAAAAGGG + Intergenic
1169483252 20:6004710-6004732 AAAACCTATCAGAGCAACAAAGG + Intergenic
1169921983 20:10744778-10744800 AAGAGTTTTGACAGTAACAAGGG - Intergenic
1170915681 20:20622509-20622531 ATGACTTCTCAAAGAAATAATGG + Intronic
1171168681 20:22995925-22995947 AAGCCATCTCACAACTACAAGGG - Intergenic
1171379690 20:24724986-24725008 TAGACCCCTCACAGCAACAATGG - Intergenic
1173956547 20:47037531-47037553 AAGACTTCTGACATCCAAAATGG - Intronic
1175365425 20:58451553-58451575 AAGACTTCACACAAGACCAAGGG + Intergenic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177336504 21:19735107-19735129 GAAACTTATGACAGCAACAAGGG - Intergenic
1177875905 21:26631799-26631821 AAGACTTCTCAAATCTAGAATGG - Intergenic
1183838872 22:40480921-40480943 AAGACTTTTCTGAGCAACACAGG + Intronic
1184352958 22:43956765-43956787 AAGACTCCTCCCCGCAACAGAGG - Intronic
949494470 3:4619106-4619128 CAGACATCTCACAGCAACCCTGG - Intronic
950002084 3:9664754-9664776 AAGGGTTCTGACAGGAACAAGGG + Intronic
950268081 3:11590029-11590051 AAGACTTCTCAAAGCCTGAAAGG + Intronic
950395149 3:12728377-12728399 AGCACGTCTCAGAGCAACAAGGG - Intergenic
952208321 3:31202968-31202990 AAAACCTCCCACAGCAACTAAGG + Intergenic
952560041 3:34581309-34581331 AAGACTATTCACAGGAACATAGG - Intergenic
954645763 3:52130700-52130722 CAGAGCTCTCACAGAAACAAGGG + Intronic
954762805 3:52889149-52889171 AAGGCTTCTCACAGGCACTAAGG + Intronic
955544709 3:60015745-60015767 AAGACATTTCACTTCAACAATGG + Intronic
955935155 3:64095973-64095995 AAGCCTTTTCACAGTACCAAGGG + Exonic
959420274 3:106119815-106119837 GAATCTTCTCACAGCATCAAAGG - Intergenic
959610888 3:108293704-108293726 ATGTCCTTTCACAGCAACAATGG + Intergenic
960673244 3:120171773-120171795 AAGACTTCACAGAGTATCAAAGG + Intronic
961051169 3:123748246-123748268 AAGAATTCACACATCACCAAGGG + Intronic
962717567 3:138139770-138139792 GAGACGTCTCACAGGAACACTGG - Intergenic
963338712 3:144007605-144007627 AAGACTTCTGACATCATGAAAGG - Intronic
967311046 3:188106556-188106578 AAGAGCTCTAACAGAAACAAGGG - Intergenic
967456997 3:189700044-189700066 AAGACTTCTTAAAGGCACAAGGG - Intronic
967533100 3:190571687-190571709 AAGTCTTCTCACTCCAAAAATGG - Intronic
968951055 4:3691771-3691793 AAGACATCTAACAACAGCAAGGG - Intergenic
971781838 4:31045488-31045510 ATGACTTCTGACAGCAGGAACGG - Intronic
971957533 4:33441022-33441044 AAAACTTGTCACAGAGACAAAGG + Intergenic
974100337 4:57409516-57409538 AAGACTTCTCCCACCACCACTGG - Intergenic
981015177 4:139967104-139967126 AAGAATCAACACAGCAACAATGG + Intronic
981803747 4:148688572-148688594 AAGATTTCTCAAAGGCACAAGGG + Intergenic
982321071 4:154078029-154078051 AAGACTTCTGACAGGAGGAAAGG - Intergenic
982391397 4:154868117-154868139 AAGACTTCTCAGCCAAACAAAGG + Intergenic
983281629 4:165688287-165688309 AAGACATCTCATTTCAACAAGGG - Intergenic
983843471 4:172486180-172486202 AAGAAGGCTCCCAGCAACAAGGG + Intronic
984851063 4:184152747-184152769 AGGACTTCTCACAGCAGCCGAGG + Intronic
986749527 5:10774466-10774488 ATCACTTCACACACCAACAAAGG + Intergenic
987657868 5:20831449-20831471 CTGAATTCTCACAGAAACAATGG - Intergenic
988401860 5:30772518-30772540 ATTACTGCTCACAGCAACATGGG - Intergenic
988765674 5:34372505-34372527 CTGAATTCTCACAGAAACAATGG + Intergenic
988788184 5:34583298-34583320 AACAGTTCTTACAGAAACAAGGG - Intergenic
990989691 5:61673136-61673158 ATGAATTCTCACAGCAGGAAAGG - Intronic
993720143 5:91314164-91314186 AAGTTTTCTAACAGCAACAATGG - Intergenic
994097125 5:95857414-95857436 AAGATTTCTCACAGCAGCTCTGG - Intronic
997181009 5:131829141-131829163 ATGGCTTCTCAAAGCAACACTGG + Intronic
999121117 5:149210109-149210131 AAGACTCCTCTCAGCAATCATGG + Intronic
1000842336 5:166235495-166235517 AAGAATTTTGAAAGCAACAAGGG + Intergenic
1003234156 6:4281351-4281373 AATACTTCTCACTGCCTCAACGG + Intergenic
1007515687 6:42409391-42409413 AAGACTTCTCTAAGCAAACAAGG - Intronic
1008022772 6:46599823-46599845 AAGGCATCTCAAAGCAACACTGG + Intronic
1010158660 6:72825550-72825572 AAGACTTCTCACTGTCACCAAGG - Intronic
1011402240 6:86976102-86976124 AAGACTGATGACAGAAACAAAGG + Intronic
1012641173 6:101616533-101616555 AAGACTTTTTACAGAAACTATGG - Intronic
1013166566 6:107598741-107598763 AAGACTTCTAACAGCTGGAAAGG + Intronic
1014089689 6:117389603-117389625 AAAACTTTTCACATCAGCAAAGG + Exonic
1014711669 6:124813918-124813940 AAAACTTCTCTGAGCAATAAGGG - Intronic
1017025449 6:150177069-150177091 AAGACATCTCTCAGGAACCAGGG - Intronic
1018233514 6:161700043-161700065 AGGGCTTATAACAGCAACAAAGG - Intronic
1021527378 7:21604097-21604119 ATGACTTCTCATAATAACAAAGG - Intronic
1024700212 7:51898752-51898774 ACCCCTTCTCACAACAACAATGG + Intergenic
1026615460 7:71898815-71898837 AAGACTCATCTCAACAACAATGG + Intronic
1028538094 7:91911698-91911720 AAAACTTCTCAAAGTATCAATGG + Intergenic
1029235000 7:99108148-99108170 AAGGCTCTGCACAGCAACAATGG - Intronic
1030284876 7:107815582-107815604 TAGACTTCTTACAGCAATATTGG + Intergenic
1031362521 7:120863967-120863989 ATTACTACTCACAGCAATAAAGG + Intergenic
1032690239 7:134278496-134278518 AACACTTCTCATAGCAATATTGG + Intergenic
1033349680 7:140552089-140552111 AAGCATTCTGACAACAACAAAGG + Intronic
1033915141 7:146314961-146314983 AAGTCTTCTCCCAGCAAGACTGG - Intronic
1034722009 7:153301981-153302003 AAGACATCTGACAGCATCACTGG + Intergenic
1038810720 8:30839473-30839495 AAGACTTCTAAAATCAAAAAGGG - Intronic
1038845387 8:31224248-31224270 AACACTTCTGAAAGAAACAAAGG - Intergenic
1039314328 8:36354967-36354989 AGGACTTGTCCCAGCCACAAAGG + Intergenic
1040315832 8:46260463-46260485 AAGACTTCTAAAAGAGACAATGG + Intergenic
1045623281 8:104008630-104008652 AAGTATTCTCACATCTACAAAGG - Intronic
1046124489 8:109887205-109887227 AAGATTTCTTAGAGGAACAAGGG - Intergenic
1047375034 8:124287982-124288004 AACTATTCCCACAGCAACAAGGG + Intergenic
1049029663 8:140024936-140024958 AAGACTTCCCAGGGCAACCAAGG + Intronic
1050656249 9:7831903-7831925 ATGACTTATCCCAGTAACAATGG + Intronic
1050988942 9:12121438-12121460 AAACCTTTTTACAGCAACAATGG + Intergenic
1055273060 9:74583329-74583351 AACATTTCCCACAGAAACAATGG + Intronic
1055421091 9:76143503-76143525 AAGACATATCATAGGAACAATGG - Intronic
1056071751 9:82994342-82994364 ATGACTTCTCAAAGCCACAGAGG + Intronic
1056552226 9:87661239-87661261 AGGACTACTCACAGTAGCAAAGG - Intronic
1057915361 9:99051282-99051304 AGGACCTCTCACAGTAACCATGG + Intronic
1058245961 9:102625640-102625662 AAGACTGCACAAAGCAGCAAGGG + Intergenic
1061541307 9:131278983-131279005 AGGACATCTCACAGCAGCACCGG + Intergenic
1185946126 X:4378713-4378735 AAGAGTGTTCACAGCAGCAAAGG - Intergenic
1186134975 X:6509798-6509820 AAGACATATGACAGCAACCAAGG - Intergenic
1186289483 X:8080872-8080894 AAGTCATGTCACAGGAACAAAGG + Intergenic
1188059117 X:25578427-25578449 CAGACTTTTCACAGCAATAATGG + Intergenic
1188543267 X:31272743-31272765 AAGACTTTTCACTGCAAAATGGG + Intronic
1189124328 X:38430018-38430040 AAGACTTATCCCATTAACAAGGG + Intronic
1189242318 X:39534856-39534878 AAGAGTTCTCTGAGGAACAATGG - Intergenic
1190463642 X:50704376-50704398 AATAGTTTTCACATCAACAATGG - Intronic
1191868819 X:65728101-65728123 TTGACTTCTAACAGCGACAATGG + Intronic
1192285461 X:69730338-69730360 AAGGCTTCTCAAAGCATGAAGGG + Intronic
1192556017 X:72089944-72089966 AAGACTACGCACAGTAACAGTGG + Intergenic
1193791400 X:85819661-85819683 AATACCTCTCACAGCAGTAAGGG + Intergenic
1195127636 X:101823463-101823485 GAGACTGCTCAGAGCAACAAGGG - Intergenic
1197516770 X:127441894-127441916 CAGACTGCTCACAGAGACAAGGG - Intergenic
1201618224 Y:15925490-15925512 AAGACATGTGACAGCAACCAGGG - Intergenic
1201623287 Y:15983931-15983953 AAGAGTTGTCAAAGCAACCATGG - Intergenic
1201733288 Y:17229329-17229351 AGGAGTGTTCACAGCAACAAAGG - Intergenic