ID: 946102476

View in Genome Browser
Species Human (GRCh38)
Location 2:217337949-217337971
Sequence GGGAAGTGACCTCATACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946102476_946102486 28 Left 946102476 2:217337949-217337971 CCCAGGGTATGAGGTCACTTCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 946102486 2:217338000-217338022 CTGGAACTGAAACCAAATCTTGG 0: 1
1: 0
2: 0
3: 12
4: 183
946102476_946102483 4 Left 946102476 2:217337949-217337971 CCCAGGGTATGAGGTCACTTCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 946102483 2:217337976-217337998 GTCACTGGTGACTTAGTGACTGG 0: 1
1: 0
2: 3
3: 11
4: 104
946102476_946102485 9 Left 946102476 2:217337949-217337971 CCCAGGGTATGAGGTCACTTCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 946102485 2:217337981-217338003 TGGTGACTTAGTGACTGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 166
946102476_946102484 5 Left 946102476 2:217337949-217337971 CCCAGGGTATGAGGTCACTTCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 946102484 2:217337977-217337999 TCACTGGTGACTTAGTGACTGGG 0: 1
1: 0
2: 2
3: 7
4: 136
946102476_946102487 29 Left 946102476 2:217337949-217337971 CCCAGGGTATGAGGTCACTTCCC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 946102487 2:217338001-217338023 TGGAACTGAAACCAAATCTTGGG 0: 1
1: 0
2: 1
3: 23
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946102476 Original CRISPR GGGAAGTGACCTCATACCCT GGG (reversed) Intronic
900899071 1:5504564-5504586 GGGGAGTGATCTCATCCCCCTGG + Intergenic
902121508 1:14169850-14169872 GGGAAGTGACTTCATCTTCTTGG - Intergenic
902472757 1:16660416-16660438 GGCACGTGACCCCACACCCTGGG + Intergenic
902486047 1:16747027-16747049 GGCACGTGACCCCACACCCTGGG - Intronic
904702344 1:32365417-32365439 TGGAAGTGACCTCACTCTCTCGG + Intronic
908028303 1:59973556-59973578 GAGAAGTGACCTCATATGCTTGG - Intergenic
914007342 1:143743836-143743858 TGGTAGTCACCTCATACCCCAGG - Intergenic
917863986 1:179175733-179175755 AGGATGTGAGCTCATGCCCTAGG + Intronic
921096017 1:211887967-211887989 GGGTACTGACCTCGTAGCCTAGG - Intergenic
923716169 1:236426405-236426427 GGGCAGTGTCCTCCTCCCCTGGG - Intronic
924537271 1:244946339-244946361 GTGAAGTGACATCATACTCAAGG + Intergenic
1067662920 10:48250013-48250035 GCCAAGTGACCTCACATCCTGGG - Intronic
1081399124 11:42622295-42622317 GGGTAGTGACCTCTCTCCCTAGG + Intergenic
1083987075 11:66222481-66222503 CTGAAGTGACCTCAGGCCCTAGG + Intronic
1085088661 11:73691040-73691062 GGGAAGAGAGCTCAGGCCCTGGG + Intronic
1085746947 11:79123114-79123136 GGAAAGGGAACTCAGACCCTGGG + Intronic
1093961791 12:25281678-25281700 GGAAAGGGACCTCAGAACCTGGG + Intergenic
1098149467 12:67531291-67531313 GAGAAGAGACCTCACAGCCTGGG - Intergenic
1099669849 12:85675830-85675852 GGGAAGAGACCACAGACCCAAGG + Intergenic
1100477896 12:94950961-94950983 GGGAGGTGAGCTCCTTCCCTAGG - Intronic
1100992611 12:100267140-100267162 AGGAAGTGACGTCATGCCCCCGG + Intronic
1101193322 12:102357206-102357228 GGGAATTGCTCTCATACCATGGG + Intergenic
1101255382 12:102972124-102972146 GGGAAGTGTACTCAGACACTGGG + Intergenic
1102953424 12:117045016-117045038 GGGAAGTGTCCTCAGAGGCTGGG + Intronic
1103358771 12:120341798-120341820 GGGAAGAGAGCTCAGGCCCTGGG + Exonic
1103791866 12:123477834-123477856 GGGAAGTGGCCTCAAACACGGGG + Intronic
1104841136 12:131826524-131826546 GGGAAGTGAGCTGAAGCCCTGGG - Intergenic
1113023994 13:105920599-105920621 CGGAAGTGACCTTTTGCCCTGGG - Intergenic
1117253715 14:53957470-53957492 GGGAAGTGAGCTCATTTACTGGG - Intronic
1127932361 15:63605380-63605402 GGGAGGTATCCTCATATCCTTGG + Intergenic
1128657001 15:69469827-69469849 AGGCTGTGACCTCCTACCCTGGG - Intergenic
1128861626 15:71078920-71078942 GGGAAGTGACCTCTGATCATTGG + Intergenic
1131889662 15:96958992-96959014 GGCAAGTGCCCTCATGCCTTAGG + Intergenic
1134034473 16:11019071-11019093 GGGATGTGAACACATACCTTGGG - Intronic
1137435836 16:48453620-48453642 GGGAAATGACCTCAGAGCTTTGG + Intergenic
1137614118 16:49836881-49836903 GGAAAATGAGCTCAGACCCTGGG + Intronic
1137806231 16:51308513-51308535 GGGAAGTCACTTCATTTCCTGGG + Intergenic
1140236474 16:73163779-73163801 GGAAAGTTACCAAATACCCTTGG - Intergenic
1142504712 17:355469-355491 GGTGAGTCACCTCATACCCATGG + Intronic
1144770962 17:17759194-17759216 GTGGTGTGACCTCAGACCCTGGG + Intronic
1147129144 17:38395993-38396015 AGGCAGAGAGCTCATACCCTTGG - Exonic
1147510053 17:41060167-41060189 AGGAAATGACCTCATGTCCTGGG - Intergenic
1150223589 17:63510683-63510705 GGAAATTGACCTCATCCTCTGGG - Intronic
1151965783 17:77430496-77430518 GGGAAGTGACCTCATAGCAAGGG + Intronic
1152260860 17:79266296-79266318 GGGAAGTGTCCTCATCCTCGTGG + Intronic
1153175420 18:2366755-2366777 GTGAAGTGAACACACACCCTTGG - Intergenic
1153364813 18:4243464-4243486 GAGAAGAGAACTCATCCCCTTGG + Intronic
1153506756 18:5808302-5808324 GGGAAGGGACATCACACACTGGG - Intergenic
1155954050 18:31942591-31942613 GGGAGGATACCACATACCCTCGG + Exonic
1160948836 19:1656066-1656088 GGGGAGTGTGTTCATACCCTGGG - Intergenic
1161226504 19:3148899-3148921 GGGAAGGGTCCCCAGACCCTGGG + Intronic
1161628400 19:5339735-5339757 GGGAGGTGACGTCATACCGGGGG - Intronic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1165818393 19:38658003-38658025 GGGGAGTGCCCTCATACCAGAGG + Intronic
1167212756 19:48143706-48143728 GGGAAGTGAGCTCATGCATTTGG - Intronic
927504274 2:23603106-23603128 GGGAAGTGACCCCCCACCCCAGG + Intronic
928081984 2:28319896-28319918 GGGAAGTGACCTCACTCCCGAGG + Intronic
936073997 2:109390135-109390157 GTGAAGAGACCTCAGACCCTTGG - Intronic
938016738 2:127873494-127873516 GGGAAGTCACGCCATACCATTGG - Intronic
946102476 2:217337949-217337971 GGGAAGTGACCTCATACCCTGGG - Intronic
947102019 2:226631028-226631050 GGGAACTGAGCCCACACCCTGGG + Intergenic
1172990114 20:39029546-39029568 GGGAGGTGAGCTCATACAATGGG - Intronic
1176428270 21:6561771-6561793 GGGCAGTGACCTCATTCCACAGG + Intergenic
1179256347 21:39719456-39719478 TGGAGGTGACCTCATTTCCTTGG + Intergenic
1179493778 21:41758822-41758844 GGGAAGTGACCTTAGACCAGAGG - Intronic
1179703760 21:43170087-43170109 GGGCAGTGACCTCATTCCACAGG + Intronic
1181856977 22:25788880-25788902 AGCAAGTGACCTCATCTCCTTGG + Intronic
1183035553 22:35138494-35138516 GAGCAGTGAGCTTATACCCTTGG - Intergenic
949296234 3:2527235-2527257 GGGCTGTGACCTCAGAGCCTTGG + Intronic
950452273 3:13072140-13072162 GTGCAGTGACCTCAGACCTTAGG - Intronic
953756111 3:45647333-45647355 GGGAAGTGAACTCTTACCATGGG + Intronic
954211754 3:49101667-49101689 GTGGAGTGACCACATAGCCTGGG + Exonic
955353074 3:58208325-58208347 GGTAAATGACCTCAAACCCCTGG - Intronic
958884587 3:99711580-99711602 TGGAAGTGACCTAATACCTGGGG + Intronic
958900549 3:99881112-99881134 GGTAAGAGACTTCCTACCCTTGG + Intronic
959400488 3:105895631-105895653 GGGAAGTGGCTTCCTAGCCTGGG + Intergenic
961404946 3:126672282-126672304 GGGATGTAACCTCAGGCCCTGGG - Intergenic
961440731 3:126951679-126951701 GGGAACTGACCTCACACCTCTGG - Intronic
962809955 3:138951286-138951308 GAGAAGCGACCTCCTACTCTGGG + Exonic
966663421 3:182442455-182442477 GGGAAGTGAGCTGAAAGCCTAGG - Intergenic
979266906 4:118714377-118714399 GGCTGGAGACCTCATACCCTGGG + Exonic
981767169 4:148264086-148264108 GGGAATTGAACTGATAACCTTGG - Intronic
983974610 4:173917922-173917944 GGGAAGTGAACTCAAAGCCAGGG - Intergenic
989076324 5:37566981-37567003 GGGAAGTGAAGTCAGAACCTGGG + Intronic
993902128 5:93591602-93591624 GGGAAGTGACCTTGTACTCCAGG + Intronic
997581448 5:135019879-135019901 GTGAGGTGACATCATGCCCTGGG + Intergenic
997777372 5:136623101-136623123 GGGAAGTGTCTTTGTACCCTGGG - Intergenic
1001445475 5:171779484-171779506 GGGAAAAGACCTCACAACCTGGG - Intergenic
1001552262 5:172611631-172611653 GGCAAGTGACCTCATCTCCCTGG - Intergenic
1007766168 6:44161569-44161591 GAGTAATGACCTCACACCCTGGG + Intronic
1010695385 6:78967750-78967772 CAGAAGTGAGCTCATAACCTTGG - Intronic
1011634261 6:89355210-89355232 GGGAAGGGAGCTCATTTCCTTGG + Intergenic
1015012596 6:128369125-128369147 GGGAAATAACCTCTTTCCCTTGG - Intronic
1017775440 6:157676733-157676755 GGGCAGAGACCTGAGACCCTTGG - Exonic
1019106678 6:169673561-169673583 GGGAAGTGACCCCAGATGCTGGG + Intronic
1019509710 7:1411808-1411830 GGGAGGTGAACACATACGCTGGG - Intergenic
1025250978 7:57351175-57351197 GGCAAGTGACTTAATCCCCTGGG + Intergenic
1027710134 7:81590275-81590297 GGGAAGTCACTTAATACCCCTGG - Intergenic
1033670654 7:143489378-143489400 GGGAAGGGACAACATAACCTGGG - Intergenic
1034140041 7:148806823-148806845 GGGAAGTTACCTCAAATTCTGGG + Intergenic
1034991679 7:155551448-155551470 GGGAGGTGACCTCACAACATGGG + Intergenic
1036522526 8:9505160-9505182 GGGTAATGACTTCAGACCCTAGG + Intergenic
1037704846 8:21310231-21310253 GGGAAGTTACCTCAGACACCGGG + Intergenic
1040447987 8:47515520-47515542 GGGAAGTGTCCCAATCCCCTTGG + Intronic
1041945226 8:63433508-63433530 GGCAAGTGACCTGATTCCCCAGG + Intergenic
1047352958 8:124093381-124093403 ATGCAGTGACCTCATGCCCTTGG - Intronic
1049037916 8:140091088-140091110 GGGATGTGATCTCTTACCCAGGG - Intronic
1049112508 8:140656442-140656464 GGGAAGTGCCTTCATACCTCTGG - Intergenic
1049687096 8:143943367-143943389 GGCAGGTGCCCTCATGCCCTCGG - Intronic
1050291960 9:4164604-4164626 GGGAAGTGACATCTTAACCATGG + Intronic
1055644423 9:78349237-78349259 GGGGAGTGACTTCCTGCCCTAGG + Intergenic
1056025475 9:82490465-82490487 CCCAAGTGACCTCATTCCCTAGG - Intergenic
1060239087 9:121887809-121887831 GGGATGTGAGCTCCTTCCCTCGG + Intronic
1061973873 9:134058668-134058690 GGGATGTCATCTCAGACCCTGGG - Intronic
1189679461 X:43500422-43500444 GGGAAGTAACCTGAAACCCTTGG - Intergenic
1191872274 X:65758118-65758140 GGTCAGTGACCTCATACAGTAGG - Intergenic
1192548112 X:72030031-72030053 GGGCAGAAACCTCATTCCCTTGG - Intergenic
1198534539 X:137573895-137573917 GGGAAGGGACCTCATTTCCTAGG + Intronic