ID: 946105202

View in Genome Browser
Species Human (GRCh38)
Location 2:217363161-217363183
Sequence CTGTGGGAATTGAGGTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946105202_946105206 -8 Left 946105202 2:217363161-217363183 CCCAGTCACCTCAATTCCCACAG 0: 1
1: 0
2: 0
3: 17
4: 187
Right 946105206 2:217363176-217363198 TCCCACAGGACCATTGCAGTTGG 0: 1
1: 0
2: 1
3: 12
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946105202 Original CRISPR CTGTGGGAATTGAGGTGACT GGG (reversed) Intronic
903852834 1:26318477-26318499 CTGTGGTTATGGAGGTGACAGGG + Intronic
904304736 1:29580811-29580833 CTGTGGGAAATGCAGAGACTGGG + Intergenic
904360691 1:29969799-29969821 CTGTGAGAATTCAGCAGACTGGG - Intergenic
904588119 1:31591471-31591493 GTGTGAGGATTTAGGTGACTTGG - Intergenic
905283810 1:36866247-36866269 GTGTGGTAATTGAGGTCAATGGG - Intronic
908616873 1:65931694-65931716 CTGTGGGATTTGATGTGTCTGGG - Intronic
910472822 1:87573411-87573433 CTGTGGCAATTGCAGTGAATAGG - Intergenic
912402074 1:109402480-109402502 GTGTGTGACTTGAGGTTACTTGG + Intronic
915623864 1:157102633-157102655 CTCTGGAAATTAAGGTGAATAGG + Intergenic
916859388 1:168786614-168786636 TTGTGGGAATTGTGGTAAGTTGG + Intergenic
917098030 1:171418973-171418995 GGCTGGGAATGGAGGTGACTGGG + Intergenic
918950841 1:191135047-191135069 CTGTGGGAACTGCGTTGGCTGGG - Intergenic
920450902 1:206060507-206060529 CTGTGGGGATTGGTGTGAGTGGG + Intronic
920838575 1:209534735-209534757 CTGTGGGAGGTGAGAGGACTGGG - Intergenic
921601010 1:217106484-217106506 CAGTGTGAATTGAGATGACAGGG + Intronic
923441934 1:234028787-234028809 CAGAGGAAATTGAGGTGACCTGG - Intronic
1063213806 10:3905846-3905868 CGGTGGGGATTGAAGTGATTAGG + Intergenic
1063647857 10:7903809-7903831 CTGTGGATATTGAAATGACTGGG + Intronic
1064211050 10:13360748-13360770 TTGTTGGAATTCAGGTCACTTGG - Intergenic
1064417473 10:15162691-15162713 CTCTGGGAAATAAGGTGACCAGG + Intronic
1064565472 10:16634743-16634765 CTTAGGTAATTGAGGTAACTGGG - Intronic
1066135948 10:32446366-32446388 CTGTGGGAAGTCGGGTGACTGGG - Exonic
1068779051 10:60899892-60899914 CTGTTGAAAATGAGGTGGCTAGG + Intronic
1073171309 10:101511161-101511183 TGGTGGGAATTAAGGTGGCTGGG - Intronic
1074966125 10:118492214-118492236 CTGTGAAAATTGAGCTGACATGG - Intergenic
1075189885 10:120297374-120297396 CTGGAGGAATTGTTGTGACTGGG - Intergenic
1076719446 10:132386853-132386875 CTGGTGGATTTGAGGTGTCTGGG + Intergenic
1076719555 10:132387176-132387198 CTGGTGGATTTGAGGTGTCTGGG + Intergenic
1077793786 11:5469457-5469479 CTGGGTGAATTGAGGTGAGATGG + Intronic
1077982266 11:7312044-7312066 ATGTGGGAATGTATGTGACTGGG + Intronic
1078441081 11:11368936-11368958 CTGTGGGAATTGTGTGGCCTGGG + Intronic
1078997400 11:16717265-16717287 CTGTGAGAAGTTAGGTGACTTGG + Intronic
1079403595 11:20126172-20126194 CTGAGGCAAGTGAGGTGAGTCGG - Intergenic
1081802581 11:45869975-45869997 CTGGGGGCACTGTGGTGACTTGG + Intronic
1082625029 11:55473965-55473987 CTGTGGGTCCTGGGGTGACTCGG - Intergenic
1083249000 11:61452844-61452866 CTGAGGCAACTGGGGTGACTGGG - Intronic
1083893504 11:65608549-65608571 CTGGGGGCACAGAGGTGACTTGG + Intronic
1084095166 11:66906603-66906625 CTGGGGGGATGGAGGTGACGTGG - Intronic
1084669384 11:70596278-70596300 CTGTGGGAATTGAAGTCAGCAGG - Intronic
1087762524 11:102116539-102116561 AGGGGTGAATTGAGGTGACTGGG - Intronic
1088728889 11:112663350-112663372 CAGAGGGAATTGAAGAGACTGGG - Intergenic
1088813116 11:113404792-113404814 CTACGGGAAATGAGGAGACTGGG + Intergenic
1090099462 11:123778790-123778812 CTGTGGGTAATGAGGTTCCTGGG + Intergenic
1090548262 11:127790016-127790038 CTCTGGGATCTGAGTTGACTGGG + Intergenic
1090960010 11:131547776-131547798 CTGTTGGAGTTGCGGGGACTAGG - Intronic
1091749837 12:3015311-3015333 CTCTGAGAATTTGGGTGACTAGG - Intronic
1101253601 12:102957289-102957311 CTCTAGGAATTGAGGTGTATAGG - Intronic
1104084780 12:125464278-125464300 CTGTGGGATTTGCTCTGACTCGG + Intronic
1110298036 13:73892840-73892862 TTGTGGGAATAGAGGTGGGTAGG + Intronic
1110467267 13:75816013-75816035 CTTTGGCAATTGAAGTGCCTAGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112905800 13:104419763-104419785 CTGAGGCAATAGAGGTGCCTGGG - Intergenic
1112993310 13:105540953-105540975 CTGTGAAAATAGAGGAGACTTGG + Intergenic
1115193523 14:30772006-30772028 CAGTGGGAAGTCAGGTGACATGG - Intergenic
1115747959 14:36458154-36458176 CTGGGGGAATAAAGTTGACTGGG + Intergenic
1117767971 14:59102580-59102602 CTATGGGAAAGGAGGTTACTAGG + Intergenic
1118890165 14:69902499-69902521 CTGTGTGAGTTGTGGAGACTAGG + Intronic
1120647393 14:87090007-87090029 CTTAGGGAATGGAGTTGACTTGG - Intergenic
1121074677 14:91058715-91058737 CTGTATGAATTCAGGTGATTTGG - Intronic
1121364883 14:93300051-93300073 CTGTGGGAGTTAAGGTATCTAGG + Intronic
1121830859 14:97050905-97050927 CTGAGGGAACAGAGCTGACTTGG + Intergenic
1123796561 15:23777909-23777931 CAGTAGGAACTGAGGTAACTAGG + Intergenic
1125481569 15:40084732-40084754 CGGTGGGGATTAAGGAGACTGGG - Intergenic
1126711444 15:51461360-51461382 CTGTGGGAAGCCAGGTGTCTGGG - Intronic
1126892552 15:53222108-53222130 CTGTAGCACTTGAGGTGACAGGG + Intergenic
1127359699 15:58234419-58234441 CTATGAGAAGTGAGGTGATTTGG - Intronic
1129709062 15:77811068-77811090 CTGTGGGAATTGGGGTGGGGGGG - Intronic
1130881467 15:88059573-88059595 CTGTGTTGATTGAGGTGCCTGGG - Intronic
1136418419 16:30117286-30117308 CTGTGGATAAGGAGGTGACTTGG + Intronic
1138028597 16:53541605-53541627 CTGAGAGAACAGAGGTGACTGGG - Intergenic
1138187007 16:54984588-54984610 CTCTGAGAAATAAGGTGACTTGG + Intergenic
1139408350 16:66737810-66737832 CTGTGGGCTTTGTGGTCACTTGG - Intronic
1141647450 16:85375311-85375333 CTGGGGGAGGTGAGGTGACTTGG - Intergenic
1143564733 17:7714798-7714820 CTGTGGGAATTGGGGTACCTGGG - Intergenic
1145970131 17:28951354-28951376 TTGTGGTACGTGAGGTGACTGGG + Exonic
1145973023 17:28968019-28968041 CTGTGGGAGGGGAGTTGACTTGG + Intronic
1146658839 17:34651403-34651425 CTGGGGGCATTGAGGGCACTTGG - Intergenic
1146955646 17:36935163-36935185 CTGTGGGCCTTGAGGTTGCTGGG + Intergenic
1148159075 17:45439832-45439854 CCGTGGGCACTGAGGTCACTGGG + Intronic
1150390421 17:64786922-64786944 CCGTGGGTACTGAGGTCACTCGG + Intergenic
1150904894 17:69326972-69326994 CTGGGGGAGTTGAGGGGACGAGG - Intronic
1151118992 17:71771293-71771315 GTGTGGAAATTGAGGAGACATGG + Intergenic
1151572472 17:74933747-74933769 CCGTGGGGCATGAGGTGACTGGG + Exonic
1158331676 18:56369174-56369196 CTTAGGGAATTCAAGTGACTTGG - Intergenic
1159855527 18:73583126-73583148 CTTTGGGAAGGGAGGTGAGTAGG + Intergenic
1159995768 18:74962492-74962514 CTGTGGGAATGGATGGGCCTAGG + Intronic
1162161923 19:8724589-8724611 TGGTGGGAATGGAGGTGGCTGGG - Intergenic
1165124028 19:33581418-33581440 CAATGGCAGTTGAGGTGACTGGG + Intergenic
1166113629 19:40639352-40639374 CAGAGGGAGTTGAGTTGACTTGG - Intergenic
1166822193 19:45587507-45587529 CTATGGGAATGGAGGTGATGGGG - Intronic
1167139029 19:47636850-47636872 CAGTGGGAAGTGAGGTTACAGGG - Intronic
1167324152 19:48813610-48813632 CTGGGGGGACTGGGGTGACTGGG - Intronic
1167430465 19:49451359-49451381 CTCGGGGAATTGAGGTTAATGGG - Intronic
1167812996 19:51851631-51851653 CTGTGTGAAATAAGGTGTCTGGG - Intergenic
925977770 2:9153014-9153036 ATGTGGGGATTGAGCTGACAAGG - Intergenic
926166031 2:10522558-10522580 CTGTGGGAGCTGAGGAGACTGGG - Intergenic
926166046 2:10522612-10522634 CTGTGGGAGCTGAGGAGACTGGG - Intergenic
927282313 2:21319976-21319998 CTCTGGATATTGAGGTGCCTGGG + Intergenic
931119115 2:59196915-59196937 CTGTGGGGATAGAGGTGCCTTGG + Intergenic
932152514 2:69386732-69386754 CTGAGGGAATTGAGGTGTGGAGG - Intronic
935365287 2:102282941-102282963 CTGTGAAAATGGAGATGACTGGG + Intergenic
936475157 2:112833292-112833314 CTGGGGGAATTGAGTTGGCTGGG + Intronic
937059447 2:118970677-118970699 CTGGGGGAAAGGTGGTGACTTGG + Intronic
937558469 2:123190081-123190103 GTGTTAGCATTGAGGTGACTGGG + Intergenic
942270299 2:174267856-174267878 CTGAGGGAATTGAGGGGGCTGGG - Intergenic
943314846 2:186374543-186374565 CTGGGGGAGTTGGGGGGACTGGG + Intergenic
944655766 2:201875256-201875278 CTGTGGCAATTCAGGTGGGTTGG + Intronic
944837666 2:203596256-203596278 CTTTGGGAACTGAGCTGTCTGGG + Intergenic
945472388 2:210241891-210241913 ATGTGGGAAATGATGTGAGTAGG + Intergenic
945784920 2:214222003-214222025 CTGTGAGAATGGATGTCACTAGG - Intronic
946105202 2:217363161-217363183 CTGTGGGAATTGAGGTGACTGGG - Intronic
946184682 2:217973478-217973500 GGGTGGGAATTAAGGAGACTGGG + Intronic
946255146 2:218436656-218436678 CCCTGGGGATTGAGGTGGCTGGG - Intronic
948097857 2:235350678-235350700 CTGGGAGAACTGAGGTGAATAGG - Intergenic
948550909 2:238772588-238772610 CTGTGGGAATTTGGGTGGCCTGG + Intergenic
948931521 2:241135334-241135356 CTGTGGGACTTGAGGGTGCTCGG - Intronic
1168834941 20:871717-871739 CTGGGGGAGTTGAGGTTACAGGG + Exonic
1172877689 20:38175840-38175862 CCGTGGGAAGGGAGGTGACCTGG - Intergenic
1173343083 20:42171862-42171884 CTGTGGGAATTAATGTGCCTTGG - Intronic
1174763076 20:53225735-53225757 CTTTTGGAATTGAGATAACTGGG - Intronic
1174802541 20:53576299-53576321 CTGTGGGACTTCAGGTTACTTGG + Exonic
1174997301 20:55584606-55584628 CTGTGGGAACTGAGCTGATCAGG + Intergenic
1176978576 21:15352702-15352724 CTGTGGGACCTGATGTGATTAGG + Intergenic
1178484173 21:33006706-33006728 ATGAGGAAATTGAGGTGCCTAGG + Intergenic
1179615929 21:42583560-42583582 CCTTGGGAATGGAGGTGACCTGG - Intergenic
1180143671 21:45908152-45908174 CTTGGGGAATTGAGGCCACTTGG + Intronic
950884884 3:16354481-16354503 CTGTGTCAAAGGAGGTGACTTGG - Intronic
951528010 3:23672097-23672119 CTGAGGGAGTGGAGGAGACTTGG - Intergenic
951957826 3:28276139-28276161 CACTGGGAATTGAGGTATCTAGG - Intronic
954744270 3:52778159-52778181 CTGTGGGATATGAGGTGAGATGG - Intronic
959126793 3:102299700-102299722 ATCAGGGAATTGAGGTGACAGGG + Intronic
959763482 3:109996664-109996686 AGGTGGGAATTGAGATCACTTGG - Intergenic
961697693 3:128717220-128717242 CTATGGGAAGTGAGGATACTGGG + Intergenic
961981519 3:131084147-131084169 CTGTGAGAGTTGAGGGGATTGGG - Intronic
965661950 3:171051376-171051398 TTTTGGTAAATGAGGTGACTAGG + Intergenic
966558791 3:181295072-181295094 CTGTGGGAACTTGGGTCACTTGG - Intergenic
968273085 3:197419866-197419888 ATGTGGGGAGTGAGGTGACCAGG - Intergenic
968926694 4:3552034-3552056 CTGTGAGAACTGAAGGGACTGGG - Intergenic
972666509 4:41170300-41170322 ATGTGGGAATTGAGATTACATGG - Intronic
974913345 4:68149321-68149343 CTCTGGGAGTTCAGGTGTCTTGG + Intergenic
975599580 4:76085400-76085422 GTGTGGCTATTGAGGTGCCTAGG + Intronic
977714694 4:100168773-100168795 CTCTGGGATTTGATGTGACTGGG - Intergenic
978436359 4:108688985-108689007 CTGTGGGACTTGAAGTGTGTTGG - Intergenic
985139972 4:186829833-186829855 CTGTAGGGATTGAGAGGACTTGG - Intergenic
985878096 5:2615970-2615992 CTGTGTTAACTGAGATGACTTGG + Intergenic
990240673 5:53813376-53813398 CTGGAGGAAGTGAGGTGGCTAGG - Intergenic
990320330 5:54623618-54623640 GTGTGGGAATGGAGAAGACTTGG - Intergenic
994676636 5:102831046-102831068 CAGTGGGAATTTTGGTCACTTGG + Intronic
996187945 5:120502604-120502626 CTGTGGGAATTCAGAGGTCTTGG + Intronic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
998093689 5:139384998-139385020 CTGGGGGAATGGAGGTGCCTGGG - Intergenic
998482038 5:142470600-142470622 CTGTGGGAATTGACGGGAAAGGG + Intergenic
999418957 5:151424243-151424265 CTGTGATATTAGAGGTGACTGGG - Intergenic
1000918131 5:167106739-167106761 CTGTGGCAATAGAGGTGAAGAGG + Intergenic
1001421762 5:171592995-171593017 CTGTGAGAGGTGAGGTCACTTGG - Intergenic
1002900002 6:1402393-1402415 CTGTGGGAACTCAGGTCACAGGG + Intergenic
1003215327 6:4104118-4104140 ATGTGGGAATGAAGGTGACTGGG + Intronic
1005586939 6:27286343-27286365 ATCTGGGAATTCATGTGACTGGG - Intronic
1005799829 6:29409806-29409828 CTGGGGAATCTGAGGTGACTAGG + Intronic
1008224455 6:48896922-48896944 CTGTGCAAAGTCAGGTGACTGGG - Intergenic
1008827279 6:55711884-55711906 CTGTGGGAGATGAGGTGCTTTGG + Intergenic
1009439544 6:63660935-63660957 CTGTGGAACTTGAGGAGACAGGG + Intronic
1009935184 6:70225370-70225392 CTGTGTCAACTGAGGTGACAGGG - Intronic
1012499660 6:99874843-99874865 CTGGGGGAATTGTGGTTTCTGGG + Intergenic
1014831037 6:126103127-126103149 CTGTGGGAAGAGAAGTCACTGGG - Intergenic
1015609648 6:135002733-135002755 CTATGGGATTTGAAGTGCCTGGG - Exonic
1016207753 6:141490586-141490608 GTGTGGGAATTGAGCTGGGTTGG - Intergenic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016617906 6:146074312-146074334 CTGTGGAAAAGCAGGTGACTAGG - Intronic
1017428136 6:154343525-154343547 TGGTGGGAAGTGAGGCGACTTGG - Intronic
1018556940 6:165060012-165060034 CTATGGAAATTAATGTGACTAGG - Intergenic
1019171365 6:170134970-170134992 CTGTGGAATTTGAGGTGCCACGG - Intergenic
1019978089 7:4600632-4600654 CTGTGGGTATTGTGTTCACTGGG + Intergenic
1023664690 7:42510594-42510616 CTGTGGGAAGTGAGGAGCCCTGG + Intergenic
1023670204 7:42568351-42568373 CTGGAGAAACTGAGGTGACTTGG + Intergenic
1024516312 7:50261828-50261850 CTGTGGGTATTCAGATAACTAGG + Intergenic
1024847956 7:53671955-53671977 ATGAGGTATTTGAGGTGACTGGG - Intergenic
1027726049 7:81807414-81807436 TTTTGGGATATGAGGTGACTTGG + Intergenic
1029116373 7:98239646-98239668 CTCTGGGAAGTGGGGTGACCAGG + Intronic
1033551839 7:142454728-142454750 CTGGGGGAATGGAGGAGGCTGGG + Intergenic
1033554119 7:142473661-142473683 CTGAGGGAATGGAGGAGGCTGGG + Intergenic
1034079100 7:148260236-148260258 CTCTCCTAATTGAGGTGACTGGG + Intronic
1035123299 7:156587618-156587640 CTCTGGGAGATTAGGTGACTTGG + Intergenic
1037928602 8:22864591-22864613 CAGTAGGAATCGAAGTGACTCGG + Intronic
1038898630 8:31816357-31816379 ATGCTGGAATTCAGGTGACTTGG - Intronic
1042207161 8:66340898-66340920 CTTTAGGGATTGTGGTGACTCGG - Intergenic
1045010175 8:97951895-97951917 CTGCGGGAAAGGAGGAGACTAGG + Intronic
1046297637 8:112242576-112242598 CTATTGAAATTGTGGTGACTTGG + Intronic
1047585368 8:126266804-126266826 CTATGGGCATTGTGATGACTGGG - Intergenic
1051783467 9:20716096-20716118 CTGTGGGAATTGACTTAGCTGGG + Intronic
1053150285 9:35738904-35738926 CTGTGGGAGAGGAGGGGACTTGG + Intronic
1056787120 9:89601261-89601283 TGGTGGGGATTGAGGTGAATGGG + Intergenic
1057226280 9:93294924-93294946 AACTGGGAATTGAGGTGACTTGG + Intronic
1057420646 9:94909758-94909780 CTGTTGGTTCTGAGGTGACTGGG + Intronic
1058328926 9:103734359-103734381 CTGTGGGATTTGTTGTGATTAGG + Intergenic
1059783564 9:117555644-117555666 CTGTGTGTATTGAGGTGGATAGG + Intergenic
1059977181 9:119730011-119730033 TTGTGGGCAATGATGTGACTCGG + Intergenic
1060289263 9:122285324-122285346 CTTTTGGAATGGAGGAGACTGGG + Intronic
1061180512 9:129022602-129022624 CTTTGTGAAATGAGGTGGCTGGG + Intronic
1185430774 X:10545-10567 CTGTGGGGATTTAGGGGACCAGG + Intergenic
1185440040 X:222942-222964 CTGTGGGGATTTAGGGGACCAGG + Intergenic
1189376970 X:40474115-40474137 CTGTGGGAAATCAGCTCACTAGG - Intergenic
1193775978 X:85642093-85642115 CTGGGGGCATTGAGGGGGCTGGG - Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1199642503 X:149877223-149877245 CTCTGAGAATTGAGGTGGCTAGG + Intergenic