ID: 946108541

View in Genome Browser
Species Human (GRCh38)
Location 2:217393495-217393517
Sequence CCCCCCACTCAGTTTAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946108527_946108541 29 Left 946108527 2:217393443-217393465 CCGTCAGAGTCTCGTGGTCTTAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 946108541 2:217393495-217393517 CCCCCCACTCAGTTTAAATGGGG 0: 1
1: 0
2: 0
3: 4
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946108541 Original CRISPR CCCCCCACTCAGTTTAAATG GGG Intronic
900655757 1:3756028-3756050 CCCTCCTCTCAGTTTAAAGATGG + Intronic
907083653 1:51648577-51648599 CTCTCCACTCAGCTTTAATGCGG - Intronic
908880547 1:68726985-68727007 GGCCCTAGTCAGTTTAAATGGGG - Intergenic
912304655 1:108554947-108554969 CTCGACACTCATTTTAAATGTGG - Intergenic
919629485 1:199946048-199946070 CACCCCACTCAGCTTAGCTGTGG - Intergenic
920536324 1:206738998-206739020 TACTCCACTCAGTTTAAAAGTGG + Intergenic
920582812 1:207128024-207128046 CCCCCAACTCCGATTATATGGGG + Intronic
924723439 1:246644891-246644913 CCCCTCCCTCTGTTAAAATGGGG - Intronic
1067047599 10:42993262-42993284 CTCCCCACTCTGTGTACATGGGG + Intergenic
1071872466 10:89810376-89810398 CCCCATCCTAAGTTTAAATGTGG + Intergenic
1072176417 10:92926968-92926990 TCCCCCACACAGTTTTAATATGG - Intronic
1074997864 10:118773416-118773438 CCCAGCACTCACTTTAGATGTGG + Intergenic
1075516763 10:123115482-123115504 GCACCCACTCAGCTAAAATGGGG + Intergenic
1075668830 10:124249240-124249262 TCCCCCACTGATTTTAAGTGAGG + Intergenic
1079523736 11:21359703-21359725 CACCCCTCTCAGATTAAATCAGG - Intronic
1084274820 11:68045928-68045950 GCCCCCACTCAGTGTCACTGGGG + Intronic
1086675816 11:89605911-89605933 CCCCCTACCCAGCTTTAATGAGG - Intergenic
1086743172 11:90392688-90392710 CAACCCTCTTAGTTTAAATGAGG + Intergenic
1088805527 11:113348723-113348745 CCTCCCACTCAGAGTAACTGAGG + Intronic
1092875224 12:12841995-12842017 GGCCCCACTCAGTTTGAACGTGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1108922920 13:55698602-55698624 CCCCCCAGCCAGTTTGAATAAGG + Intergenic
1115505613 14:34091601-34091623 TCCCCCACTGATTTGAAATGAGG + Intronic
1117944264 14:61001006-61001028 CAGCCCACTTAGTTTAACTGTGG - Intronic
1122380182 14:101297808-101297830 CCCCTCCCTCAGTTTTACTGAGG - Intergenic
1127393515 15:58525721-58525743 CCATCCAATCTGTTTAAATGAGG + Intronic
1127396322 15:58546428-58546450 CCACCCCATCAGTTTAATTGAGG + Intronic
1133483076 16:6190841-6190863 CTCCCAACTCGGTTTAAATGTGG - Intronic
1137447959 16:48543684-48543706 CCACCGACTCAGTCTAGATGAGG + Intronic
1138067287 16:53955444-53955466 CCCTCATCTCAGCTTAAATGAGG - Intronic
1141649660 16:85386129-85386151 CCTCCCACCCTGTTTAAATATGG + Intergenic
1142372374 16:89690342-89690364 CCCCCTGCCCAGTTCAAATGAGG + Intronic
1144783933 17:17821596-17821618 CCCTCCCCTCAGTTTACAGGGGG + Intronic
1145795190 17:27651363-27651385 CTCCCCACTCTGTATAACTGAGG + Intergenic
1157123864 18:44936953-44936975 TGCCCAACTGAGTTTAAATGAGG + Intronic
1157580417 18:48770999-48771021 CCCCCTACGCTGATTAAATGTGG + Intronic
1158541563 18:58360887-58360909 ACCCCCAGTCAGTATAACTGTGG + Intronic
1160865995 19:1256173-1256195 CTCCCAGCTCAGTTTAAAAGTGG + Intronic
927886099 2:26719960-26719982 CCCCCCACTCATTTTATAGATGG - Intronic
929657786 2:43751397-43751419 CCCCCCAGTAAGTTTACAAGAGG + Intronic
935200918 2:100855896-100855918 CAGCCCACTCAGCTTGAATGGGG + Intronic
936003973 2:108865709-108865731 CCAACCACTCACCTTAAATGGGG - Intronic
936944997 2:117922151-117922173 CCCACCTCACCGTTTAAATGAGG + Intronic
938979854 2:136515981-136516003 CCCCCCACTCAGTATAGCTTCGG - Intergenic
942857656 2:180569180-180569202 CTCCTTACTCAGTTTAAGTGGGG - Intergenic
946108541 2:217393495-217393517 CCCCCCACTCAGTTTAAATGGGG + Intronic
947851012 2:233288165-233288187 CTCCCCTCTCAGCTTCAATGAGG - Intronic
949052732 2:241905808-241905830 CCCCACACTCAGTTTCACTATGG - Intergenic
1168897637 20:1334758-1334780 CCCCCAAGTCTGTTTGAATGGGG - Intronic
1175224206 20:57435465-57435487 TCCACCTCTCAGTTTAAATAAGG - Intergenic
1184569277 22:45311595-45311617 CCCTCCACTCAGCTTAAACTGGG - Intronic
949987208 3:9550773-9550795 CACCCAACTCAATTTAGATGTGG - Intronic
954483646 3:50825592-50825614 CCCCCCACCCAGTTTTAATATGG - Intronic
954853739 3:53625317-53625339 CCACCAACTCAGTTTTAATTGGG - Intronic
955129613 3:56152402-56152424 CCCCCCCTTCATTTTAAATTGGG - Intronic
962986533 3:140541342-140541364 TCCCCCACTCAGGTTGACTGGGG - Intronic
967264484 3:187678295-187678317 CCCACCCCTCAGTTTACATATGG + Intergenic
969833747 4:9821199-9821221 CCCCTCAGTCAGTTAATATGGGG + Intronic
970252671 4:14132580-14132602 CCCACCACTCACTTTAATGGAGG - Intergenic
981248627 4:142571218-142571240 CCTCCCACTCATTTTTAATCTGG + Intronic
989440216 5:41462501-41462523 CCCTCTACTCACTTTAGATGAGG - Intronic
996653461 5:125911823-125911845 CCCCCCTCTAAGTTTAAATATGG + Intergenic
1003378281 6:5599201-5599223 ATCTCCACTCATTTTAAATGAGG + Intronic
1004108470 6:12689240-12689262 CCCCCCACTCACTGTTATTGGGG + Intergenic
1004456141 6:15793100-15793122 GAGCCCACTCAGTTGAAATGAGG - Intergenic
1007381776 6:41494910-41494932 CCCCCCGCCCAGTTTGAATGAGG - Intergenic
1016144733 6:140655842-140655864 CTGCCCACTCAGATTAAGTGTGG - Intergenic
1019895434 7:3978993-3979015 CCCTCCACTCAGCCTCAATGAGG - Intronic
1026796448 7:73369024-73369046 CCCCCAACCCAGTTTAGAGGAGG + Intergenic
1031451307 7:121923683-121923705 CCCCCCACCAAGTTAAAATCAGG - Intronic
1033839044 7:145351706-145351728 CCTCCAACTCAGTTTTCATGAGG - Intergenic
1036532245 8:9602504-9602526 GCCACCACTCAGATTAACTGAGG + Intronic
1036938869 8:13032089-13032111 CCCCCCATGCAGTTTGAAGGTGG - Intergenic
1041622725 8:59990799-59990821 CCCCACACTGAGTTTTACTGTGG + Intergenic
1049223141 8:141436949-141436971 CCCCCCACCCAGTGCAGATGGGG - Intergenic
1052550601 9:29942562-29942584 TCCCCCCCTCAGTTTAGAGGGGG + Intergenic
1052630990 9:31038557-31038579 TTCCCCACTCACTTTAAATAGGG - Intergenic
1196661496 X:118275429-118275451 TCCCCCACTGATTTGAAATGTGG - Intergenic
1198772383 X:140144722-140144744 CCCCCCACCCAGTTTCATTCAGG + Intergenic