ID: 946114198

View in Genome Browser
Species Human (GRCh38)
Location 2:217447254-217447276
Sequence AGCATCTCTCCTTCTCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946114198_946114199 -2 Left 946114198 2:217447254-217447276 CCAAGGGGAGAAGGAGAGATGCT 0: 1
1: 0
2: 2
3: 40
4: 362
Right 946114199 2:217447275-217447297 CTTTCTCCAAAGAGCTCAAGAGG 0: 1
1: 0
2: 0
3: 21
4: 250
946114198_946114202 11 Left 946114198 2:217447254-217447276 CCAAGGGGAGAAGGAGAGATGCT 0: 1
1: 0
2: 2
3: 40
4: 362
Right 946114202 2:217447288-217447310 GCTCAAGAGGAGTCAGGAGAAGG 0: 1
1: 0
2: 3
3: 20
4: 327
946114198_946114201 5 Left 946114198 2:217447254-217447276 CCAAGGGGAGAAGGAGAGATGCT 0: 1
1: 0
2: 2
3: 40
4: 362
Right 946114201 2:217447282-217447304 CAAAGAGCTCAAGAGGAGTCAGG 0: 1
1: 0
2: 1
3: 58
4: 711

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946114198 Original CRISPR AGCATCTCTCCTTCTCCCCT TGG (reversed) Intronic
900309951 1:2028874-2028896 AGCCTCTCTCCCTCTCCTCTGGG + Intronic
900401034 1:2472980-2473002 AGCATCTCCGCCTCTCCCCTGGG - Intronic
900743471 1:4344401-4344423 ATCATCTCTCCTCAGCCCCTCGG - Intergenic
900756669 1:4440176-4440198 AGCCTCTTTCCTTCACCCCAGGG + Intergenic
900778264 1:4600621-4600643 AACACGTCTCCTCCTCCCCTTGG + Intergenic
901712647 1:11127813-11127835 TGCTTCTCTCCTTCTTCTCTTGG - Intronic
902359011 1:15931812-15931834 AGCTTCTGTGCTTCTCCCCGAGG - Exonic
902551937 1:17224416-17224438 AGGGTCTCACCTTGTCCCCTTGG - Exonic
903386947 1:22933250-22933272 ACCATCTCTCTTCCTCCCCCAGG + Intergenic
904681414 1:32232016-32232038 AGCTCCACACCTTCTCCCCTGGG - Intergenic
904894274 1:33802467-33802489 AGCATCCCTGCTTCTCTCTTTGG + Intronic
905253952 1:36668022-36668044 AGCTCCTCTGTTTCTCCCCTGGG - Intergenic
905311526 1:37052249-37052271 AACATCTCTGCCTCACCCCTTGG + Intergenic
906423192 1:45687619-45687641 ATCATTTCTCCTACTGCCCTCGG - Exonic
906679204 1:47713697-47713719 CGCATCTCCCCTTCATCCCTGGG - Intergenic
907962280 1:59294911-59294933 AGAATCTCACCTTCGCCACTTGG + Intergenic
907990281 1:59575249-59575271 AACATCTCTGCTTTACCCCTTGG + Intronic
909322074 1:74302283-74302305 CCCATCTCTCTTTCTCTCCTTGG + Intronic
909829506 1:80169375-80169397 AGCACCTCTTCTCCTCCCTTTGG - Intergenic
910261025 1:85294089-85294111 ACTATCTCTCCTTCTGCCCTTGG - Intergenic
910743868 1:90551952-90551974 TGCATCTCTCCATCTCTCTTAGG + Intergenic
912796042 1:112694224-112694246 AGAAACACTCCTCCTCCCCTGGG - Intronic
915464629 1:156089745-156089767 AACGTCTCTGCTTCTCCCCTGGG + Intronic
916116227 1:161487226-161487248 AACATCTCTCTCTCTCCCCTTGG - Intergenic
916723755 1:167504660-167504682 GGCATCTCTGCTTCTCTGCTGGG - Intronic
917600179 1:176566097-176566119 TTCATCTTCCCTTCTCCCCTCGG - Intronic
917746845 1:178018293-178018315 AGTTTCTCTCCTTCTCTCCTTGG - Intergenic
918740752 1:188128012-188128034 AGCAGCTCTCCTGCTGCCCCAGG - Intergenic
919035647 1:192305020-192305042 AGGATCTCTCTTTGTCACCTAGG - Intergenic
919759438 1:201088012-201088034 GGCTTCTCTCCTTGTCCCCCAGG - Intronic
920071985 1:203308580-203308602 ACCATCTCTCCTGCTCTCCTTGG + Exonic
920107432 1:203563891-203563913 AGAGTCTCTCCCTGTCCCCTAGG + Intergenic
920199205 1:204249174-204249196 AGCTTCTCACCTTCTCAGCTCGG + Exonic
921343042 1:214153663-214153685 ATCATCTCACCTTCTCACCCCGG - Intergenic
921609805 1:217198057-217198079 CCCATCTCTCTTTCTCTCCTTGG - Intergenic
922451132 1:225738289-225738311 AGCATCTCTCTCTCTCACCCAGG + Intergenic
924710929 1:246529471-246529493 AGCATCTCTCTCTTTACCCTTGG + Intergenic
1063120047 10:3099253-3099275 AGATTCTCCCTTTCTCCCCTAGG + Exonic
1063212395 10:3892898-3892920 AGCAGCTCTCCTTCTCCTTAGGG - Intergenic
1065371079 10:24987111-24987133 GGCATTTCTCCTCCTCTCCTAGG + Intronic
1067092714 10:43277486-43277508 ACCCTCTCTCCCTCTGCCCTGGG + Intergenic
1067226281 10:44378213-44378235 AGCATCTCCTCTGCTCCCCTGGG - Intronic
1067494632 10:46750781-46750803 AGCATCTGTCCTTTCTCCCTGGG + Intergenic
1067600024 10:47589617-47589639 AGCATCTGTCCTTTCTCCCTGGG - Intergenic
1068147383 10:53088779-53088801 AGCAACTCTCCTTCCACCCCAGG + Intergenic
1070131106 10:73655964-73655986 AGCACCTCAACTTCTCTCCTGGG - Exonic
1070321761 10:75359784-75359806 AGGAGCTCTCTTTTTCCCCTGGG + Intergenic
1071168768 10:82838007-82838029 AGCATCACTCCTGCTCCTCCTGG - Intronic
1072069062 10:91899001-91899023 AGCAACTCTCCATCTCAGCTGGG - Intergenic
1072151091 10:92684679-92684701 AGTCTCTTTCCTTCTCTCCTTGG + Intergenic
1072801689 10:98396768-98396790 AGCCTCTCTACTTCTTCCCTAGG + Intronic
1073461925 10:103670743-103670765 AGCATTGCTCCTGCTCCCCAAGG - Intronic
1073538311 10:104297450-104297472 GGCCTCTCTCCTTCTCCCTCTGG - Intronic
1074883085 10:117673379-117673401 AGCACCTTGCTTTCTCCCCTGGG - Intergenic
1076385486 10:130052192-130052214 AGCTTCTCTACTTTTGCCCTGGG + Intergenic
1076584857 10:131539758-131539780 AGCATCTCTCTTTGTCACCCAGG + Intergenic
1076669698 10:132112759-132112781 GGCAGCTCTCCACCTCCCCTTGG + Intronic
1076990907 11:273009-273031 TTCCTCTGTCCTTCTCCCCTGGG - Intergenic
1076997715 11:307086-307108 ATCATCTCTGCCTCTTCCCTGGG - Intergenic
1076999505 11:315698-315720 GGCATCTTCCCTGCTCCCCTGGG + Intergenic
1077377374 11:2211379-2211401 AGCTGCCATCCTTCTCCCCTTGG - Intergenic
1077889915 11:6411411-6411433 AGCATCACTGCTTCTGCCCCAGG + Intronic
1078445628 11:11403016-11403038 AGCGTCATTCCTTCTGCCCTGGG - Intronic
1078751183 11:14165084-14165106 AGCAGGTCTCCTTCTTGCCTGGG - Intronic
1080306361 11:30840643-30840665 AGCAGCTCTCCATCACCACTCGG - Intronic
1080725793 11:34898692-34898714 AGCGTCTCTCTCTCTGCCCTTGG + Intronic
1080780297 11:35422966-35422988 GGCATCTCTCAGTCTCCTCTAGG + Intergenic
1081812969 11:45923426-45923448 AGCAGCCCCCCTTCTCCGCTAGG - Intronic
1082087053 11:48058817-48058839 AGGATCTTGCCTTTTCCCCTCGG - Intronic
1082761844 11:57134796-57134818 AACATCTCTCTTCCTCTCCTTGG - Intergenic
1083038768 11:59666669-59666691 AGCACCTATCCTGCTCCTCTGGG - Intronic
1083368912 11:62163075-62163097 AGCATCTTTCATTCTGCCCCGGG + Intergenic
1083591561 11:63898336-63898358 AGCATGTCATCTTCTCCCCGAGG + Intronic
1084088052 11:66863764-66863786 AGCCTCTCACCTTCACACCTCGG + Exonic
1084990652 11:72921616-72921638 AGCACCTCTCTTTTTGCCCTTGG + Intronic
1085836841 11:79966127-79966149 AGCATGTCTCCTTGTGCCTTAGG + Intergenic
1087922602 11:103883670-103883692 ATGATCTCACCTTCTCCCATTGG + Intergenic
1088831447 11:113540232-113540254 TGCTTCTCTGCTTCTCCTCTGGG - Intergenic
1088832036 11:113545446-113545468 AGCATCACTCCTTCTAACCCTGG + Intergenic
1089649700 11:119904784-119904806 GGCCTCTCTCCTCCTGCCCTTGG - Intergenic
1089858973 11:121572157-121572179 AGCATTCCTCCTTGTGCCCTTGG + Intronic
1090247781 11:125229062-125229084 AGTGTCTCTCCCTCTCACCTGGG - Intronic
1091369995 11:135049823-135049845 AGGACTTCTCCTTCACCCCTGGG - Intergenic
1095779944 12:46048530-46048552 AGCAGCTCTCCTCCTACCCTAGG - Intergenic
1096252870 12:50044560-50044582 AGCACCTCTCCATCCCCCCTGGG - Intergenic
1096616107 12:52834395-52834417 AGGACCCCTCCCTCTCCCCTTGG - Intergenic
1096730049 12:53602411-53602433 AACATCTCTCCTACTCTCTTAGG + Intronic
1096820257 12:54228264-54228286 AGCATCTCTTCCTCCCTCCTTGG + Intergenic
1098108577 12:67097241-67097263 ATCTTCTCTCCTTTTCCTCTGGG + Intergenic
1098988670 12:77040952-77040974 AGCCACTCTCCTTCACCCCTTGG - Intronic
1099768383 12:87020608-87020630 AGCAGCTCTCCTCCTGCCCCAGG - Intergenic
1100931864 12:99618971-99618993 AGCAGCTCTCCTTCTACCACAGG - Intronic
1101549336 12:105747614-105747636 AGAATGGCTCCTTCTGCCCTGGG + Intergenic
1103080733 12:118022098-118022120 CGCATCACTCCTTCAACCCTTGG - Intronic
1103233440 12:119351561-119351583 AGCATCTCCCCTTCTCTCTCTGG - Intronic
1103949564 12:124543501-124543523 AGCATCTGACCCTCTGCCCTCGG + Intronic
1104394995 12:128425078-128425100 ACTACCTCTCCCTCTCCCCTGGG - Intronic
1104739017 12:131159028-131159050 ATTATCACTCATTCTCCCCTTGG - Intergenic
1105590643 13:21790101-21790123 AGTATCTCTCCCTCCCCTCTGGG - Intergenic
1105634421 13:22203649-22203671 AGCTTCTCTCCTTTTCTCCAAGG + Intergenic
1105667449 13:22575685-22575707 AGCAGCTCTCCTCCTCCCAAGGG + Intergenic
1107928088 13:45282877-45282899 AACAACTCTCCTTCTCACATAGG + Intronic
1109207175 13:59495507-59495529 ATCATCTCCTCTTCTACCCTGGG - Intergenic
1109299368 13:60574990-60575012 AACACCTCTCCCTCTCCTCTTGG - Intergenic
1110168482 13:72472045-72472067 AATATCTCTCCTTCTCCGATTGG + Intergenic
1110282990 13:73717277-73717299 AGGGTCTCTCCTTCTTGCCTAGG - Intronic
1110336995 13:74344927-74344949 CTCATCTATCCTTCTTCCCTGGG + Intergenic
1110491741 13:76117935-76117957 AGCAGCTCTCCTTCTACACCAGG - Intergenic
1113537809 13:111082054-111082076 AGCCTCTCTCTTTAGCCCCTGGG - Intergenic
1114559304 14:23578915-23578937 AGCATCTCTCCTCCCCCGCCCGG - Intergenic
1114742712 14:25114484-25114506 ACCATCCTTCATTCTCCCCTGGG - Intergenic
1115645322 14:35365312-35365334 AGCATCTCTCCTCTTCCCCGAGG + Intergenic
1117612227 14:57496245-57496267 TGCTTCTCTCCATCTCCTCTGGG - Intergenic
1118909384 14:70048749-70048771 AGCACCTCTCACTCTCACCTGGG + Exonic
1119775833 14:77248288-77248310 AACATCTCTCCCTCTCCCTGTGG + Intronic
1120998246 14:90433160-90433182 AGCAGATCTCCTTCTTGCCTAGG + Intergenic
1121930391 14:97966765-97966787 AACATCTCTCCTTCTCACAGAGG - Intronic
1122160506 14:99781051-99781073 AGCATCTCTCCTTCTTTCCAAGG + Intronic
1122685896 14:103506163-103506185 AGCTTCACTTCTTCTCCCCGGGG - Intergenic
1122711021 14:103658183-103658205 CGCCTCTCTCATCCTCCCCTTGG + Intronic
1125540775 15:40468841-40468863 AGCATCCCTCCTCATCACCTTGG + Intergenic
1126432173 15:48597945-48597967 GGCATCTCTTCTGCTCCCCTTGG - Intronic
1127961196 15:63892194-63892216 AGCATCTCTGCTTCCCTCCTAGG + Intergenic
1128334186 15:66775603-66775625 AGCTCCTCTCCTCCTCCCCCTGG + Intronic
1128350977 15:66888290-66888312 AGCAGATCTCCTTCTTGCCTGGG - Intergenic
1128910816 15:71512631-71512653 ATCTTCTCTCCTATTCCCCTGGG + Intronic
1129071100 15:72952277-72952299 AGCATTTCCCCCTCTCCCCGAGG - Intergenic
1129316444 15:74748336-74748358 ATCATCTCTTCTTTTCCACTTGG + Intergenic
1129696587 15:77743714-77743736 AGCATCCCTCCTGCGCCCCTGGG - Intronic
1130001561 15:80052195-80052217 ATCAACTCTCCTTTTCCCCATGG - Intergenic
1130017256 15:80197080-80197102 AGCATCTCTCTTTGTCGCCTAGG + Intergenic
1130361347 15:83189369-83189391 ATCTTCTGTCCTTCTCCCCCAGG + Intronic
1130715395 15:86329059-86329081 AGCAGCTCTCCTTCCACCCCAGG - Intronic
1131101364 15:89692330-89692352 AGCATATCTCCTTGGCCCCATGG + Intronic
1131585076 15:93684287-93684309 AGCAGTTCTCCTCCTGCCCTAGG - Intergenic
1132372396 15:101307819-101307841 GGCATCTCTCCCACTCCCCGAGG - Intronic
1132537153 16:487918-487940 AGCACCTCTGCCTCTTCCCTAGG - Intronic
1132936364 16:2483296-2483318 AGGACTTCTCCCTCTCCCCTCGG + Intronic
1133413803 16:5590290-5590312 AAAATCTCTGCTTCTCCCCAGGG - Intergenic
1135565427 16:23508086-23508108 AGAATCTCGCCTTGTCACCTAGG + Intronic
1135654347 16:24234610-24234632 AGGATCTCTCTTTGTCACCTAGG + Intergenic
1137415788 16:48277779-48277801 AGCAAGTCTCCTTCTCCCTGGGG + Intronic
1138881839 16:61026087-61026109 AGCAACTCTCCCTTTCTCCTTGG + Intergenic
1139370997 16:66469433-66469455 TGCTGCTCTCCTTCTCCCCCAGG + Intronic
1140088262 16:71815582-71815604 AGCATCTCACTTTGTCACCTAGG - Intergenic
1140463214 16:75158372-75158394 AGGATCTCTCTTTCTCACCCAGG + Intronic
1140595603 16:76406346-76406368 CGCATCTCTCTCTCTCTCCTTGG + Intronic
1141138913 16:81484528-81484550 AGCATCTCCTCTTCCCCCTTGGG + Intronic
1142145889 16:88492825-88492847 AGCCCCTCTCCTTCTCCCAAGGG + Intronic
1143432144 17:6895039-6895061 AGCATCCCACCTTGTGCCCTAGG - Intronic
1143592032 17:7890960-7890982 AGCAACTCTGCTTCTGACCTGGG + Exonic
1143616706 17:8055860-8055882 AGCAGCTCTCCCTCCACCCTGGG - Intergenic
1145840111 17:27987643-27987665 AGCATCTCTGCTGATCACCTAGG + Intergenic
1147931344 17:43983505-43983527 AACAGTTCTCATTCTCCCCTTGG - Intronic
1149569682 17:57663510-57663532 AGCCTCTCCTCTTCTCCCCAAGG - Intronic
1150121806 17:62609662-62609684 AGCCTCTCTCCAGCTCTCCTAGG - Intronic
1150849062 17:68687174-68687196 AGCATCTCTCCTTCTGGCTCAGG + Intergenic
1152250835 17:79211872-79211894 AGCACCTCTCCTGGTCACCTGGG + Intronic
1152730615 17:81967864-81967886 AGCCTCTCTGCCCCTCCCCTTGG - Intergenic
1153796385 18:8626664-8626686 AGTATCTCACTTTCTCCCCGAGG - Intronic
1153853901 18:9125817-9125839 AGCCCCTCTCCTTATACCCTAGG + Intronic
1153966711 18:10189285-10189307 ATCATCTCTCCTTCTCCCTTTGG - Intergenic
1154301655 18:13198891-13198913 TCCATCTCTCCCTCTCCCCCAGG + Intergenic
1155111135 18:22715678-22715700 ATCCTCTCTTCTGCTCCCCTAGG + Intergenic
1155415345 18:25592919-25592941 AGCATCTTTCCTGCTCTCCTTGG - Intergenic
1155663683 18:28281912-28281934 AGCAGCTCTCCTTCCACCCCAGG - Intergenic
1155677005 18:28441338-28441360 AGCAGCTCTCCTCCTTCCCCAGG + Intergenic
1158507657 18:58060721-58060743 TGCACCCTTCCTTCTCCCCTAGG + Intronic
1158617801 18:59004174-59004196 GGCCTCTCTCCTTGTCCTCTAGG - Intergenic
1158922424 18:62208154-62208176 AGCATCTCTCCTTCATTCATTGG + Intronic
1160041037 18:75345757-75345779 AATATCTCTGCTCCTCCCCTAGG + Intergenic
1161278742 19:3433835-3433857 AGCATCCCTCCTCCTCCCTGGGG + Intronic
1162181641 19:8873194-8873216 AGCATCTGTTCTTCTCCACTGGG + Intronic
1162823320 19:13236434-13236456 AGCATCTTTTCTTACCCCCTTGG + Intronic
1164552421 19:29222514-29222536 GGCAGCTCTCCTGCTCTCCTAGG + Intergenic
1164573008 19:29387625-29387647 AGCATGTCACTTCCTCCCCTGGG + Intergenic
1164727960 19:30479544-30479566 TGCATCACTCATTTTCCCCTTGG + Intronic
1164909406 19:31993171-31993193 AGAATTTCTCCTTTTCCCATAGG - Intergenic
1165119861 19:33552080-33552102 AGCCTCTCTCCACCTCTCCTGGG - Intergenic
1165290216 19:34877615-34877637 AGCATGTCTCTCTTTCCCCTGGG + Intergenic
1165746070 19:38229914-38229936 AGCATCTTTCCTCCCTCCCTGGG + Intergenic
1167509034 19:49886448-49886470 AGCCTCTGTCCTTGTGCCCTAGG - Intronic
1167805866 19:51784842-51784864 AGCAGACCTCCTTCTTCCCTGGG + Intronic
1168116816 19:54226211-54226233 AGCATCTCATCTTCTCCATTTGG - Intronic
925542756 2:4984093-4984115 AGGATCTCTCCTTGTACCCCTGG + Intergenic
925675851 2:6360344-6360366 AGTATCTCTCCCTCCCTCCTAGG - Intergenic
925955025 2:8955006-8955028 AGCAGCTCTCCTCCTGCCCCAGG + Intronic
926224242 2:10955923-10955945 ATCACCTCTCCTTCCCCCCCAGG - Intergenic
926353694 2:12020660-12020682 AGCTTCTCCCCTTCTTCCTTGGG + Intergenic
926941175 2:18138606-18138628 AGCATCTCTCCTTCCCACGCTGG + Intronic
927091344 2:19714994-19715016 AGAATCTACCCTTTTCCCCTCGG - Intergenic
927704623 2:25289508-25289530 AGTATCGCTCCAGCTCCCCTAGG - Intronic
929579811 2:43074716-43074738 GGCCTCTATCCCTCTCCCCTAGG + Intergenic
931185018 2:59941394-59941416 AGCATCTTTCCTTCTGTCATAGG - Intergenic
932656872 2:73618151-73618173 ACCATCTCTCCTGATTCCCTAGG + Intergenic
937008022 2:118535771-118535793 AGCACCTCTGGTTGTCCCCTGGG + Intergenic
938251773 2:129821315-129821337 GGCCTCTCACCTTCTCACCTGGG + Intergenic
938669617 2:133574353-133574375 AGCATCCCTGCCTCTTCCCTGGG - Intergenic
940517412 2:154698587-154698609 GACGCCTCTCCTTCTCCCCTGGG - Exonic
941308422 2:163898564-163898586 AGTATCTATCCTTGTGCCCTGGG - Intergenic
941625873 2:167829707-167829729 ATCATCTCTACCCCTCCCCTTGG + Intergenic
941919004 2:170830606-170830628 GGCATCTGTCGTGCTCCCCTGGG - Intronic
942797555 2:179839768-179839790 ACCATCTCCTCTTCTCCCCTTGG - Intronic
943772452 2:191733137-191733159 GGCAACTCTCCCTCTCCACTGGG - Intergenic
944399195 2:199305680-199305702 TGCATCACTCCTTCTCCATTTGG - Intronic
944990503 2:205230058-205230080 AGCATCTCTGGATCTGCCCTGGG - Intronic
945510137 2:210691165-210691187 AACATCTTTCCTTCTAACCTTGG - Intergenic
946114198 2:217447254-217447276 AGCATCTCTCCTTCTCCCCTTGG - Intronic
947826025 2:233106602-233106624 AGCACCCCTCCTCCTCCTCTGGG + Intronic
947955711 2:234189108-234189130 AGCATCTGCCCTCCTCCCCAGGG - Intergenic
1169021223 20:2332534-2332556 AGCCTCCCTCCTTCCTCCCTTGG - Intronic
1170206165 20:13800886-13800908 TACATCTCTCCTCCTCCTCTAGG + Intronic
1171201545 20:23246077-23246099 AGCATCCCTTCTTGCCCCCTGGG + Intergenic
1171205497 20:23276170-23276192 CGCATCTCTCTGTCTCACCTTGG + Intergenic
1171338582 20:24409312-24409334 AGCATCTCTCTTTCTTTCGTTGG + Intergenic
1171503031 20:25609133-25609155 AGTATCTCTCCTTGTTGCCTAGG + Intergenic
1172134808 20:32679794-32679816 ATCATCTCCCCTGATCCCCTAGG + Intergenic
1173427643 20:42956714-42956736 AAAGTCTCACCTTCTCCCCTAGG + Intronic
1175045018 20:56096663-56096685 AGAATCTCCCCTTGTCCCCCAGG - Intergenic
1175800691 20:61799693-61799715 AGCTCCTCTCCATCTCTCCTGGG + Intronic
1176222704 20:63977645-63977667 AGAATCCATCCTGCTCCCCTGGG - Intronic
1177540052 21:22480914-22480936 ACCATATCTCTTTCTCTCCTGGG + Intergenic
1178400772 21:32282922-32282944 ACCCTCTCTCCTAGTCCCCTCGG - Intergenic
1180085131 21:45504953-45504975 ACCATCACCCCTTCTTCCCTGGG - Intronic
1182415034 22:30216020-30216042 TGAATCTCACCTTCTCCCCAAGG - Intergenic
1183590933 22:38778958-38778980 AGCTTCTCTCCTTGTCCTCTGGG - Exonic
1183676180 22:39300060-39300082 TGCTTCTGTCCTTTTCCCCTGGG - Intergenic
1184204312 22:42991525-42991547 AGTCTCTCTCCTTCTTCTCTGGG - Intronic
1184601883 22:45548740-45548762 GGCATCCCTCCTGCTCACCTTGG - Exonic
1185349352 22:50326627-50326649 AGCAGCTCGCCTTCCCTCCTCGG + Intronic
949823097 3:8136946-8136968 AGCATCCCTTCTTCTCTCATGGG - Intergenic
950973489 3:17214803-17214825 AGCATCTCTCCTCTTCCCTCTGG + Intronic
951232627 3:20197533-20197555 ACCCTCTATCCTTCTCTCCTAGG - Intergenic
951343195 3:21513915-21513937 AGCAAGTCTCCTTATCCCTTTGG + Intronic
952143157 3:30501845-30501867 AGCACTTCCACTTCTCCCCTTGG + Intergenic
952327304 3:32332891-32332913 ATCCTCTCCCCTTCTCCCATGGG + Intronic
952667388 3:35922893-35922915 AGCATCTCTCCTTCTGCCCCAGG + Intergenic
953612619 3:44460348-44460370 AGCAGATCTCCTTCTTGCCTGGG + Intronic
954461201 3:50627960-50627982 AGCATCTCTCCCTCATCCTTTGG - Intronic
956915127 3:73862756-73862778 AGCATATCTCCTTCTTGCCTGGG - Intergenic
959582664 3:107997808-107997830 AGCATTTCTGCTTCTCCCCATGG + Intergenic
959754052 3:109875393-109875415 AGCAGCTCTCCTCCTCCCCCAGG - Intergenic
960004675 3:112770007-112770029 AGCATACCTCCTTCTTTCCTGGG + Intronic
960387336 3:117035985-117036007 TGCCTCTCTGCTCCTCCCCTGGG - Intronic
961217966 3:125176122-125176144 AGCAACTCTGCTTTTCCCCTTGG - Intronic
961383098 3:126508569-126508591 GGCTTCTCTCCTTGTCCCATTGG - Intronic
961502116 3:127343675-127343697 AGCATCTTTCCATATCCCATTGG + Intergenic
962407828 3:135115436-135115458 AGCCTCTCACCTCCTCCCCCAGG + Intronic
962453070 3:135538084-135538106 AGCCTGGCTCCTTCTCCCATTGG + Intergenic
962662753 3:137620767-137620789 GCCATCTCTCAGTCTCCCCTAGG - Intergenic
964036595 3:152206490-152206512 AGCATCTCCCCTGAGCCCCTGGG - Intergenic
964652465 3:159026895-159026917 AGCAGCTCTCCTCCTGCCCTGGG + Intronic
965165024 3:165187088-165187110 AGCATCTCTCCTACCACCCTGGG - Exonic
967136354 3:186515999-186516021 ACCATCTCTCATTGTCCCATTGG + Intergenic
967210080 3:187160485-187160507 AGCAGATCTCCTTCTTGCCTGGG - Intronic
967766555 3:193286653-193286675 CGCATCTCTCTTCCTCTCCTGGG + Intronic
970824140 4:20252899-20252921 AGCAGCTCTCATCCTCCACTTGG + Intergenic
972254403 4:37337618-37337640 TCCATCTCTCCTTGTCTCCTTGG + Intronic
972559159 4:40211289-40211311 AGCCTCTCTCTTTCTCACCGAGG + Intronic
974451713 4:62071077-62071099 AGCAGTTATCTTTCTCCCCTGGG - Exonic
974975685 4:68888260-68888282 AGCATCTCTCCTTTAGCCATAGG - Intergenic
975138379 4:70896462-70896484 ACCTTCCCTCCTTCTCCCCATGG + Intergenic
976055515 4:81061100-81061122 ATCATTGCTCCTTCTCCCATGGG + Intergenic
978841575 4:113220296-113220318 AACTTCTCTCCTTATCTCCTAGG - Intronic
979532683 4:121785735-121785757 AGCATCTCTATTTCTGCCCCTGG + Intergenic
979779661 4:124634657-124634679 AGCATCTCTCATTTTACGCTTGG + Intergenic
979829595 4:125282849-125282871 TGCATCTCTCTTTCTGCCCTGGG + Intergenic
984319951 4:178181716-178181738 AGGATCTCTCTTTCTCACCCAGG - Intergenic
984690046 4:182716150-182716172 AGAAGCTCTCCTTCCTCCCTAGG - Intronic
984911974 4:184682372-184682394 AGCATCTCTCATTGTCACCCAGG + Intronic
985170695 4:187146709-187146731 AGCATCTGTCCTCTTCTCCTGGG + Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
986469144 5:8057120-8057142 AGCATTCCTCCTCCTTCCCTGGG - Intergenic
986957641 5:13173848-13173870 AGCATTCCTCTTTCCCCCCTTGG - Intergenic
987274945 5:16352472-16352494 AGCATCTCTCCTTTCCCCTGGGG - Intergenic
988538656 5:32090077-32090099 ACCATCTCTACTTCACCCCAAGG + Exonic
989079669 5:37604561-37604583 TGTATTTCTACTTCTCCCCTAGG + Intronic
989087114 5:37687381-37687403 TGCATCTCTCCCTCTCCTGTGGG + Intronic
989246320 5:39258950-39258972 AGCATGTCTCTTACTGCCCTTGG - Intronic
989388934 5:40880590-40880612 AGCAGATCTCCTTCTTGCCTGGG - Intergenic
990428119 5:55709239-55709261 AGAATCTCTCCTTCTACAATGGG + Intronic
992406913 5:76467946-76467968 AGCATTTCTCTTCTTCCCCTAGG - Intronic
992749938 5:79852622-79852644 AGCATCTCACATTCTACCCTGGG - Intergenic
992940023 5:81751788-81751810 AGCGACTCGCCTTCTCTCCTGGG + Intronic
993009016 5:82458866-82458888 AGCAGCTCTCCTTCTATCCCTGG - Intergenic
995348438 5:111147774-111147796 AGCAGCTATACTTTTCCCCTTGG + Intergenic
996677136 5:126189224-126189246 GGCAGCTCTCATTCTCCTCTGGG - Intergenic
997381505 5:133441372-133441394 TGCAACTCTCTGTCTCCCCTCGG - Intronic
998068324 5:139176906-139176928 AGAATCTCAGCTTCTCCACTTGG - Intronic
1000172266 5:158713529-158713551 AGCCTCTCTTCCTCTCCCCCTGG - Intronic
1001251648 5:170151569-170151591 AGCACCTGTCCTTCTGGCCTAGG - Intergenic
1002705626 5:181159683-181159705 AGCCTCCCTCCTGCTGCCCTTGG + Intergenic
1002756566 6:166136-166158 AGCATATTTCCATCTCCCCTGGG - Intergenic
1002824594 6:761398-761420 AGCAGCTCTCCTTCCCCGCGTGG - Intergenic
1004397526 6:15258975-15258997 AGCACCTTTCCTTCTCACCAAGG + Intronic
1005207379 6:23420477-23420499 AGCAGCTCTCCTCCTGCCCCAGG - Intergenic
1005239028 6:23802910-23802932 AGCATCTGTCCATGGCCCCTGGG + Intergenic
1005347616 6:24905865-24905887 AGCTTGTCTCCTTCTGACCTTGG - Intronic
1006813712 6:36837355-36837377 AGAATCTCTGCTTCACCACTTGG - Intronic
1008848544 6:55996722-55996744 AGCATGTTTCCTTCTGCCCCAGG + Intergenic
1009216726 6:60930011-60930033 CCCATCTCTCTTCCTCCCCTCGG - Intergenic
1009523934 6:64719550-64719572 AACATCTCTCCTTCTTGCCAAGG - Intronic
1009849769 6:69180683-69180705 AGCAGCTCTCCTTCTGCCTCAGG + Intronic
1009963371 6:70551732-70551754 AGTCTCTCTCCCTCTCTCCTTGG - Intronic
1011113700 6:83866639-83866661 AGGATCTCGCTTTGTCCCCTAGG + Intronic
1011628154 6:89299988-89300010 TTCAGCCCTCCTTCTCCCCTGGG - Intronic
1012035667 6:94135511-94135533 AGCAACTCTGCTTCTTCCCATGG - Intergenic
1012110962 6:95233182-95233204 ATAATCTCTCCTTTTCCCCTTGG - Intergenic
1013416726 6:109932149-109932171 TGCTCCTCTCCTTCTGCCCTTGG - Intergenic
1013568161 6:111390981-111391003 AGGATCTCCCCTTTTCCACTTGG - Intronic
1013761024 6:113518190-113518212 AGCAGATCTCCTTCTTGCCTGGG + Intergenic
1014479666 6:121920530-121920552 ACCATCTAACCTTCTTCCCTGGG + Intergenic
1014610076 6:123532488-123532510 AGAATTTCTCCTTTTGCCCTGGG - Intronic
1014664686 6:124222492-124222514 AAAATCTCTCCTTCTCCATTAGG - Intronic
1016684138 6:146862513-146862535 AGCCTCTCTCCTCCTTTCCTGGG - Intergenic
1017051547 6:150398289-150398311 AGCCTCTCGCCTGCTCCTCTTGG + Exonic
1017809029 6:157970807-157970829 CTCATCTCTCCCTCTCTCCTGGG - Intergenic
1017969409 6:159298802-159298824 AGCCTCCCTCCCGCTCCCCTGGG + Intergenic
1019034894 6:169046482-169046504 AGCATTTCTTCTCCTCCTCTGGG - Intergenic
1019304717 7:327819-327841 GGCATCTCTCTCTCTCCCCATGG - Intergenic
1020921840 7:14275088-14275110 AGCATCTCTCTGTCACCTCTGGG + Intronic
1020931786 7:14406111-14406133 GGTATCTCTCCTTCTCCCTCTGG - Intronic
1021900965 7:25285228-25285250 AGCTTCTTTGCTTCTACCCTGGG + Intergenic
1022738577 7:33099479-33099501 GGATTCTCTCCTGCTCCCCTTGG + Intronic
1023497756 7:40816087-40816109 AGCAGCTCTCCTTCTGCCTGAGG + Intronic
1023800746 7:43832338-43832360 AGCAGACCTCCTTCTTCCCTGGG + Intergenic
1024017440 7:45329787-45329809 AGGATCACTCCTTCTTCTCTGGG + Intergenic
1026572750 7:71546184-71546206 AGCATCTCACCCTGTCACCTAGG + Intronic
1027564227 7:79769743-79769765 ACCATCACACCTTTTCCCCTTGG + Intergenic
1029212707 7:98921926-98921948 AGCTTCTCTCCAGCTCCCCATGG + Exonic
1029221914 7:98996743-98996765 AGCATCTCTTCTTTTTACCTGGG - Intronic
1029481001 7:100812935-100812957 CACAGCTCTCCTTCTTCCCTGGG + Exonic
1029736634 7:102469066-102469088 AGCCCCTCCCCTTCACCCCTGGG + Intronic
1032104713 7:129017599-129017621 AGCATCTGTCCTTTCCCCCTTGG - Intronic
1033224124 7:139547362-139547384 AGTCTCGCTCCTTATCCCCTGGG + Intergenic
1033398013 7:140993999-140994021 AGAATCTCACCTTGTCCCCCAGG + Intergenic
1034113864 7:148564597-148564619 AGCAGATCTCCTTCTTGCCTGGG - Intergenic
1035240325 7:157524767-157524789 AGCCTCTCTCTTTCTTCTCTGGG - Intergenic
1035811591 8:2496049-2496071 AGCAGATCTCCTTCTCATCTGGG - Intergenic
1036387540 8:8295249-8295271 AGGATCTCTCCTTGTCGCCCAGG - Intergenic
1037384627 8:18325024-18325046 AGCTTTTCTCCATCTCCCTTGGG - Intergenic
1037992178 8:23328824-23328846 AGCTTCTGTCCTGGTCCCCTGGG + Intronic
1038048139 8:23784511-23784533 AGCATCTCTCTTACTGGCCTGGG - Intergenic
1039443548 8:37612347-37612369 AGCCTTCCTCCTTCTCCCCATGG - Intergenic
1039486328 8:37912968-37912990 AGCATCTCTCTCTGTCCCCCAGG + Intergenic
1039486693 8:37915782-37915804 AGGAGGTCTCCTTCTACCCTGGG - Intergenic
1039491004 8:37947471-37947493 AGCCTCTCCCCTGGTCCCCTGGG + Intergenic
1039491022 8:37947522-37947544 AGCCTCTCCCCTGGTCCCCTGGG + Intergenic
1040286202 8:46101677-46101699 AGTATCACCTCTTCTCCCCTCGG + Intergenic
1040314373 8:46253229-46253251 AGTCTCTCCGCTTCTCCCCTCGG - Intergenic
1040367673 8:46735217-46735239 GGCATCTCTCTTTGTCCCCCAGG + Intergenic
1040930632 8:52731552-52731574 AGCATATCTCTTTCTCCCCAAGG + Intronic
1041942259 8:63401789-63401811 AGCCTCTCTCCTTCTCCTGGAGG - Intergenic
1042242208 8:66675450-66675472 AGCATCTCTCCCTGTCACCCAGG - Intronic
1044272133 8:90258577-90258599 AGGATCTCTCTTTGTCACCTGGG - Intergenic
1044632523 8:94293156-94293178 ATCATCTCTGCTCCTCACCTAGG + Intergenic
1044915990 8:97113049-97113071 AGCATCCCTCCTCTTCTCCTGGG - Intronic
1044962009 8:97540523-97540545 AGCATCTCGCCTTCTCTCCAGGG + Intergenic
1045226073 8:100246795-100246817 AGCAGCTCTCCTTTTCCTCTGGG + Intronic
1045402335 8:101831702-101831724 AGCATCTTCCCTTCTACCCAGGG + Intronic
1046005708 8:108480706-108480728 ACCATCTCTCCTTCTTGCCCTGG + Intronic
1047521684 8:125599885-125599907 ACCATCTCTCCTGCTCCACTTGG - Intergenic
1047917074 8:129593894-129593916 AGCTCCTCCCCTCCTCCCCTGGG + Intergenic
1047939779 8:129818088-129818110 TACATCTCTCCATCTCTCCTGGG + Intergenic
1048180004 8:132185689-132185711 AGGATCTCTCATTCTCTCCAAGG - Intronic
1049155843 8:141066241-141066263 GGACTCTCTCCTTCTGCCCTTGG + Intergenic
1050075299 9:1856577-1856599 AGCACCTGTCCATCTCCCCATGG + Intergenic
1050181956 9:2932858-2932880 TGCCTCTCTCCTCCTGCCCTGGG + Intergenic
1051769555 9:20561989-20562011 GGATTCTCTCCATCTCCCCTTGG - Intronic
1051770758 9:20576546-20576568 CTCATCTCTCCTCCTCTCCTTGG - Intronic
1051776091 9:20635665-20635687 ATCCTCTCTTCTTCTCCCATTGG - Intergenic
1052396905 9:27949637-27949659 AGAATGTCTTCTCCTCCCCTAGG - Exonic
1052919925 9:33957061-33957083 AGGATCTCACTTTGTCCCCTAGG - Intronic
1053152894 9:35754225-35754247 AGTTTCTGTCTTTCTCCCCTGGG + Exonic
1054779715 9:69155327-69155349 AGCTTCTTTCCCTCTTCCCTAGG + Intronic
1055588464 9:77783519-77783541 ATCATCTTTCCTTCTCACGTTGG + Intronic
1055736573 9:79336867-79336889 AGCAGCTCTCCTCCCACCCTAGG + Intergenic
1056389998 9:86132117-86132139 AGCACCTCTCCTTCTTCCTTAGG + Intergenic
1056615456 9:88161539-88161561 AGCATCTCTTCATGTCCCTTGGG - Intergenic
1057236824 9:93367604-93367626 AGCATCTCACTTTGTCACCTAGG + Intergenic
1057240876 9:93407407-93407429 AGCCCCTCTCCTCCTGCCCTTGG - Intergenic
1057904652 9:98974575-98974597 AGCACCTCCTCTTCTCCCCAGGG + Intronic
1058439449 9:104993513-104993535 AGCAGCTCTCCTCCTCTCCTAGG + Intergenic
1059591410 9:115666818-115666840 AGCATTTCTTCTGCCCCCCTTGG + Intergenic
1059603456 9:115807149-115807171 TCCATCTCTCTTTCTCTCCTCGG - Intergenic
1061296250 9:129678429-129678451 AGCATGTCTCCTTCACACCAAGG - Intronic
1061943551 9:133895483-133895505 AGCTTCTCTCCTTTTCACGTCGG - Intronic
1203759925 EBV:7030-7052 AGCCTCTCTTCTCCTCCCCCGGG - Intergenic
1189127512 X:38463760-38463782 AGCTTCTATCTTTCTCCCCCTGG - Intronic
1190787021 X:53661465-53661487 AGCATCTCAGCTTCTCATCTTGG - Intronic
1192917323 X:75666485-75666507 AGCAACTCTCCTCCTTCCCCAGG + Intergenic
1193063557 X:77233150-77233172 AGCAGTTCTCCTTCTGGCCTAGG - Intergenic
1193489391 X:82130922-82130944 AGCATCTCACCCTCTCCTCCAGG - Intergenic
1193787773 X:85781415-85781437 ATTCTCTCTCCTTCTCCCCTGGG + Intergenic
1194172188 X:90601291-90601313 AGCAGCTCTCCTCCTGCCCCAGG - Intergenic
1194447743 X:94008375-94008397 AGCAACCCTCCTTCTTGCCTGGG - Intergenic
1194720081 X:97329987-97330009 TGACTTTCTCCTTCTCCCCTAGG - Intronic
1197823493 X:130564805-130564827 GGCAACTGTCCTTCTCCACTTGG - Intergenic
1198278416 X:135118816-135118838 ATGATCTCACCCTCTCCCCTGGG + Intergenic
1198278649 X:135120839-135120861 TGCATCTTGCCTTGTCCCCTGGG + Intergenic
1198292312 X:135251677-135251699 TGCATCTTGCCTTGTCCCCTGGG - Intronic
1198292546 X:135253700-135253722 ATGATCTCACCCTCTCCCCTGGG - Intronic
1200518419 Y:4179028-4179050 AGCAGCTCTCCTCCTGCCCCAGG - Intergenic
1201099220 Y:10658689-10658711 AGCATCTCTTCCTCTCACCCAGG + Intergenic