ID: 946115103

View in Genome Browser
Species Human (GRCh38)
Location 2:217454316-217454338
Sequence CAGATTATGACAAAAAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946115103_946115108 2 Left 946115103 2:217454316-217454338 CCTCCCCTTTTTGTCATAATCTG 0: 1
1: 0
2: 0
3: 15
4: 177
Right 946115108 2:217454341-217454363 GCATAATTCTGAATAATTAATGG 0: 1
1: 0
2: 2
3: 37
4: 360
946115103_946115109 13 Left 946115103 2:217454316-217454338 CCTCCCCTTTTTGTCATAATCTG 0: 1
1: 0
2: 0
3: 15
4: 177
Right 946115109 2:217454352-217454374 AATAATTAATGGAATCTAAAAGG 0: 1
1: 0
2: 1
3: 46
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946115103 Original CRISPR CAGATTATGACAAAAAGGGG AGG (reversed) Intronic
911434147 1:97833480-97833502 CAGATTAAGAGAAAAAAAGGGGG + Intronic
914441668 1:147713003-147713025 CAGTTTATGGAACAAAGGGGAGG + Intergenic
916119258 1:161513216-161513238 CAGTTTATGACAAAAACATGAGG + Intronic
916129020 1:161594875-161594897 CAGTTTATGACAAAAACATGAGG + Intronic
916696715 1:167244904-167244926 CTGAAGTTGACAAAAAGGGGAGG - Intronic
917240094 1:172939068-172939090 CAGAATAAGACAAAGAGGGAAGG - Intergenic
919883890 1:201918813-201918835 GAGATTGTGACAAAAATGGGTGG - Intronic
922975788 1:229782354-229782376 CAGAGTTTGACAAACAGGAGTGG + Intergenic
923349643 1:233091439-233091461 CAAATTATGTGATAAAGGGGTGG + Intronic
1063432890 10:6006370-6006392 CAGGTCATGACAAGAAGTGGGGG + Intergenic
1064496215 10:15913026-15913048 AACATTATGAGCAAAAGGGGAGG - Intergenic
1066576588 10:36832413-36832435 CAGATAAAAAAAAAAAGGGGGGG + Intergenic
1070662011 10:78313747-78313769 GAGATTATTACAAAGAGGGATGG + Intergenic
1071310464 10:84338742-84338764 TACATTAGGAAAAAAAGGGGTGG - Intronic
1072886137 10:99275882-99275904 GAGATTATTACATGAAGGGGTGG + Intergenic
1073609993 10:104933809-104933831 CAGAGTAAGACAAAAAAGGAAGG - Intronic
1073693753 10:105841700-105841722 CAGATGAAGAGAAATAGGGGTGG - Intergenic
1074123314 10:110509236-110509258 CTCAATATGACAAAAAGGGGAGG - Intronic
1075086524 10:119417737-119417759 GAGATGAGGACAAAAAGGAGGGG + Intronic
1076088458 10:127657347-127657369 AAGATTTTGACAAAGAGAGGAGG - Intergenic
1076138639 10:128062699-128062721 AAGATTTTGACAAAGAGGAGGGG + Intronic
1080354992 11:31432997-31433019 CTGATTGTGATAAAAAGGAGGGG + Intronic
1084305088 11:68277128-68277150 CAAATAATGACAATAAAGGGTGG - Intergenic
1085230481 11:74964539-74964561 CAGATACTAACAAAATGGGGAGG - Intronic
1088574863 11:111260764-111260786 CAAATTATCACAAACAGGGTGGG - Intronic
1092467917 12:8750725-8750747 CAGATAAATACAAAAAGGGTAGG - Intronic
1093642473 12:21543121-21543143 CAGATTTTGATTAAAAGGTGAGG - Intronic
1097510847 12:60537525-60537547 CAGAGTAAGACAGAAAAGGGTGG - Intergenic
1098337671 12:69420558-69420580 CAGCTCTTGACAAAAAGGGATGG + Intergenic
1100781693 12:98033638-98033660 CAGCCCATGACAAAAAGAGGAGG - Intergenic
1102818411 12:115887520-115887542 AAGATTCTGAGAGAAAGGGGTGG + Intergenic
1103311286 12:120010928-120010950 CTGATTAAGAAAAAAAGGGGTGG + Intronic
1107951873 13:45470151-45470173 CATATTAAGTGAAAAAGGGGAGG + Intronic
1108516032 13:51203705-51203727 CAAAATATGACAAAGAGGGTTGG - Intergenic
1108707126 13:52999669-52999691 GAGTTTATGACAAAGTGGGGAGG - Intergenic
1108997694 13:56755622-56755644 CAGATTGTGACAGAAAGAGAAGG + Intergenic
1109514643 13:63426272-63426294 CAGATTAGGTGAAAAATGGGAGG - Intergenic
1110754643 13:79158060-79158082 CAGATACTCAAAAAAAGGGGAGG + Intergenic
1112824141 13:103372604-103372626 CAGAATAGAACAAAAAGCGGAGG - Intergenic
1114552398 14:23540437-23540459 CAGGTTGAGACAAAAAGGGGAGG - Intronic
1121473079 14:94171787-94171809 CAGAAATTGACAGAAAGGGGAGG + Intronic
1126916276 15:53469564-53469586 AAGATAAGGACTAAAAGGGGTGG - Intergenic
1127750221 15:62030679-62030701 CATATTATGAGAAAATGGGAAGG + Intronic
1128682972 15:69664874-69664896 CGGTTCATGGCAAAAAGGGGTGG + Intergenic
1129625017 15:77188004-77188026 CAGTATATGACTAAAAGGGTGGG + Intronic
1130755399 15:86757655-86757677 GAGAAAATGACAAAAAAGGGTGG - Intronic
1133573908 16:7069114-7069136 CAGCTTTTGACATAAAGGAGTGG - Intronic
1138305899 16:55974127-55974149 CAGAAGAAGACAAAAAGAGGAGG - Intergenic
1139486311 16:67258498-67258520 CAGAGCAGGACAGAAAGGGGTGG + Intronic
1139798030 16:69498670-69498692 CAGACGATGAGAAAAAGGAGTGG - Intergenic
1142940265 17:3375246-3375268 GAGACTATCTCAAAAAGGGGGGG - Intergenic
1144083516 17:11785819-11785841 CAGATGAGGACAGAAAGGTGTGG - Intronic
1146382515 17:32341654-32341676 GAGATAATGACAGAAAGGAGAGG + Intronic
1148143349 17:45343812-45343834 CAGATGAAGCCAAAAAGGGGTGG - Intergenic
1149581063 17:57750670-57750692 CAGATTATGACAAACGGCGTGGG - Intergenic
1149781648 17:59402075-59402097 AAAATTATGTCAAAAAGGGGTGG + Intergenic
1150996220 17:70320788-70320810 GAGAGTATGACAGCAAGGGGTGG + Intergenic
1152179033 17:78806412-78806434 CAGAAGAAGACAAAAAGGGGAGG + Intronic
1152771023 17:82169433-82169455 CAGATTGTCTCAAATAGGGGAGG - Intronic
1153672000 18:7420350-7420372 CTGATCAAGACAAAAAGGGAAGG - Intergenic
1154511106 18:15103308-15103330 CAGATTACTACAAAGTGGGGGGG - Intergenic
1157742578 18:50106593-50106615 CAGATAATGAGAAATAGGGTGGG - Intronic
1159081208 18:63738094-63738116 GAGTTTATGACAAAATGCGGTGG - Intergenic
1159181115 18:64906250-64906272 AAAATTATGACAATAAGGGAAGG - Intergenic
1160253734 18:77228404-77228426 CAGATTGAGACAAAAAGAGAAGG - Intergenic
1161351019 19:3791730-3791752 CAGATTATGACAGCCAGAGGGGG - Intronic
1164878619 19:31712013-31712035 CAGATCATGACTAGAAGGAGAGG - Intergenic
1166895276 19:46018622-46018644 CAGCTTATGACTAAAGGGTGAGG + Intronic
1167100070 19:47399229-47399251 CAGATTCTGGGAAAAGGGGGAGG + Intergenic
1167858816 19:52266484-52266506 AATATTCTGACAAAAAGAGGAGG - Intergenic
925570883 2:5311481-5311503 CAGATTTTGTTAAAGAGGGGTGG - Intergenic
930732537 2:54742228-54742250 GAGATAATGGCAAAAAGGTGGGG - Intronic
930990769 2:57650998-57651020 CAGAGTGTGACAAGGAGGGGTGG + Intergenic
931021082 2:58046185-58046207 AAGATTATGACAATAAGGTGAGG - Intronic
931165079 2:59738138-59738160 CATATTATGACAAAATGAGAAGG - Intergenic
931263089 2:60637428-60637450 CACAATATGACAAAAGGTGGTGG + Intergenic
932192475 2:69752519-69752541 CAGATTATGTCAATCAGGGAAGG - Intronic
932672395 2:73749717-73749739 GAGATTATCATGAAAAGGGGCGG - Intergenic
933311106 2:80662290-80662312 CAGATTACGAGTAAAAGGGAAGG - Intergenic
933493873 2:83022962-83022984 CAGAGTACCACAAAAAGAGGAGG + Intergenic
933808133 2:86014908-86014930 CAAATTATGAGAAAATGGAGAGG + Intergenic
936370804 2:111900409-111900431 CAGATTATGAAAAATGGGGCTGG - Intronic
940460850 2:153960553-153960575 CAGATTAAGAGATGAAGGGGTGG + Intronic
941321892 2:164065785-164065807 GAGTTTAGGACATAAAGGGGAGG + Intergenic
941925515 2:170890258-170890280 CAGATTATTTTCAAAAGGGGAGG + Intergenic
942838519 2:180331258-180331280 CAGACTAAGAAAAAAAAGGGAGG + Intergenic
943080186 2:183250531-183250553 CAGATTCTCACACAAAGGGTTGG + Intergenic
945278630 2:208014099-208014121 CAGATTAAGTCCAAAAGGGAGGG - Intronic
945779738 2:214154504-214154526 TAGGTTATGAAAAAATGGGGGGG - Intronic
946115103 2:217454316-217454338 CAGATTATGACAAAAAGGGGAGG - Intronic
1169614972 20:7430967-7430989 CAGTCCATGACAAAAAGTGGAGG + Intergenic
1170295729 20:14823132-14823154 CAAATTATAACAAAAAGCTGTGG + Intronic
1173327115 20:42044116-42044138 CAGATAAGGACAACATGGGGTGG + Intergenic
1174416514 20:50370950-50370972 CAAATTATAACAAAAAGCTGGGG + Intergenic
1174935679 20:54865651-54865673 CAGATAATTAGGAAAAGGGGAGG + Intergenic
1175031115 20:55955093-55955115 CAGTTTATGACCAAATGTGGTGG - Intergenic
1179281709 21:39939425-39939447 CAGACTATGAGAGAAAGGGCAGG - Intergenic
1179775730 21:43660598-43660620 CAGATAATAGCAAAAAGGGAAGG + Intronic
1180665788 22:17510984-17511006 TAGAAAATGACAAGAAGGGGTGG - Intronic
1181420576 22:22795190-22795212 AAGATTATGACACAAAGGGCTGG - Intronic
1182385959 22:29941375-29941397 CACATTATCACAAAAAGGTCTGG - Intronic
951830479 3:26920735-26920757 CAGAGCATGACAAAGAGGGCAGG + Intergenic
951853202 3:27166504-27166526 CAGATTATGAAAAAGATGGAGGG + Intronic
953551563 3:43907382-43907404 CAGAGTATGACACAGAGGAGTGG - Intergenic
954194635 3:48989427-48989449 CAGATTATCACCAAAAACGGGGG - Intergenic
955936580 3:64108504-64108526 CAGAGTATGACAAAGAAGGCTGG + Intronic
956648314 3:71479068-71479090 CAGACTATCCCAAAAGGGGGAGG + Intronic
958501074 3:94909802-94909824 CAGTTTTTAACAAAAAGGAGTGG - Intergenic
959713978 3:109413020-109413042 CAGGTTGTGACAAAGAGAGGGGG + Intergenic
959781878 3:110243739-110243761 GAGTTTATGCCAAAAAGGGCAGG - Intergenic
962964853 3:140344176-140344198 CAGATGATGACACACATGGGAGG - Intronic
964025296 3:152066207-152066229 GTAAATATGACAAAAAGGGGGGG + Intergenic
964833366 3:160910322-160910344 GAGACTCTGTCAAAAAGGGGAGG - Intronic
965191499 3:165535792-165535814 CTGATTATGTCAAAAAGAGATGG - Intergenic
965192144 3:165545323-165545345 AAGTTTATGACATAAAGGTGTGG - Intergenic
965882101 3:173398083-173398105 CAGATTACGAGAAAGCGGGGAGG + Intronic
967244868 3:187476546-187476568 CAAATTAGGACAAAAATGGGGGG - Intergenic
967546028 3:190729526-190729548 CAAAATATTAAAAAAAGGGGAGG + Intergenic
969201214 4:5607922-5607944 CAGAAAATGAGAGAAAGGGGAGG + Intronic
971174875 4:24272588-24272610 CAGAGTATTTTAAAAAGGGGTGG - Intergenic
972099836 4:35400969-35400991 CTGATTATGACAAAATTAGGAGG - Intergenic
972152007 4:36104196-36104218 CAGAATTTGAAAAAAAGGTGGGG - Intronic
972204220 4:36752307-36752329 CAAAATATGAAAAAAAGGAGGGG - Intergenic
974746994 4:66089547-66089569 AAGATTATGACACAAAGAAGGGG + Intergenic
975474284 4:74805100-74805122 CAGACTACAACAAAAAGGGTAGG + Intergenic
975796761 4:78014251-78014273 CTGAATAGGACAAAAAGGTGGGG + Intergenic
976016983 4:80567521-80567543 TAGTTTACGAAAAAAAGGGGAGG + Intronic
976188909 4:82470345-82470367 CAGATTATCACAAAATGTAGTGG - Intergenic
977365533 4:96063439-96063461 ATGATTATGACAAAGAGGGCAGG - Intergenic
978247323 4:106589713-106589735 CAGAGTATGACAAAGTGAGGTGG - Intergenic
978432417 4:108646736-108646758 CAGATTATGACATAGAGCTGGGG + Intergenic
982128956 4:152209625-152209647 CAGTCTATGTCAAAATGGGGCGG + Intergenic
982320729 4:154074285-154074307 CATATTTTGACACCAAGGGGTGG + Intergenic
982582536 4:157196981-157197003 TACATGATGACAAAAAGGGAAGG - Intergenic
983312344 4:166080892-166080914 CTGATAAAGACAAAAAAGGGTGG - Intronic
984697019 4:182789310-182789332 TAGATTATGACGGACAGGGGAGG + Exonic
984935056 4:184882647-184882669 CAGTTTATGAAAGAAAGGGAGGG + Intergenic
989321050 5:40134221-40134243 CAGACTCTGAGGAAAAGGGGAGG - Intergenic
990776827 5:59312963-59312985 CAGCTTATCACAAAGAGGGCAGG - Intronic
992939433 5:81749661-81749683 CAGTTTAAAAAAAAAAGGGGGGG + Intronic
993003215 5:82403638-82403660 GAGGTTATAACAAAAAGGAGGGG + Intergenic
993085375 5:83357435-83357457 GAGATTATGAGAAATCGGGGGGG + Intergenic
993535461 5:89079671-89079693 TATAATATGACAAAAAGGTGAGG - Intergenic
993978175 5:94508522-94508544 TAGAATATGAAAAAAAAGGGGGG + Intronic
998346260 5:141466863-141466885 CATATTATGAAAAAAATGTGTGG - Intronic
1000238921 5:159390839-159390861 CAGAGCATGAGAAAAAGAGGTGG - Intergenic
1001165422 5:169361329-169361351 CAGGATTTGAAAAAAAGGGGAGG + Intergenic
1001898836 5:175405415-175405437 CAAAATAGAACAAAAAGGGGAGG - Intergenic
1002072954 5:176691339-176691361 CAGGGTATGACAAATAGGGATGG + Intergenic
1005245050 6:23873913-23873935 TAAATTATGATAAAATGGGGGGG + Intergenic
1009371570 6:62909970-62909992 CATATTTTTACAAAAAGTGGAGG + Intergenic
1013419589 6:109954682-109954704 GACATTATAACAAAAAGAGGAGG + Intergenic
1014570602 6:123003029-123003051 CATATCATGGCAAATAGGGGAGG + Intronic
1016854834 6:148656910-148656932 GAGAAAATGACCAAAAGGGGGGG + Intergenic
1018023217 6:159782538-159782560 CAGATTAGGAGAAAAAGTGTTGG + Intronic
1018465109 6:164037040-164037062 CAGATTATAACAAAAAAGGAAGG + Intergenic
1020082114 7:5291713-5291735 CAGATGCTGATAAAAAGGAGAGG - Exonic
1020218575 7:6215610-6215632 CAAATAAGGACAAAAAGGGTGGG + Intronic
1021334084 7:19376834-19376856 CAGACTAGGACTAAAAAGGGTGG - Intergenic
1022898671 7:34779788-34779810 CAAATTATGACAAAACATGGTGG + Intronic
1023583069 7:41701984-41702006 CAGAAAATGAAAAAGAGGGGAGG - Intronic
1025196804 7:56940427-56940449 CAGATGCTGATAAAAAGGAGAGG + Intergenic
1025675144 7:63636510-63636532 CAGATGCTGATAAAAAGGAGAGG - Intergenic
1030794306 7:113769388-113769410 CAGCTAATGACAAAAGGGGGAGG - Intergenic
1037620799 8:20561886-20561908 CAGATTATGTCATAAAAAGGAGG - Intergenic
1039158105 8:34585867-34585889 CAGAGTTTGACAAAAAGTGGTGG + Intergenic
1040759372 8:50820316-50820338 ATGATTATTACAAAAGGGGGTGG + Intergenic
1041053059 8:53956231-53956253 CAGATTGTGCCAGAAAGGGAGGG + Intronic
1041573788 8:59369755-59369777 CAGTTTATGAGAAATATGGGGGG + Intergenic
1042642161 8:70948494-70948516 CAGATTCTCACAAAACTGGGTGG - Intergenic
1043912721 8:85881719-85881741 CAGATATTGACAATAAGGGGTGG - Intergenic
1045149846 8:99392225-99392247 GAGAGTATGAGAGAAAGGGGAGG - Intronic
1047778510 8:128092758-128092780 AAGATTTTGACAAAGAGGAGGGG - Intergenic
1048014572 8:130485933-130485955 CAGATTATGACTTTAAAGGGAGG - Intergenic
1048928632 8:139292903-139292925 CAGCATATGACATAGAGGGGTGG - Intergenic
1050734067 9:8743099-8743121 CAAATTAAAAAAAAAAGGGGGGG + Intronic
1052642998 9:31193372-31193394 CAGATTAGCACAGAAAGGAGAGG + Intergenic
1056397803 9:86197345-86197367 CGGAATAGGACAAAAAGGAGGGG + Intergenic
1056887231 9:90455151-90455173 CAGATTTTGGCAAAAGGGAGAGG + Intergenic
1057668938 9:97071341-97071363 TAAATTATGACAAAAAGGCCTGG - Intergenic
1058728342 9:107825072-107825094 CAGATTATGGCAAAACGGCTAGG + Intergenic
1059126425 9:111690893-111690915 CAGGATAGGAGAAAAAGGGGAGG - Intronic
1059356332 9:113702188-113702210 CAGAACAAAACAAAAAGGGGTGG + Intergenic
1061342073 9:129990545-129990567 CAGATGATGTCAGAAAGGTGTGG + Intronic
1190227604 X:48558271-48558293 CAGACGATGACAAAAAGGTTTGG - Intronic
1191865852 X:65703160-65703182 CATAATATGGCTAAAAGGGGAGG + Intronic
1195485784 X:105404521-105404543 CAGAATAGGAAAAAAAGGGGAGG - Intronic
1197702027 X:129606738-129606760 AAGAGCCTGACAAAAAGGGGTGG - Intergenic
1199966290 X:152823700-152823722 CAGAGTTGGAGAAAAAGGGGAGG - Intergenic
1201706996 Y:16948655-16948677 TACATTATTAAAAAAAGGGGGGG - Intergenic
1201725675 Y:17148717-17148739 CAGATTATGAGAAAAAGCATAGG + Intergenic
1201757261 Y:17499637-17499659 CAGAAGATAACAAAAAGGGATGG - Intergenic
1201844293 Y:18406345-18406367 CAGAAGATAACAAAAAGGGATGG + Intergenic