ID: 946115293

View in Genome Browser
Species Human (GRCh38)
Location 2:217456061-217456083
Sequence TACTCTCTCAAGTCTATGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946115291_946115293 -10 Left 946115291 2:217456048-217456070 CCTCTGGGCAGTTTACTCTCTCA 0: 1
1: 0
2: 1
3: 15
4: 159
Right 946115293 2:217456061-217456083 TACTCTCTCAAGTCTATGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946115293 Original CRISPR TACTCTCTCAAGTCTATGTT GGG Intronic
905493901 1:38369426-38369448 TACTCCCTCAATTCTATCTTTGG + Intergenic
906800927 1:48736173-48736195 TACTCTGTCAAGAATGTGTTAGG - Intronic
908598048 1:65709344-65709366 CACTCTCTCAACCCTATTTTAGG + Intergenic
908808118 1:67951753-67951775 TGCTCTTTCAAGTCTCTGGTTGG - Intergenic
909781824 1:79558011-79558033 TTCTCTTTCAAGTTTATTTTGGG - Intergenic
909985761 1:82158898-82158920 TACTATTTCAAGTTTATGTTTGG + Intergenic
912794251 1:112681525-112681547 TACTCTCTCAACTGTGTGATGGG + Intronic
917037588 1:170765793-170765815 TACTCTGTCAATTCTATAATGGG - Intergenic
923893633 1:238243275-238243297 TACTCTTTCAAGCATATGTATGG - Intergenic
924623280 1:245680560-245680582 TTCTCTCTCAATTCTGTCTTTGG + Intronic
1063737960 10:8782792-8782814 TTCTCCCTCTAGTCAATGTTTGG - Intergenic
1063738065 10:8784372-8784394 TACTCAGTCAAGTCTATGTGTGG - Intergenic
1064946365 10:20794268-20794290 TCCTCTCTCAAGCCAATGCTAGG + Intronic
1065882321 10:30047441-30047463 AACTCTTTCAAATCTATATTTGG - Intronic
1066115004 10:32231964-32231986 TTGTCTTGCAAGTCTATGTTTGG + Intergenic
1068164955 10:53318141-53318163 TACTCTGTCAAGCAAATGTTGGG + Intergenic
1070623965 10:78035701-78035723 TACTCTTGCAAGTCTATGTTTGG - Exonic
1071011567 10:80946374-80946396 TACTCACTCAAGTCTTTGTAAGG + Intergenic
1071519755 10:86322291-86322313 TATTCTCTCAGGTCTCTTTTTGG - Intronic
1071849359 10:89552733-89552755 TACTCTCTCCAGATTCTGTTAGG - Intronic
1072686345 10:97539675-97539697 TACTCCCTCAAGCCTTTCTTGGG + Intronic
1076543234 10:131227506-131227528 TGCTATCTCAGGTCTATATTAGG - Intronic
1077379556 11:2223298-2223320 TACAATCTCAAGTCTCTGATGGG - Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1080405541 11:31975638-31975660 TACTCTGTGATGTGTATGTTAGG + Intronic
1082272863 11:50191100-50191122 TTCTCTCTCTAGTCTATATCTGG - Intergenic
1089870047 11:121664533-121664555 TTCTCTCTGACATCTATGTTTGG - Intergenic
1090149235 11:124364761-124364783 TACTCTCTCAAGTATGCTTTTGG - Intergenic
1090153284 11:124408306-124408328 TATTCTCTCTCCTCTATGTTTGG - Intergenic
1095258510 12:40070501-40070523 TCCTTTCTCAAGTCTATTTTAGG + Intronic
1099871460 12:88354873-88354895 GACTCCCTCAAATCTATCTTTGG - Intergenic
1100088483 12:90939699-90939721 GAACCTCTCAACTCTATGTTTGG - Intronic
1100953673 12:99881618-99881640 TCATTTCTCAAGTCTTTGTTAGG - Intronic
1101331103 12:103758597-103758619 TGCTTTCTCAAGCCTCTGTTTGG + Intronic
1102359036 12:112267687-112267709 TACTTTCTCAAGTGTTTTTTTGG - Intronic
1102926658 12:116831629-116831651 TACTCTAACAATTCTATGTCTGG - Intronic
1108164782 13:47680862-47680884 TACTCTCTCGAATGAATGTTAGG - Intergenic
1108245768 13:48511866-48511888 TTTTCTCTCAGGTCTATGTCTGG - Exonic
1108897798 13:55356659-55356681 TACTCTCACAAATTTATCTTAGG + Intergenic
1111502709 13:89143457-89143479 TTCTCACTCAAGTATTTGTTTGG - Intergenic
1114703385 14:24701461-24701483 TACTCTGTTAAGTCTCTGATTGG + Intergenic
1115634336 14:35276891-35276913 TATTCTCTCAGGGCTCTGTTGGG + Intronic
1116758655 14:48982274-48982296 TGCTGTCTTAAATCTATGTTTGG - Intergenic
1120346073 14:83291923-83291945 TAGTCACTGAAGTCTATTTTTGG - Intergenic
1120407775 14:84110277-84110299 TCCTCTCTCTAGTGCATGTTTGG - Intergenic
1120749735 14:88186516-88186538 TGGTCACTCAAGTGTATGTTGGG - Intronic
1122484149 14:102066621-102066643 TGACCTCTCAAGTCTTTGTTAGG + Intergenic
1122992740 14:105245790-105245812 TACAGTTTCAAGTCTGTGTTTGG - Intronic
1124547138 15:30640389-30640411 TACTCTCTGAAGGCTCTGGTTGG - Intronic
1124780737 15:32630351-32630373 TACTCTCTGAAGGCTCTGGTTGG - Intronic
1126866164 15:52939451-52939473 AAGTCTCTCAAGTCTATTTTAGG + Intergenic
1127354049 15:58181139-58181161 TGCTCTGTTAAGTATATGTTAGG + Intronic
1128229061 15:66022247-66022269 TACTCTCTCAGCTCCATGTAAGG + Intronic
1130208688 15:81902470-81902492 TCCTATTTCATGTCTATGTTTGG - Intergenic
1131179730 15:90231559-90231581 TGCTCTCTCAAGTTTCTGGTAGG - Intronic
1133878272 16:9756019-9756041 TCCTATTTCATGTCTATGTTTGG - Intronic
1138308918 16:56006473-56006495 GACTTTCTCATGTCTTTGTTGGG + Intergenic
1141613943 16:85199675-85199697 TTCTCTCTGAAGTCTAAGTTTGG + Intergenic
1143962662 17:10733536-10733558 CACTCTCTCCAGTCTGTGTGAGG - Intergenic
1144534127 17:16070576-16070598 TTCTATCTCAGGTCTATGTCTGG + Intronic
1150059842 17:62057520-62057542 TACTCTCTTTAGACTATGTGGGG + Intronic
1152224233 17:79085373-79085395 CCCTCACTCAAGTCTCTGTTGGG + Intronic
1156809929 18:41235848-41235870 AATTCTCTAAAGTCTATGTCAGG - Intergenic
1157309294 18:46540089-46540111 TACTCCCTCAAGTCATTGTGAGG - Intronic
930385289 2:50686927-50686949 AATTCTCTAAAGTTTATGTTGGG + Intronic
930794859 2:55378318-55378340 TACGCTATGAAGTCTATGTTTGG + Intronic
931504887 2:62914524-62914546 TAATCTCCCCAGTCAATGTTAGG + Intronic
931805077 2:65796498-65796520 TCCTCTTTCAAGTCTCTGTCAGG + Intergenic
933549543 2:83758420-83758442 TAGTCTCACATGTCTATTTTTGG + Intergenic
937442060 2:121924422-121924444 TACTCTATCAAGTTTCTGTCTGG + Intergenic
941504081 2:166318438-166318460 TAGTCTTTCAATTTTATGTTTGG - Intronic
942314722 2:174687223-174687245 TACTGTCTTAAGTCTTTTTTTGG - Intergenic
946115293 2:217456061-217456083 TACTCTCTCAAGTCTATGTTGGG + Intronic
1177131747 21:17265855-17265877 TCTTCTCTCTAGTCTTTGTTAGG - Intergenic
949360446 3:3226805-3226827 TACTTTCTGAAGTTTATATTTGG + Intergenic
950521966 3:13502606-13502628 CACCCTCTCAAGTCTGTGGTGGG - Intronic
953695995 3:45159895-45159917 AAGTCTTGCAAGTCTATGTTTGG + Intergenic
955543280 3:60000631-60000653 TTTTCTCTCATGTCTATCTTAGG - Intronic
956174933 3:66464055-66464077 TTCTTTCTCAAGTCTAAGTTGGG - Intronic
957577844 3:82032250-82032272 TACTCCCTCAAGTCTATGGGTGG + Intergenic
957954009 3:87160602-87160624 TTCTTTCTCAAGACTTTGTTGGG + Intergenic
959911963 3:111773392-111773414 GACCCCCTCAAGCCTATGTTGGG - Intronic
960791245 3:121433550-121433572 TACTCTCTGAAGTCCACTTTGGG - Intronic
961061155 3:123830483-123830505 TATTCCCTCAAGTCAATGATGGG + Intronic
961495848 3:127290645-127290667 TATTAACTAAAGTCTATGTTTGG + Intergenic
964086628 3:152826858-152826880 GACTTTGTAAAGTCTATGTTGGG + Intergenic
964261647 3:154845837-154845859 TTCTCTGGCTAGTCTATGTTGGG - Intergenic
965017928 3:163183843-163183865 TACTCTATCAAGTACAGGTTAGG - Intergenic
965136550 3:164779118-164779140 TATTCTCTCTATTTTATGTTAGG + Intergenic
970141913 4:12992418-12992440 TACTGTATCATTTCTATGTTTGG + Intergenic
971987943 4:33851014-33851036 CACTATCTCACGTATATGTTTGG - Intergenic
974248895 4:59359872-59359894 CAGTCTCTGAAGTCTAGGTTGGG - Intergenic
974768335 4:66377878-66377900 TACTCTATAAAGTCTATGACAGG - Intergenic
977096056 4:92746010-92746032 TATTCTCTCATGTTTATGTAAGG - Intronic
977276953 4:94989506-94989528 TACTCTATCAGATCAATGTTAGG - Intronic
978264917 4:106812160-106812182 TACTCTATCAATTCCATTTTTGG + Intergenic
978531618 4:109720730-109720752 TACTCTCTTGAGGCTATGTATGG - Intronic
980634208 4:135477737-135477759 TTCTTTCTCAAATCTATGTTGGG - Intergenic
981566660 4:146108630-146108652 TACTCCCTCAATTTTATTTTTGG + Intergenic
989169772 5:38462602-38462624 TCCTCTCTCTAGTCTAAGTTAGG + Intronic
990433035 5:55756347-55756369 TACACTCTGAAGTCTCTATTTGG + Intronic
990793765 5:59516208-59516230 TGCTCTGGCAAGTCTATGTATGG - Intronic
991249366 5:64542895-64542917 GACTCTGTGAAGTCAATGTTTGG + Intronic
992179470 5:74182716-74182738 TACTGTCTCAAGTCTAACATAGG - Intergenic
992880055 5:81098840-81098862 TAGTCTCTCAAGTGTATCTCTGG + Intronic
993710639 5:91221329-91221351 CACACTGTCAAGTCTATGTTGGG - Intergenic
993892347 5:93489740-93489762 TCCTGTCTCAAGTACATGTTTGG + Intergenic
994474188 5:100246388-100246410 TACTCTGTGGTGTCTATGTTAGG - Intergenic
995246127 5:109937602-109937624 TCCTGTCTCAGGTCAATGTTTGG + Intergenic
998120920 5:139576822-139576844 TAGTCTCTCATGTCTAGTTTTGG + Intronic
1000373272 5:160557150-160557172 TAGTTACTCATGTCTATGTTGGG - Intergenic
1000567088 5:162862179-162862201 TAATCTGTCAAGTCTCTGTAAGG - Intergenic
1000719329 5:164687095-164687117 CACTCTCTCAAGTGTATTTATGG - Intergenic
1008310767 6:49970214-49970236 CATTCTCTCAACTGTATGTTGGG + Intergenic
1012680889 6:102177486-102177508 TACTCTCTCACGTATATCTGAGG + Intergenic
1013938758 6:115634140-115634162 ATCTCCCTCAAATCTATGTTGGG - Intergenic
1028798489 7:94932545-94932567 TACTCTCTCAATTTTAAGATAGG - Intronic
1031184199 7:118455135-118455157 TACTCATTCAAGTCTAGTTTAGG + Intergenic
1031269296 7:119625764-119625786 TACATTCTCCACTCTATGTTTGG - Intergenic
1035062849 7:156082020-156082042 TGCTCTCTCCAGTCTCTGTCAGG - Intergenic
1036551530 8:9819561-9819583 TACCCTCCCAAGTCTAAATTAGG + Intergenic
1037602846 8:20412675-20412697 TACTCTCTCAAGGCTGGGTCAGG + Intergenic
1042939876 8:74096835-74096857 TTCTCTCTCAAGCCTTTGATCGG + Intergenic
1047330154 8:123879750-123879772 CACTCACTGAAGTATATGTTGGG + Intronic
1047909039 8:129506825-129506847 TACTTTCTCAAGTCTTTATTGGG - Intergenic
1048535093 8:135285958-135285980 TATTGTCTGAAGTCTATGATAGG + Intergenic
1058099656 9:100904890-100904912 TACTCTTTTATGTCTTTGTTAGG + Intergenic
1058342394 9:103914101-103914123 TACTTACTCATGTCTATGTTTGG + Intergenic
1059809103 9:117836212-117836234 AACTCTCTCTAGTCTCTGGTTGG + Intergenic
1186881970 X:13875392-13875414 TTCTCTTTCAAACCTATGTTAGG - Intronic
1187021831 X:15391388-15391410 TATTTTCTAAAGTCTGTGTTTGG + Intronic
1194002302 X:88445594-88445616 TACTATATAAAGACTATGTTTGG - Intergenic
1194947116 X:100082339-100082361 TATTCTCTGAAGACTATATTTGG + Intergenic
1197702155 X:129607656-129607678 TACACTCTCAAATCTTTGCTTGG + Intergenic