ID: 946115496

View in Genome Browser
Species Human (GRCh38)
Location 2:217458427-217458449
Sequence AAGGAGAATAAGAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1544
Summary {0: 1, 1: 0, 2: 10, 3: 136, 4: 1397}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946115496_946115500 5 Left 946115496 2:217458427-217458449 CCAGCCTCTTTCTTATTCTCCTT 0: 1
1: 0
2: 10
3: 136
4: 1397
Right 946115500 2:217458455-217458477 TTTGGTTTCACAGCATACTTTGG 0: 1
1: 1
2: 3
3: 20
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946115496 Original CRISPR AAGGAGAATAAGAAAGAGGC TGG (reversed) Intronic
900005629 1:47555-47577 AAGGAAAAAAAGAAAAATGCAGG - Intergenic
900330343 1:2131120-2131142 AAGGAAAATGAGTGAGAGGCGGG - Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900784033 1:4636501-4636523 GAGGAGAAAAAGAAAGATGACGG + Intergenic
900955184 1:5882450-5882472 AAGGAGAAAGAACAAGAGGCGGG - Intronic
900994134 1:6111235-6111257 AAAAAGAAAAAGAAAAAGGCCGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901179551 1:7331845-7331867 AAGCAGAATAAGAAGGACGAGGG - Intronic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901519065 1:9768922-9768944 AAGGAGAAAGGGAAAGAGGGAGG + Intronic
901520342 1:9779040-9779062 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
902653105 1:17849599-17849621 AAGGATAAAAAGTAAGAGACAGG - Intergenic
903170836 1:21552141-21552163 AAGGAGAAAAGGAAGGAGGGAGG - Intronic
903286185 1:22278198-22278220 AAGGAGCAAGAGAAAGAGGATGG + Intergenic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
903524647 1:23983903-23983925 AAAGAAAAGAAGAAAGAGGCCGG - Intergenic
904104715 1:28069575-28069597 AAGAAGAAAAAAAAAGAGGGTGG + Intronic
904107472 1:28098006-28098028 AAGGAGAAGAAGAAGAAGACTGG - Intergenic
904139640 1:28342462-28342484 AAGAAAAAAAATAAAGAGGCTGG - Intergenic
904165291 1:28550712-28550734 AAAGAAAAGAAAAAAGAGGCTGG + Intergenic
904295757 1:29518833-29518855 AAGGAGGAGAAGGAAGAAGCAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904327249 1:29734889-29734911 AAGGAAAATGAGAAAGAGTGGGG + Intergenic
904465680 1:30705938-30705960 CAGGAGAATAAGAATTAGGGAGG - Intergenic
904535231 1:31195064-31195086 AAAGAAAAAAAGAAAGAGTCAGG - Intronic
904560682 1:31395206-31395228 AAGAAGAAGAAGAAGAAGGCGGG - Intergenic
904586617 1:31584339-31584361 AAGGTGCAGAGGAAAGAGGCAGG + Intronic
904867696 1:33594492-33594514 AAGAGAAATAAAAAAGAGGCTGG - Intronic
904999871 1:34659669-34659691 AGAGAGCACAAGAAAGAGGCAGG - Intergenic
905123677 1:35702324-35702346 AAGGAGGCTCAGAAAGGGGCAGG + Intergenic
905215812 1:36406684-36406706 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
905362039 1:37427582-37427604 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
905541705 1:38765204-38765226 GTGGAGAATAAGAAAGAGTGGGG - Intergenic
905583784 1:39101878-39101900 AGAGAGAGAAAGAAAGAGGCTGG + Intronic
905618608 1:39420369-39420391 AAGAAAAATCAGATAGAGGCAGG - Intronic
906119418 1:43378678-43378700 CATGACAATAAGAAGGAGGCAGG + Intergenic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906477508 1:46179774-46179796 AAGGAGAAAAAGAAAAAGATGGG + Intronic
906783982 1:48597875-48597897 AAAGAAAAAAAGAAAGAGGGAGG + Intronic
906895767 1:49769516-49769538 AAGCAGAAAAAGAAAGAGCCAGG + Intronic
907188135 1:52627150-52627172 AAAGAGAGAAAGAAAGAGGAGGG - Intergenic
907327968 1:53653171-53653193 AAGGAGAAAGAAAAAGTGGCTGG + Intronic
907508065 1:54936442-54936464 AAGGAGGATAAAGAGGAGGCTGG - Intergenic
907743048 1:57185484-57185506 AGGGAGAAAAAGAGAGAGGCAGG + Intronic
907773904 1:57493725-57493747 AAGAAGAAAAAGAGGGAGGCAGG + Intronic
908083761 1:60608656-60608678 CAGGAGGATGAGAAAGAGCCTGG - Intergenic
908090419 1:60679718-60679740 AAGGTGAATAAGACAGAGGGAGG + Intergenic
908424373 1:63991570-63991592 AAGGAAAGACAGAAAGAGGCAGG + Intronic
908525046 1:64979862-64979884 AAGGACACTGAAAAAGAGGCAGG + Intergenic
908758232 1:67488515-67488537 AAAAAGAAAAAAAAAGAGGCTGG + Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908825655 1:68130525-68130547 AAGGTGAATAGGAGAGAGGTTGG - Intronic
908826075 1:68133996-68134018 AAGGAGAGAAAGAAATAGGGAGG + Intronic
908962931 1:69723478-69723500 AAGGAAAACAAGAAAGAAGTCGG - Intronic
909171512 1:72301888-72301910 AAGAAGAAAAAGAAAAAGGTGGG + Intergenic
909195112 1:72610424-72610446 AAGAAGAAGAAGAAAGAGATAGG - Intergenic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
909437451 1:75659402-75659424 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
909469526 1:76011634-76011656 AAAAAGAAAAAGAAACAGGCCGG + Intergenic
909665402 1:78126783-78126805 AAGCACAATGAGAAAGAGGGAGG + Intronic
909699776 1:78510415-78510437 AGAGAGAGTAAGAAAGAGGAAGG + Intronic
909888643 1:80974388-80974410 AAGAAGAATAAGAAATAGACAGG + Intergenic
910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG + Intergenic
910103185 1:83600113-83600135 AAGGAGAGAAAGAAAGGGGCGGG + Intergenic
910275695 1:85446811-85446833 AAGGAGAAGAAGAAAGGAGGAGG - Intronic
910660892 1:89671309-89671331 AAGGAGAAAAGGAAAGAGGAAGG + Intronic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
911014732 1:93320280-93320302 AAGCAGAATGAGCAAGAGGTGGG - Intergenic
911219263 1:95229989-95230011 AAAGAGAAAAAAAAAGAGGTAGG - Intronic
911663246 1:100527150-100527172 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
912039672 1:105372730-105372752 AAGGAGGAGAAGAAATAGGAAGG + Intergenic
912158534 1:106952270-106952292 AAGGAGGGTAAGAAAGAAGAAGG + Intergenic
912164568 1:107028123-107028145 AAGGAGAAAAAGAAAAAGAAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
912679128 1:111717610-111717632 AAGGAGAATGAGGAATGGGCAGG + Intronic
913163947 1:116168387-116168409 GAGGAGTAGAACAAAGAGGCGGG + Intergenic
913582741 1:120243060-120243082 GAGGAGCAGGAGAAAGAGGCAGG - Intergenic
913598632 1:120402568-120402590 AAAGAGAAAAAGAAAGAGAAAGG - Intergenic
913625432 1:120655300-120655322 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914088749 1:144477050-144477072 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
914198512 1:145463953-145463975 AAGAAGGATACGAAGGAGGCAGG - Intergenic
914245851 1:145885478-145885500 TAGGAGGACAAGAAAGGGGCCGG + Intronic
914258178 1:145977370-145977392 AAGGAGAGGAAGGAAGGGGCTGG - Intronic
914309863 1:146457153-146457175 AAAGAGAAAAAGAAAGAGAAAGG - Intergenic
914477620 1:148037082-148037104 AAGAAGGATACGAAGGAGGCAGG - Intergenic
914511102 1:148332833-148332855 AAGAAGGATATGAAGGAGGCAGG - Intergenic
914564671 1:148854554-148854576 GAGGAGCAGGAGAAAGAGGCAGG - Intronic
914592246 1:149115980-149116002 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
914608155 1:149275688-149275710 GAGGAGCAGGAGAAAGAGGCAGG + Intergenic
914685456 1:149974844-149974866 AGAAAGAAAAAGAAAGAGGCTGG - Intronic
914798880 1:150945201-150945223 TACGAGGATAAGAAAGAGGAAGG - Intronic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915151725 1:153838498-153838520 AGGGGGAAAAAAAAAGAGGCAGG - Intronic
915176456 1:154019628-154019650 AAAAAGAATAAAAAATAGGCCGG + Intronic
915177389 1:154027474-154027496 AGGGAGAATAAGGAAGTGCCAGG - Intronic
915270304 1:154749143-154749165 CAGGAGAGTAAGACAGAGCCAGG + Intronic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
915799901 1:158779343-158779365 GATGAAAATAAGCAAGAGGCTGG - Intergenic
915863206 1:159469793-159469815 AAGGAGAAAAAGAAAGAAAGGGG + Intergenic
916152151 1:161804673-161804695 AAGTAGAAAAAAAAAAAGGCAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916409106 1:164527264-164527286 AGGGATAAAAAAAAAGAGGCAGG - Intergenic
917635893 1:176935858-176935880 AAAGAGAGCAAGAAAGAGGGGGG - Intronic
917881589 1:179342296-179342318 AAAGAGAAAAAGAGAGAGGGAGG - Intronic
918105792 1:181413976-181413998 AAGGAGGATATTAAAAAGGCAGG - Intronic
918625507 1:186652354-186652376 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
918628729 1:186689602-186689624 AAGGAGAAGAACAAAGTTGCAGG + Intergenic
918730152 1:187983021-187983043 AAGGAGAACAAGAAGGATGAAGG + Intergenic
918974335 1:191462583-191462605 AAGTAGAATAAGGAAGAAGCAGG - Intergenic
919204928 1:194409619-194409641 AAGGATAATAAGAAAGTTTCAGG + Intergenic
919392962 1:197010533-197010555 AAGAAGAAAAAGAAAGAGAGAGG + Intergenic
919442104 1:197648638-197648660 AAGGAGAATAAAGAAGAGCCTGG - Intronic
919710429 1:200722018-200722040 AAGGAGAAGGTGAAATAGGCTGG + Intergenic
919888732 1:201954792-201954814 AAGAAGAGAAAGAAAGAGGCCGG + Intergenic
920080980 1:203372797-203372819 TAGGAAAGTAAGAAAGAGGCAGG + Intergenic
920081470 1:203376928-203376950 AAGGAGAAGAAGAGAGATGGGGG + Intergenic
920189222 1:204181775-204181797 AAGGAGAAGAGAAAAGAGGAAGG - Intergenic
920222805 1:204416658-204416680 AAAGAAAAGAAGAAAGAGGGAGG + Intergenic
920251970 1:204627934-204627956 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
920911985 1:210227544-210227566 AAGGAGGATAAGAAAGAAAGTGG + Intergenic
921131990 1:212227829-212227851 AAGGAGAGTGGGAAAGAGGCAGG + Intergenic
921391780 1:214622913-214622935 AGGGGGAAAAAGAAAAAGGCCGG + Intronic
921511659 1:216038493-216038515 AAATAGAATAAGAAAGTGGAGGG - Intronic
921813272 1:219538365-219538387 AAAGAGAAAAAGAAAGAAGGAGG - Intergenic
921824359 1:219655450-219655472 ATGGAAATTAAGCAAGAGGCAGG - Intergenic
922117773 1:222631101-222631123 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
922240834 1:223754750-223754772 ACGCAGAACAAGAAAGAGTCTGG + Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922595697 1:226811073-226811095 AAGGAGGAGAAGAGAGAGGTGGG - Intergenic
922653820 1:227363705-227363727 AAGTGGAAAAAGAATGAGGCCGG + Intergenic
922682958 1:227616172-227616194 AAGGAATACAAGAAAGAGGTGGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922722739 1:227906836-227906858 AAGGAGGATGAGGAAGAGGGAGG - Intergenic
922878509 1:228960719-228960741 AAAGAGACTAAGAAGAAGGCAGG + Intergenic
922943389 1:229489135-229489157 AAGAAGAAAAAGAAAAAGGAAGG - Intronic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923329267 1:232907481-232907503 AAGAAGAAGAAGTAAGGGGCTGG + Intergenic
923566512 1:235080506-235080528 AAAGAAAGAAAGAAAGAGGCTGG + Intergenic
923714243 1:236411512-236411534 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
923846354 1:237736967-237736989 AAGGAAATGAAGAAAGAGGGAGG + Intronic
923861451 1:237895907-237895929 GAAGAGATTAAGAAAGAGGTAGG + Intergenic
924005148 1:239600763-239600785 AAGGAAAAGAAGAAAAAGGAAGG - Intronic
924129034 1:240886593-240886615 AAGAAGAAAAAGAAAGAGAAAGG - Intronic
924165959 1:241283715-241283737 AAGGAGGAAAATAAAGAGGTTGG - Intronic
924171052 1:241341545-241341567 AAGGAGAAGAAGGAAAAGGAAGG + Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924494597 1:244575142-244575164 AAGGAAAATCAGAAAGAAACAGG - Intronic
924736472 1:246761369-246761391 AATAAGAAGAAAAAAGAGGCCGG - Intronic
1063010299 10:2015168-2015190 AAGAAGAATGAGAAAGAGAGAGG - Intergenic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063272642 10:4528640-4528662 AAGGAGATTAAGGAGGAGGAAGG + Intergenic
1063366158 10:5492294-5492316 AAGGAAAAAAAAAAAAAGGCAGG + Intergenic
1063373637 10:5538517-5538539 CAGGAGTAGAAGAAACAGGCCGG - Intergenic
1063396982 10:5697498-5697520 AAGCAGAATGAGAAAGTGCCTGG + Intronic
1063717736 10:8545266-8545288 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1063720332 10:8574120-8574142 AAGGGAAATATGAAAGAGGAAGG + Intergenic
1063889876 10:10618302-10618324 AGGGAGAGTAGGGAAGAGGCTGG - Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064272573 10:13878797-13878819 AAGGAGAGAAAGAGAGAGGGAGG + Intronic
1064464611 10:15566814-15566836 AAAAAGAAAAAAAAAGAGGCCGG + Intronic
1064880258 10:20044158-20044180 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
1064997092 10:21305621-21305643 AAAGAGGGAAAGAAAGAGGCCGG - Intergenic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065066148 10:21966991-21967013 AAGAAGAAGAAGAAAAAGGTGGG - Intronic
1065223359 10:23518531-23518553 AAGGAAAATAGGAAAGAAGGAGG - Intergenic
1065334157 10:24638159-24638181 AAGGAAAGTGAGCAAGAGGCCGG - Intronic
1065722764 10:28642498-28642520 TAGTAGAAGAAGAAAGAGGTAGG - Intergenic
1065782453 10:29182772-29182794 AAGGAGAGAAAGAGAGAGGGTGG - Intergenic
1065881390 10:30040483-30040505 AAGGCAAATGAGAACGAGGCTGG - Intronic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066404021 10:35102273-35102295 AAATAAAATAAGAAACAGGCTGG + Intergenic
1066507069 10:36056577-36056599 GAGGAGGGTAAGAAAGAGGATGG + Intergenic
1066513002 10:36122669-36122691 AAGAAGAGTAAGAAAAAGGGAGG - Intergenic
1066627940 10:37428347-37428369 AAGAAGAAGAAGAAAGAGAAAGG + Intergenic
1066705984 10:38178493-38178515 AAGGAAAATAAGCAAGAGTGGGG - Intergenic
1067299911 10:44998783-44998805 AAGGAGAATGGGAAAAAGACAGG - Exonic
1068099443 10:52533089-52533111 AGGGAGAGAAAGAAAGAGGGAGG - Intergenic
1068376068 10:56182735-56182757 AAGAAGAAAAAGAAAAAGGAAGG + Intergenic
1068724825 10:60289362-60289384 GGGGAGAAGAAGAAAGAGGGTGG - Intronic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1069285738 10:66713167-66713189 AAGGAGAATAAGATATGGGCGGG - Intronic
1069392896 10:67955473-67955495 AAAGAGTATAAGGAACAGGCTGG + Intronic
1069444291 10:68458550-68458572 AAAAAGAAGAAGAAAGAGGCTGG + Intronic
1069473114 10:68710632-68710654 AAGAAGAAGAAGAAAGGGCCAGG - Intergenic
1069817976 10:71210556-71210578 AAGGAGAGAGAGAAAGAGGTTGG + Intergenic
1069948504 10:72003366-72003388 CAGGAAAATTAGGAAGAGGCAGG + Intronic
1069950708 10:72016340-72016362 AAGAAGAAAAAGAAAGAGGAAGG + Intergenic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1070523247 10:77273217-77273239 AGGGAGAATAAGAGAGAGGCAGG - Intronic
1070785767 10:79161347-79161369 AGGGACAGTAAGAAAGAGGGTGG - Intronic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070906335 10:80076762-80076784 GAGGAGAAGAATAAAGAGGGTGG + Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071702965 10:87962055-87962077 AGGTAGAATAAGAAATAGGAAGG - Intronic
1072151090 10:92684677-92684699 AAGGAGAGAAGGAAAGAGACTGG - Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1072275274 10:93816681-93816703 AAGGAGAAAAGAAGAGAGGCAGG + Intergenic
1072761927 10:98063747-98063769 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1073953558 10:108840001-108840023 AAGAAGAATAGGAAGGAGACAGG + Intergenic
1074021350 10:109587599-109587621 ACGGAGAATAAGAGAAAAGCAGG - Intergenic
1074146222 10:110719851-110719873 AAACAGAATAAGACAGAGGTGGG - Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1074945862 10:118280010-118280032 AAGGAGAATAAGGAGGTGGAAGG - Intergenic
1074999778 10:118787178-118787200 AAGGAGGGAAAGACAGAGGCTGG - Intergenic
1075201203 10:120405754-120405776 AAGGAAAATGAGACAGAGACAGG + Intergenic
1075318570 10:121471258-121471280 AAAAAAAAAAAGAAAGAGGCCGG - Intergenic
1075365854 10:121888096-121888118 TATAAGAATAATAAAGAGGCTGG + Intronic
1075654751 10:124153402-124153424 AAGGGAAATAAGAAAGGGGGAGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076172877 10:128337531-128337553 AAGGAGTATTAGAACGAAGCTGG + Intergenic
1076232398 10:128832525-128832547 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076239053 10:128888783-128888805 AAGAAGGATGAGAATGAGGCAGG + Intergenic
1076372582 10:129964762-129964784 AAGGAGAAGTGGGAAGAGGCAGG + Intergenic
1076375365 10:129980102-129980124 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1076442344 10:130488606-130488628 AAGGGGATTGAGGAAGAGGCAGG + Intergenic
1076459469 10:130631014-130631036 AAGGAAAATAAGAAAGAAGTTGG - Intergenic
1076575319 10:131462323-131462345 AAGGAGAGAAAGACAGAGACAGG - Intergenic
1076584942 10:131540341-131540363 AAAAAGAAAAAGAAAGAAGCTGG - Intergenic
1077770464 11:5212806-5212828 AAAGAGAAAAAGAAAAAAGCTGG - Intergenic
1077893144 11:6434052-6434074 GAGGACAATAAGAAAGAGAAAGG - Intronic
1077992395 11:7423710-7423732 ATGGAGAATAAGAGAAAGGCCGG + Intronic
1077999390 11:7481378-7481400 AAGGTGAATAGGAAAAAGGTAGG - Intergenic
1078279118 11:9881824-9881846 AATAAGAAGAAGAAATAGGCTGG + Intronic
1078390434 11:10931638-10931660 AAGGAGAGAAGAAAAGAGGCAGG + Intergenic
1078459998 11:11507449-11507471 TAGGAGGAAAAGAAAGAGGTGGG - Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079388133 11:19998706-19998728 AAGGAGAAAAGGAGAGAGGGGGG - Intronic
1079623457 11:22584271-22584293 AGGGAGCAAGAGAAAGAGGCAGG - Intergenic
1079687070 11:23372808-23372830 AATGAGAAGAAGAAAGAGAAGGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1079959083 11:26900506-26900528 AAGAAGTAGAAGAAAGAGGTAGG - Intergenic
1080313651 11:30924056-30924078 AAGGAGGATAAGATGGAGCCAGG - Intronic
1080466678 11:32504006-32504028 AAGGAAAGAAAGAAAGAGACAGG + Intergenic
1080507671 11:32933055-32933077 CAGAAGAATAAGAAAGAGAAGGG - Exonic
1080585003 11:33674103-33674125 AGGTAGAATGAGAAACAGGCAGG - Intergenic
1080878208 11:36295884-36295906 TAGAAGACTAACAAAGAGGCAGG + Intergenic
1081362341 11:42195968-42195990 AGGGAGAAAAAGAAAGAGAAAGG - Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1081992436 11:47345164-47345186 AAGGAGGAAAAGATGGAGGCTGG - Intronic
1082756016 11:57077452-57077474 AAGAAGAAGAAAAAAAAGGCAGG + Intergenic
1083213247 11:61202550-61202572 AAGGAGCAAAAGAAAGAGAAGGG + Intergenic
1083392744 11:62366804-62366826 AAGGCTCATAAGAAAGAGCCAGG - Intronic
1083434120 11:62630994-62631016 AAAGAGCAGAAGAATGAGGCAGG + Intronic
1083478882 11:62930769-62930791 AAAGAGAAGAACACAGAGGCAGG - Intergenic
1083482395 11:62957992-62958014 AAAAAAAAGAAGAAAGAGGCTGG - Intronic
1083489166 11:63002204-63002226 AATAAAAATAAAAAAGAGGCTGG - Intronic
1083590051 11:63888526-63888548 AGGGAGACAGAGAAAGAGGCGGG - Intronic
1083687368 11:64384636-64384658 AGGGAGAATCAGAAAGAGTGGGG - Intergenic
1084078672 11:66803283-66803305 CTTGAGAATAAGAAACAGGCTGG + Intronic
1084565663 11:69927187-69927209 AAAAAGAAAAAAAAAGAGGCCGG + Intergenic
1085558116 11:77444222-77444244 TAGGAGAATAAGAAGGAAACTGG - Intronic
1085592241 11:77774753-77774775 AAGAAAAAAAAGAAAGAAGCAGG - Intronic
1085638179 11:78174078-78174100 AAGGAGCTTGAGGAAGAGGCAGG + Exonic
1085654214 11:78297661-78297683 AAGTAGAACAAGCAAAAGGCAGG + Intronic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1085810888 11:79680071-79680093 AAGGAGGAGAAGAAAGAGAAAGG - Intergenic
1085844513 11:80049995-80050017 AAGGAGCATAAGAAAAAGGAAGG + Intergenic
1085909999 11:80812041-80812063 AAGGAGAAAAAAAAAGAGAAAGG - Intergenic
1086075289 11:82844438-82844460 AAAGAAAGAAAGAAAGAGGCCGG + Intronic
1086092070 11:83014845-83014867 AAGGAAGAAAAGAAAGAGGAAGG + Intronic
1086257860 11:84900971-84900993 AAGAAGAATAAAAGAAAGGCTGG - Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086400460 11:86457244-86457266 AAGGAGAGTAAGAAATAGGGTGG - Intronic
1086923391 11:92613261-92613283 AATGAGGAGAAGCAAGAGGCTGG - Intronic
1087151294 11:94861965-94861987 ACGGAGGATAAGAACAAGGCTGG - Intronic
1088058292 11:105611207-105611229 AAGGAGAGAAAGGAAGAGGAGGG - Intronic
1088117195 11:106326200-106326222 AAAAAGAAAAAAAAAGAGGCAGG + Intergenic
1088139120 11:106594488-106594510 AAGCAGAAGAAGAAAAATGCAGG - Intergenic
1088419291 11:109624597-109624619 AAAGAGAATAAGAAAAATGGTGG + Intergenic
1088548392 11:110985196-110985218 AAGGAGAAGAATAAAGGAGCAGG + Intergenic
1088637411 11:111836308-111836330 AAGGAGAATAAGAAAAACACAGG + Intronic
1089248409 11:117138851-117138873 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
1089266107 11:117263101-117263123 AAGGAAAAAAAAAAAGTGGCTGG - Intronic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089597148 11:119587774-119587796 AGAAAGAAAAAGAAAGAGGCAGG + Intergenic
1090211788 11:124925902-124925924 AAGGATAATAATAACAAGGCTGG + Intronic
1090487380 11:127126027-127126049 ATGGAGATTTAGAAGGAGGCTGG - Intergenic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090537149 11:127655568-127655590 TAGGACAATAGGAAAGAGGTTGG + Intergenic
1090672998 11:128963486-128963508 AAAGAGAAAAAGGAAGAGGAGGG + Intergenic
1090815054 11:130285586-130285608 CAGAAGAACAAAAAAGAGGCTGG - Intronic
1091007546 11:131967148-131967170 CAGGTGAATATAAAAGAGGCTGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091456887 12:614545-614567 AAGGGGAAGAAGACAGAGGGAGG - Intronic
1091562288 12:1624088-1624110 AACGAAGAAAAGAAAGAGGCTGG + Intronic
1091729611 12:2870662-2870684 AAAAAGAAAAAAAAAGAGGCCGG + Intronic
1092119239 12:6032341-6032363 AAAGAAAAGAAAAAAGAGGCCGG + Intronic
1092225520 12:6745882-6745904 AAGCAGAATAACACAGAGGAGGG - Intergenic
1092362474 12:7848850-7848872 AAAAAGAAAAAAAAAGAGGCCGG - Intronic
1092588939 12:9932592-9932614 AAGGAAAAAAAGAAAGATGATGG - Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093169238 12:15840844-15840866 TAGGAAAAAATGAAAGAGGCTGG - Intronic
1093301030 12:17455326-17455348 AAAGAGAGGAAGAAAGAGACAGG - Intergenic
1093309034 12:17555744-17555766 ATGGGTAATAAGAAAAAGGCAGG - Intergenic
1093482802 12:19622681-19622703 AAGAAGAAAAAGAAAGAAGTGGG - Intronic
1093499791 12:19798727-19798749 AAAGAGAACAAGGAAGAGGGAGG - Intergenic
1093725909 12:22508339-22508361 AGGGAAAATAAGGAAGAGGATGG + Intronic
1093756167 12:22854278-22854300 AAGGAGAGAAAGAAAGAGGGAGG - Intergenic
1093819387 12:23594743-23594765 AAGGAGAATGATAAAGAGTCAGG - Intronic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094234382 12:28146846-28146868 GAGGAGAAGAAGAAAGAAGGAGG - Intronic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094469027 12:30785580-30785602 AAGGAGAAAAAAAAAGAGGCTGG + Intergenic
1094491651 12:30964372-30964394 AAAGAGAATAAGAAGGAAACGGG - Intronic
1094539154 12:31348595-31348617 AGGGAGACTAAGAAACAGTCTGG - Intergenic
1095108877 12:38268857-38268879 AGTGAGAATAAGAGAGAGGGAGG + Intergenic
1095298607 12:40556254-40556276 AAGGAGAGTAAGAATAAGGGTGG + Intronic
1095402824 12:41834704-41834726 ATGGAGAGTTAGAAAGAGCCTGG - Intergenic
1095548394 12:43400657-43400679 AATGAAGAAAAGAAAGAGGCAGG - Intronic
1095680339 12:44967366-44967388 AAATAAAAAAAGAAAGAGGCAGG + Intergenic
1095960162 12:47829214-47829236 AAGGAGAATGAGACAGAGAAGGG + Intronic
1096060637 12:48696434-48696456 AAGGAAAAAAGGAAAAAGGCTGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096089930 12:48892290-48892312 AAGGAGAAAGAGAAAGAGAGAGG - Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1096910273 12:54976539-54976561 AAGGAGGAAAAGAAGGAGGGAGG + Intronic
1097119673 12:56721474-56721496 AAGGAGATAAAGAAAGGGGGAGG + Intronic
1097163672 12:57069275-57069297 AAGGAAAACAAGAAAGAGTTTGG + Exonic
1097469892 12:59976399-59976421 AAGGAGAATGAAATAGAGACAGG - Intergenic
1097596326 12:61636855-61636877 ATGGATAATCACAAAGAGGCAGG + Intergenic
1097765612 12:63523390-63523412 AAAGAGAACAAGAAAGAGAGTGG + Intergenic
1098449293 12:70601295-70601317 ACGGAAAATAAGGAAGAGGCGGG - Intronic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1098884763 12:75949395-75949417 AAGAAAAAAAAAAAAGAGGCCGG - Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099183496 12:79493536-79493558 AAAGAAAAAAAGAAAGATGCAGG - Intergenic
1099342662 12:81457278-81457300 AAGGAAAAAAAAAAAAAGGCCGG - Intronic
1099780602 12:87190341-87190363 AAGATGAATAAGAACTAGGCTGG - Intergenic
1100022790 12:90090201-90090223 AAAGAGAAGAGAAAAGAGGCCGG - Intergenic
1100029111 12:90164238-90164260 CAGAAGAATAACACAGAGGCAGG - Intergenic
1100117500 12:91325172-91325194 AAGGAGAGGAAGAAAGATGAAGG + Intergenic
1100208850 12:92380466-92380488 AAAGTAAATAAGAAAGAGGTTGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100642665 12:96497337-96497359 AAGGAGAAGAAGAAAGTTGGAGG + Intronic
1101109681 12:101473518-101473540 AAGTTGGAGAAGAAAGAGGCAGG - Intergenic
1101423371 12:104567462-104567484 AAGGAAATAAAGGAAGAGGCAGG - Intronic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1102640044 12:114359096-114359118 AAGAATAATAAGAAAACGGCCGG + Intronic
1102669198 12:114602632-114602654 AAGGAAAAAAAGAAAAAGGAGGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1102984337 12:117266093-117266115 AAATAGAAAAAGAAAAAGGCCGG - Intronic
1103022988 12:117551309-117551331 AAAGAGGAGAAGGAAGAGGCAGG - Intronic
1103119451 12:118369025-118369047 AAGAAGAAGAAGAAAAAGCCAGG + Intronic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103361984 12:120359937-120359959 AAGGAGAGTAGGGAAGAGGCTGG - Intronic
1103410857 12:120710544-120710566 AAGGAGGAGAAGAAGAAGGCGGG + Exonic
1103748921 12:123145662-123145684 AAGGAGATTAACCAACAGGCAGG - Intronic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1105337720 13:19489045-19489067 AAGGAGAAGGAGAAAGATGGGGG + Intronic
1105726331 13:23165821-23165843 AAGTAGAATTTGAAACAGGCTGG - Intergenic
1105782053 13:23714352-23714374 CAGGAGAAGAAAAAAGAGGTTGG - Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1105967745 13:25399850-25399872 AAGAAGAAGATGAAAGAGGAGGG - Intronic
1105993970 13:25652474-25652496 AATAAGAATAAGGAAGAGGGAGG - Intronic
1105998053 13:25692001-25692023 AAAAAGAATATGAAAGTGGCAGG + Intronic
1106176073 13:27333033-27333055 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1106246487 13:27954356-27954378 AAGAAGAAAAAGAAAGTGCCCGG + Intergenic
1106295748 13:28412284-28412306 AAAGAGAAAAAGAAAGAGAAGGG - Intronic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1106885564 13:34181203-34181225 AAGGAAAAGAAGAAAGAGAAAGG - Intergenic
1107290259 13:38844270-38844292 AGAGAGAGAAAGAAAGAGGCGGG - Intronic
1107475669 13:40733399-40733421 AAGGAGAAAAAGAAAAAGATTGG + Intronic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107733838 13:43375241-43375263 AGGGAGAAAAAGAACGGGGCGGG + Intronic
1107893068 13:44930981-44931003 AAGAATAATAGGAAACAGGCTGG - Intergenic
1108035035 13:46281815-46281837 AAGAAGGATAAAAAAGAGCCTGG - Intergenic
1108464351 13:50699787-50699809 AAGAATAATAAGGAAAAGGCTGG - Intronic
1108477590 13:50836376-50836398 AAGGAAAGAAAAAAAGAGGCCGG + Intronic
1108639216 13:52366649-52366671 AAGGAGAATAAGAACGACAAAGG + Intergenic
1108829284 13:54456855-54456877 AGAGAGAGAAAGAAAGAGGCAGG - Intergenic
1108892969 13:55284796-55284818 AAGGAGAAGAAAGAAGAAGCAGG + Intergenic
1109384705 13:61611163-61611185 AAGGAAAAGAGGAAGGAGGCAGG - Intergenic
1109684448 13:65797433-65797455 AAGTAGTCTAATAAAGAGGCAGG + Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1109784496 13:67156284-67156306 CAGCAGAAGAAGATAGAGGCAGG + Intronic
1110306332 13:73991673-73991695 AAGTGGAATCAAAAAGAGGCAGG - Intronic
1110545432 13:76750217-76750239 AAGGAAAATATGAAAGGGGAAGG - Intergenic
1111276200 13:85950632-85950654 AAGGAGGAGAAGAATGAAGCTGG - Intergenic
1111797935 13:92946863-92946885 AAGGAGGAAAAGGAAGAGGGAGG + Intergenic
1111814014 13:93127916-93127938 AATGTGAATAAGAAAGTGGGGGG - Intergenic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112408946 13:99145752-99145774 AAGAAGAAGAAGAAAAATGCAGG + Intergenic
1112523239 13:100117818-100117840 AAAAAGAAAAAAAAAGAGGCCGG + Intronic
1112584511 13:100706311-100706333 AAAGAGAAGAAGAAAGAGAAGGG - Intergenic
1112876152 13:104041821-104041843 AATGTGAATATGACAGAGGCAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1113268550 13:108646142-108646164 AAGGAAAGTAAGAAAAAGGAGGG + Intronic
1113490241 13:110686015-110686037 AAAGAAAAAAAGAAAGAGGAGGG + Intronic
1113577780 13:111406157-111406179 AAGTAGAATAAGATAAAAGCTGG + Intergenic
1113694813 13:112337295-112337317 GAGGAGAATGAGGACGAGGCTGG + Intergenic
1113852793 13:113427523-113427545 AAAGAAAAGAAAAAAGAGGCCGG - Intronic
1113920387 13:113904895-113904917 AAGGTGATAAAGAAAGAGGAAGG + Intergenic
1114353515 14:21881427-21881449 AAGGAAAAAAGGAAAGAGGAGGG - Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1114657675 14:24325813-24325835 AAGGAGATGGAGAAAGAGGTGGG - Exonic
1114941026 14:27610990-27611012 AAAGAGAAAAATAAAAAGGCGGG + Intergenic
1114994644 14:28332673-28332695 AAGAAGAATAAGAAAGACAAAGG + Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115305714 14:31931508-31931530 AAAGAAAGAAAGAAAGAGGCCGG - Intergenic
1115696758 14:35907697-35907719 AAGGAGAAAAGAAAAGAGGCTGG + Intronic
1116073437 14:40080018-40080040 TAGGAGAGTGAGAAAGAGGAGGG - Intergenic
1116215669 14:42014099-42014121 AAGGAGAAAGAGAAAAAGGATGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116624677 14:47249311-47249333 AAAGAAAGAAAGAAAGAGGCCGG - Intronic
1117087533 14:52217046-52217068 AAAGAGAAGAAGAAAGTTGCAGG - Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117753789 14:58952779-58952801 AAGGAGAAAAAGAGAAAGGTAGG - Intergenic
1117874557 14:60238840-60238862 AAGGAGAGTATGATATAGGCAGG - Intergenic
1117960998 14:61161419-61161441 AAAGAGGAAAAGAAAGAGGCAGG + Intergenic
1118275312 14:64381301-64381323 AAAGAGAAGAAGAAATAGGCCGG + Intergenic
1118397286 14:65348304-65348326 AAGGAGATTGTGAAACAGGCAGG + Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118693940 14:68365235-68365257 AAGTAGAATAAAGAGGAGGCAGG + Intronic
1118767721 14:68921322-68921344 AAGCAGAAGAAAGAAGAGGCAGG - Intronic
1118899614 14:69975472-69975494 AAGAGGAATAAGAGAGAAGCAGG + Intronic
1119321397 14:73733218-73733240 AAGGTGAATCAGAAATAGGCTGG + Intronic
1120147411 14:80994042-80994064 AAGGAGGAAAAGGAAGAGGAGGG - Intronic
1120188633 14:81420002-81420024 AAGGGGAATAAGAGACAGGTGGG - Intronic
1120592740 14:86394986-86395008 AAGAAAAAAAAGAAAAAGGCTGG + Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1120848894 14:89150782-89150804 CAGGAGAAGAAGACAAAGGCTGG + Intronic
1120899909 14:89566867-89566889 AAGGAGGGTAAGGAAGAGGAGGG - Intronic
1120925332 14:89792298-89792320 AAGGGGAATAAGGAAAAGGCAGG + Intergenic
1121232713 14:92369444-92369466 AATGAGAAGAAGAAAAAGGTTGG + Intronic
1121385392 14:93517240-93517262 GAGGAGAAAAAGAAAGAGAAAGG - Intronic
1121805885 14:96822075-96822097 AAGGAAAAAAAAAAAAAGGCAGG - Intronic
1122020438 14:98833641-98833663 AAGGAAAGAAAGAAATAGGCTGG + Intergenic
1122038161 14:98963298-98963320 AAGGAGAAGGAGAAAGAAGAAGG + Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1122825815 14:104369886-104369908 AAGGAGAGAAGGAAAGAGTCTGG - Intergenic
1124459636 15:29877623-29877645 AAAGAGAAGAAGAAAGAAGAAGG - Intronic
1124463111 15:29911347-29911369 CAGCAGAAGAAGGAAGAGGCAGG + Intronic
1124622491 15:31282122-31282144 AAGAAGAGGAAGAGAGAGGCTGG - Intergenic
1125127947 15:36246453-36246475 AAGAAGAGTAAGAAAAAGGGTGG + Intergenic
1125184164 15:36911486-36911508 AATGAGAAGAGGAAAGAGACAGG + Intronic
1125556516 15:40590204-40590226 AAAGAAAGAAAGAAAGAGGCTGG - Intergenic
1126052331 15:44697311-44697333 AAGGAGAAGAAGGAAGAAGAAGG - Intronic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126420037 15:48462608-48462630 AACAAGAATAAGAAAGAGCCAGG - Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127150569 15:56070676-56070698 AAGGAGAAGAACAAAGATGGAGG + Intergenic
1127176558 15:56364447-56364469 AAAGAAAAGAAAAAAGAGGCTGG - Intronic
1127364303 15:58272916-58272938 AAATATATTAAGAAAGAGGCTGG - Intronic
1127688911 15:61375787-61375809 GAGGAGAATCAGAAAGGGCCAGG - Intergenic
1127798317 15:62456832-62456854 AAGCAGAATGAGACAGAGCCAGG - Intronic
1127871716 15:63079560-63079582 AAGGGGTACAAGAAAGAGCCGGG - Intergenic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128112834 15:65087326-65087348 AAGAAGAATAAGAAAAAGAGTGG - Intergenic
1128160435 15:65420241-65420263 GAGGAAAGTAAGAAATAGGCCGG - Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128413684 15:67423885-67423907 AAGGAGAGTGAGAAAGAGAAAGG + Intronic
1128682254 15:69660610-69660632 AAAGAAGAAAAGAAAGAGGCCGG + Intergenic
1129683499 15:77671593-77671615 AGGGAGAATAGGAAGGAGACCGG - Intronic
1129803293 15:78433375-78433397 AATGAGAATAAGAAATAGCCAGG + Intergenic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131139772 15:89967750-89967772 AAGAAGAAGAAGAAAGCAGCCGG + Intergenic
1131278622 15:91003153-91003175 CAGGTGCATGAGAAAGAGGCCGG + Intronic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1131860354 15:96646604-96646626 AAAAAGAAAAAGAAAAAGGCAGG - Intergenic
1132023280 15:98383035-98383057 AAGGAAATCAAGAAAGAGCCAGG + Intergenic
1132345543 15:101106386-101106408 AGGGAGAGAAAGAATGAGGCCGG + Intergenic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1132447886 15:101943367-101943389 AAGGAAAAAAAGAAAAATGCAGG + Intergenic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1132872284 16:2121068-2121090 AAGGAGAAGGGGAAAGAGCCGGG + Intronic
1133064386 16:3195730-3195752 AAACAGAAAAAGAAAGAGGGTGG - Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133250821 16:4479707-4479729 AAATAGAATAAGAAAAAGGCAGG - Intronic
1133647206 16:7775433-7775455 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
1133756057 16:8763376-8763398 AAGCAGAAAAAGCAAGAGGTAGG + Intronic
1133931465 16:10235756-10235778 CAGCAGAGTAAGAAAGAGTCTGG - Intergenic
1134326232 16:13210362-13210384 ATTGAGTATAAGAAAGAGACAGG + Intronic
1134429975 16:14194343-14194365 AGGGAGAGAAAGAAAGAGGGAGG + Intronic
1134523538 16:14928877-14928899 AAGGGGGATAAGAAAGATGAGGG - Intronic
1134549354 16:15132043-15132065 AAGGGGGATAAGAAAGATGAGGG + Intronic
1134551333 16:15140147-15140169 AAGGAGAAGGGGAAAGAGCCGGG + Intergenic
1134711132 16:16327361-16327383 AAGGGGGATAAGAAAGATGAGGG - Intergenic
1134718982 16:16370662-16370684 AAGGGGGATAAGAAAGATGAGGG - Intergenic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1134948442 16:18341222-18341244 AAGGGGGATAAGAAAGATGAGGG + Intergenic
1134955699 16:18381332-18381354 AAGGGGGATAAGAAAGATGAGGG + Intergenic
1135037818 16:19092951-19092973 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1135159640 16:20082459-20082481 AGGGAGAATAAGAAAGGAGAAGG + Intergenic
1135405899 16:22197567-22197589 GAAAAGAAAAAGAAAGAGGCAGG + Intergenic
1135460929 16:22642275-22642297 ATGGTGAACAAGAAAGATGCAGG - Intergenic
1135467329 16:22698325-22698347 ATGGAGATTAAGAGATAGGCTGG - Intergenic
1135471741 16:22737248-22737270 AAGGAAAAAAGAAAAGAGGCTGG + Intergenic
1135647339 16:24174636-24174658 AAGCAGCTGAAGAAAGAGGCAGG - Intronic
1135694089 16:24572299-24572321 AAGAAGCATAAGAAACATGCAGG + Exonic
1136178563 16:28535282-28535304 AAGGAGGGAAAGAAAGAGGAAGG - Intronic
1136361273 16:29781333-29781355 AGGAAGAAAGAGAAAGAGGCTGG + Exonic
1136403340 16:30030161-30030183 ACGGGGAAGAAGAGAGAGGCGGG + Intronic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1136539093 16:30918682-30918704 AAGGAGAAGAAGGAAGAAGAAGG - Intergenic
1136555650 16:31006355-31006377 AGGGAGGATGAGAAAGGGGCAGG - Intronic
1137289978 16:47045828-47045850 AAAGAGAGAAAGAAAGAGGTAGG - Intergenic
1137459528 16:48647916-48647938 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1137843979 16:51668987-51669009 AAGGAGAAAAAGAGAGAGAGAGG + Intergenic
1137862814 16:51863825-51863847 AAGCAGAAAAAGGAAGAGACCGG - Intergenic
1137934091 16:52617218-52617240 ATGGAGAAAAAGAAAAAGCCAGG + Intergenic
1138087151 16:54143538-54143560 AAAGAGAAGAAGGAAGAAGCAGG + Intergenic
1138103595 16:54274464-54274486 AGAGAGAATAAGAGAGAGGAAGG - Intergenic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1138609625 16:58112359-58112381 AAAGAGAAAAAGAAAAAAGCAGG + Intergenic
1138650979 16:58461356-58461378 AAGGTGCATAAGGAAGAGGTAGG - Intergenic
1138735467 16:59246009-59246031 AAGGAGAATAAGAAGATAGCAGG + Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139165570 16:64561397-64561419 AAGGAGAAGAAGAAAGAAGGAGG + Intergenic
1139168855 16:64605751-64605773 AAGGATAATAAGAAAAAAACAGG + Intergenic
1139264446 16:65625839-65625861 AAGGAAAAAAAAAAAAAGGCTGG + Intergenic
1139605167 16:68013104-68013126 AAGAGGAGGAAGAAAGAGGCTGG + Intronic
1139628664 16:68213093-68213115 AAGAAGAGAAAGAAACAGGCCGG - Intronic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1139715154 16:68807371-68807393 AAGAAAAATATAAAAGAGGCTGG + Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1140146347 16:72314043-72314065 AGGGAGCACAAGAAACAGGCTGG + Intergenic
1140153146 16:72392903-72392925 AAAGAGAATGAGAAAAAGGATGG + Intergenic
1140288701 16:73629569-73629591 AATGAGAAGAAGATGGAGGCTGG + Intergenic
1140574675 16:76152721-76152743 AAGGAGAAAAAGAGAGATGGAGG + Intergenic
1140777663 16:78264902-78264924 AAGGAGAAAAAGAAAAAGAAAGG - Intronic
1140871307 16:79109124-79109146 AATGAGAACAATATAGAGGCAGG + Intronic
1141066005 16:80914584-80914606 AAAGAGACCAAGCAAGAGGCCGG + Intergenic
1141302691 16:82832446-82832468 AAGGAGGATGAGAAGGAGGAAGG - Intronic
1141372406 16:83500367-83500389 AAGAAGAAGAAGAAAGAAGAAGG - Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141535267 16:84674942-84674964 GAGGAGAAGAAGGAAGAGGAGGG - Intergenic
1141603089 16:85137849-85137871 AAGAAGAAAAAGAGAAAGGCAGG - Intergenic
1141773018 16:86102304-86102326 AAGGAGGAAAAGAGAGAGGGAGG - Intergenic
1141789279 16:86223083-86223105 AATTAGAAAAAGCAAGAGGCTGG - Intergenic
1141892687 16:86937293-86937315 GGGGTGAAAAAGAAAGAGGCGGG - Intergenic
1141924611 16:87159940-87159962 AAGGAGAAGGAGAAGGAGACAGG + Intronic
1142484580 17:238221-238243 AAGGAGAAAAGAAAAGAGGGAGG + Intronic
1142788283 17:2242713-2242735 AAAAAGAATAAGAAAGAAGCAGG + Intronic
1143135058 17:4707943-4707965 AAAGAAAAAAAAAAAGAGGCTGG + Intergenic
1143162263 17:4879418-4879440 AAGGAGTGTAAGAGAAAGGCAGG - Intronic
1143182546 17:4992673-4992695 AAGGAGAGAAAGAAAGAGAATGG - Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143395407 17:6590978-6591000 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1143715705 17:8767205-8767227 AAGGAGAAAAAGAAAATGGATGG - Intergenic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144053168 17:11515281-11515303 AAAGAAAAGAAGAAAGAGGAAGG + Intronic
1144091420 17:11860345-11860367 AAGCAGAATAAGAGAGAGAAAGG - Intronic
1144158358 17:12531078-12531100 AAATAGAATCTGAAAGAGGCAGG - Intergenic
1144180951 17:12752285-12752307 AAGAAGTATAAAAAAGAGGTGGG + Intronic
1144239219 17:13293643-13293665 AGGGAGAGAAAGAAAGAGGGAGG - Intergenic
1144313039 17:14031134-14031156 AAGGAGGAAAAGAAAAAAGCAGG + Intergenic
1144488708 17:15688779-15688801 AAGAAAAAAAAAAAAGAGGCCGG + Intergenic
1144752076 17:17655906-17655928 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1145093102 17:20001951-20001973 CTTGAAAATAAGAAAGAGGCCGG - Intergenic
1145101846 17:20084131-20084153 AACAAAAATAACAAAGAGGCTGG + Intronic
1145183131 17:20770536-20770558 AAAGAAAAAAAAAAAGAGGCTGG - Intergenic
1145764108 17:27446190-27446212 AAGGAAAGAAAGAAAGAGGCGGG + Intergenic
1146174984 17:30660175-30660197 AAGGAGCAAGAGAAAGAGGAGGG - Intergenic
1146299336 17:31676140-31676162 AGGGAGAAAAAGAGAGAGGGAGG + Intergenic
1146429808 17:32781680-32781702 AAGGAGAGAAATAAAGAGGAAGG + Intronic
1146496894 17:33330630-33330652 AAGGAGTATTAGAAAGAGCATGG - Intronic
1146610512 17:34300870-34300892 AATGAGAAACAGAAAGAAGCTGG + Intergenic
1146620320 17:34392039-34392061 AAGGAGAGGTTGAAAGAGGCAGG - Intergenic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147131287 17:38410840-38410862 AAGAAGAAGAAGAAAAAGACTGG - Intergenic
1147327453 17:39676304-39676326 AAGGAGAAGAGGAAGGCGGCAGG + Intronic
1147354290 17:39881390-39881412 AATGAGAAAGAGAAAGAGGTGGG + Intergenic
1147453155 17:40518819-40518841 AAGGAAAATGAGTCAGAGGCAGG - Intergenic
1147497669 17:40933235-40933257 AAGAGGAAAAAGAATGAGGCAGG - Intronic
1147766199 17:42838016-42838038 AGGGAAAATGAGAGAGAGGCAGG + Intronic
1147937114 17:44018424-44018446 AAGGAGAATGAGAAAAAGTCTGG + Intronic
1148057265 17:44807582-44807604 AATGAGAATAAGATAGAAACAGG + Intronic
1148342739 17:46883276-46883298 AAGGAAAAAAAAAAAAAGGCCGG - Intronic
1148609621 17:48955987-48956009 AATAAGAAGAAAAAAGAGGCCGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148750913 17:49945350-49945372 AAAAAGAAAAAGAAAAAGGCCGG + Intergenic
1148816813 17:50333957-50333979 AAAGACGAAAAGAAAGAGGCAGG + Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149008587 17:51831608-51831630 AAGGAAAACAAAAAAGAGGAAGG + Intronic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149299822 17:55294773-55294795 AACAAGAACAAGAAAGAGGATGG + Intronic
1149965366 17:61157526-61157548 AATGAAAAAAAAAAAGAGGCAGG - Intronic
1150047834 17:61930742-61930764 AAGGAAAAAAAAAGAGAGGCTGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150465208 17:65386814-65386836 AAAGAAAAGAAAAAAGAGGCAGG - Intergenic
1150552219 17:66221340-66221362 AAGGAAAGAAAGAAAGAGGAGGG + Intronic
1150928630 17:69560575-69560597 AAAGAAAAAAAAAAAGAGGCCGG - Intergenic
1151442544 17:74140813-74140835 AAAGTAAATAAGAGAGAGGCTGG + Intergenic
1151739433 17:75969886-75969908 AAAGAGAGCGAGAAAGAGGCCGG + Intronic
1152326598 17:79645183-79645205 AAGAAGAATAAGCGAAAGGCGGG - Intergenic
1153105623 18:1522233-1522255 AAAGAGAATAGGATAGAGGGAGG - Intergenic
1153240892 18:3030525-3030547 AAAAACAATAAAAAAGAGGCCGG + Intergenic
1153565560 18:6414605-6414627 AAAGAGAAAGAGAAAGAGCCTGG + Intronic
1153569895 18:6459700-6459722 AAGGAGAAGAAGAGAGATGGAGG - Intergenic
1153780108 18:8486965-8486987 GATGAGAAGAAGAAAGAGGCAGG - Intergenic
1153873466 18:9343009-9343031 ATAGAGAATAAGAAACAGACTGG - Intronic
1154928730 18:20969237-20969259 TACGAGAATAGCAAAGAGGCTGG - Intronic
1155030083 18:21976509-21976531 AAGGAAAATAAGATAGACGGAGG + Intergenic
1155081385 18:22413453-22413475 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1155096499 18:22560501-22560523 AGTGAGAATAAAATAGAGGCTGG + Intergenic
1155354980 18:24943287-24943309 AGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1155558896 18:27053425-27053447 AAGGAGCAAAAGAAAGAAGACGG - Intronic
1155589787 18:27413633-27413655 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156333164 18:36144596-36144618 AGTGAGGATAATAAAGAGGCTGG + Intronic
1156419494 18:36935306-36935328 AAGGAGAAGAGGAAAAAGGGAGG - Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157330396 18:46699924-46699946 ACTGAGACCAAGAAAGAGGCTGG - Intronic
1157680129 18:49598546-49598568 GAGGAGAAGGAGAAAGAAGCAGG - Exonic
1158243606 18:55405747-55405769 AGGTAGGAAAAGAAAGAGGCAGG + Intronic
1158321617 18:56270423-56270445 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1158422809 18:57311154-57311176 AAGGACAGTAAGAAAGTGGTAGG + Intergenic
1158611353 18:58943454-58943476 AAGGAAAAAAAAAAAAAGGCTGG - Intronic
1158646645 18:59254481-59254503 AAGAAGAAGAAGAGATAGGCTGG - Intergenic
1158794423 18:60826008-60826030 AAGGAGAATAACAAGGTGGAAGG + Intergenic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159072118 18:63636865-63636887 ATGGAGAGAAAGAAAGAGCCTGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159599088 18:70411556-70411578 AAGAAGAAAGAGAAAGATGCTGG - Intergenic
1159949459 18:74471477-74471499 GAGGAGAAGGAGCAAGAGGCAGG - Intergenic
1159951866 18:74489971-74489993 AAAGAGAAAGAGAAAGAGGGAGG + Intergenic
1160363470 18:78304256-78304278 AAGGAAAAAAAGAAAAACGCTGG + Intergenic
1160629834 18:80239132-80239154 AGGGAGAATAAGGGAGAGGTGGG + Intronic
1160637385 19:89166-89188 AAGGAAAAAAAGAAAAATGCAGG - Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160950836 19:1666515-1666537 AAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1161010172 19:1956063-1956085 CAGGAGGATGAGAAAGGGGCAGG - Intronic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161598814 19:5167520-5167542 AAGAAAAAAAAAAAAGAGGCTGG + Intronic
1161632521 19:5365534-5365556 AAAGAAAGAAAGAAAGAGGCCGG - Intergenic
1161652578 19:5494440-5494462 AAAAAGAAAAAGAAAAAGGCCGG + Intergenic
1161904031 19:7141821-7141843 AAGGAGAGGAAGTGAGAGGCAGG + Intronic
1161905842 19:7155916-7155938 AAGAAGAAAAAGAAAGAAGAAGG + Intronic
1161914944 19:7221410-7221432 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162011026 19:7815253-7815275 AAGAAGAATAAGGAACAGGATGG - Intergenic
1162080490 19:8214966-8214988 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162080503 19:8215008-8215030 GAGGAGAAAAAGGAAGAGGAGGG + Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162383155 19:10343958-10343980 AAGAAGAATATGAAAGAGATAGG - Intergenic
1162746721 19:12802660-12802682 AAGGAGAAATGGAAAGAGGTCGG + Intronic
1162871199 19:13588041-13588063 AAGAAAAGAAAGAAAGAGGCCGG + Intronic
1162873636 19:13604396-13604418 AAAGAGAAAGACAAAGAGGCCGG + Intronic
1162933572 19:13969195-13969217 AAGGAGAGGAAGAGAGGGGCGGG + Intronic
1162950036 19:14065839-14065861 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1163007305 19:14405139-14405161 AAAGAAAAAAAAAAAGAGGCCGG - Intronic
1163120595 19:15215103-15215125 AAAAATAATAATAAAGAGGCTGG + Intergenic
1163150304 19:15408585-15408607 AAAGAAAGAAAGAAAGAGGCCGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163538861 19:17894628-17894650 GAAGAAAATAAGAAAGAGGTGGG - Exonic
1163725498 19:18921153-18921175 AAAGAAAGAAAGAAAGAGGCAGG + Intronic
1163956333 19:20645152-20645174 GAGGAAAATAACAAAGAGGAAGG + Intronic
1164442080 19:28286547-28286569 AAAAAGAAAAAGAAAGGGGCAGG + Intergenic
1164452327 19:28377527-28377549 AAAGAAAAGAAAAAAGAGGCTGG - Intergenic
1164493087 19:28732142-28732164 AAGGAGAAGGAGAAAGAAGGAGG + Intergenic
1165116405 19:33531559-33531581 AAGGAAAAGAAGGAAGGGGCCGG + Intergenic
1165672229 19:37689192-37689214 AAAGAAAAAAAAAAAGAGGCCGG + Intronic
1165873513 19:38989648-38989670 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1166103519 19:40585834-40585856 AAGTGAAATAAGAAAGAGGCCGG - Intronic
1166195626 19:41203811-41203833 AAGAAGGAGAAGAAAGATGCAGG - Intronic
1166196735 19:41211298-41211320 AAAAAAAATAATAAAGAGGCGGG + Intergenic
1166284953 19:41819825-41819847 AAAGAAAGTAAGAAATAGGCTGG - Intergenic
1166627099 19:44367709-44367731 AATGAGAATAAGGAAGAAGAAGG - Intronic
1166635236 19:44445449-44445471 GAGCAGAATGAGAAAGAGGGAGG - Intronic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1166859216 19:45800204-45800226 AAGGAGAATAAGAGAGTGGGAGG - Intronic
1167253215 19:48412480-48412502 AGAGAGAGAAAGAAAGAGGCGGG + Intronic
1167476332 19:49703495-49703517 AAAGAAAGAAAGAAAGAGGCCGG - Intronic
1167527690 19:49995139-49995161 AGGAAGAAGAGGAAAGAGGCCGG + Intronic
1167619225 19:50551870-50551892 AAGGAGAGAAAGAAGGAGGGAGG - Intronic
1167626411 19:50592725-50592747 AAGGAAAAGAAGAAAGAAGGAGG - Intergenic
1168054207 19:53852568-53852590 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1168098299 19:54127926-54127948 AAGAAGAAAAAGAAAGGGGGTGG + Intronic
1168522154 19:57060921-57060943 AAGGAGAATAGGAACCAGACTGG - Intergenic
1168532026 19:57137793-57137815 AAGGAGATAAAGAAAGAGAGAGG + Intronic
1168543476 19:57231545-57231567 AAGGGGAAGAAGAAAGAGTAAGG - Intronic
925102538 2:1260450-1260472 AAGGAGATGAAGGAAAAGGCCGG + Intronic
925173685 2:1767739-1767761 AGGGTGAATAAGAAGGAAGCAGG - Intergenic
925695220 2:6569495-6569517 AAAGAGAATATAAAAGAGCCAGG - Intergenic
925829748 2:7882541-7882563 AATGAGAAATAGAAAGAGGCTGG + Intergenic
926502635 2:13674779-13674801 AAAAATAATAAGAAAAAGGCAGG + Intergenic
926510735 2:13774406-13774428 ACAGAGAATAAGAAAGAAGTTGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927205454 2:20606617-20606639 AAGAAGAAGAAGAAAGACGCTGG - Intronic
927330632 2:21859342-21859364 AAGGAGGATCTGTAAGAGGCTGG + Intergenic
927737035 2:25533622-25533644 AAGTAGAAAGAGAGAGAGGCAGG - Intronic
927761696 2:25762367-25762389 AAGAAGAGTAAGAAAGAGGCTGG + Intronic
927779291 2:25926528-25926550 AAGGAGAAAATGAAAAAGGGAGG + Intergenic
927785855 2:25974362-25974384 TAGGAAAAAAAGAAAAAGGCCGG - Intronic
927789460 2:25999028-25999050 AGAAAGAAAAAGAAAGAGGCCGG - Intergenic
928070317 2:28208624-28208646 AAGGAAAGAAAGAAAGAGGAAGG - Intronic
928498617 2:31863035-31863057 GAGGAAAGAAAGAAAGAGGCTGG + Intergenic
928582560 2:32723783-32723805 AAAGAGAGTAAGACAGAGGGAGG - Intronic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
929074273 2:38065383-38065405 AAAAAGAAAAAGAAAGAGGCTGG + Intronic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
930124962 2:47788547-47788569 AAAAAGAAAAAGAAAAAGGCTGG - Intronic
930232120 2:48853856-48853878 AAGAAGGATAAGAATTAGGCAGG - Intergenic
930315894 2:49796483-49796505 ACTAAGAATAAGAAATAGGCTGG + Intergenic
930382837 2:50653863-50653885 AAGGAAACAAAGTAAGAGGCAGG - Intronic
930502652 2:52241739-52241761 AAGGAAAAGAAGAGAAAGGCTGG + Intergenic
930542271 2:52721495-52721517 AAGAAGAATAAGGAAGAGCAAGG - Intergenic
930556787 2:52906260-52906282 AAGGGGAAGTAGAAGGAGGCTGG - Intergenic
931071447 2:58656396-58656418 AAGGAAGAGAAGAAAGAGACAGG - Intergenic
931133410 2:59366292-59366314 AAAGAGAAGAAGAGAGAGGGAGG + Intergenic
931332300 2:61300301-61300323 AAGGAGAATGGGGAAGAGGATGG - Intronic
931442694 2:62302563-62302585 AAGGAAAATAAGCAAGAAACAGG - Intergenic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
931683075 2:64768718-64768740 AAGGAGGAAAAGAAGGAGGGAGG - Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932939478 2:76145768-76145790 AAGAAGAATAATACAGAGACAGG + Intergenic
933027536 2:77279799-77279821 AAGGAAATGAAGAGAGAGGCAGG + Intronic
933248012 2:79997306-79997328 AAGGAGAAAAAAAGAGAGGGAGG + Intronic
933309003 2:80637488-80637510 CAGGAGAGGAAGAAAGAGGTGGG + Intronic
933366017 2:81355069-81355091 AAGGCAAATAAGAAGGAGGGAGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933493009 2:83012342-83012364 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
933509763 2:83225686-83225708 ATGGAGAATAAGGAAAAGGGTGG + Intergenic
934065641 2:88338685-88338707 AATGAGCATAAAAAAGAGGCTGG + Intergenic
934159951 2:89239526-89239548 GTTCAGAATAAGAAAGAGGCAGG + Intergenic
934207328 2:89942905-89942927 GTTCAGAATAAGAAAGAGGCAGG - Intergenic
934728953 2:96644180-96644202 AAAAAAAAAAAGAAAGAGGCTGG + Intergenic
934884342 2:98011503-98011525 AAGAAGAAAAAGAAAGAGAAAGG - Intergenic
934903250 2:98177559-98177581 AAGGAGAAAAAAAAAAAGGAGGG - Intronic
934977745 2:98816708-98816730 GAGGAGCAGAGGAAAGAGGCAGG + Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935578720 2:104736924-104736946 AAGGAAGGAAAGAAAGAGGCTGG + Intergenic
935754827 2:106268905-106268927 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936233619 2:110725125-110725147 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
936433751 2:112485466-112485488 AAGGAGAACTAGAATGATGCTGG - Intronic
936594609 2:113835882-113835904 AACAAGAATAAAAAAGAAGCTGG - Intergenic
936705697 2:115071205-115071227 AGGGAGAATAAGAAAAAAGTAGG - Intronic
936727947 2:115344921-115344943 AAGTAGAGTAAGAGAGAGGAAGG - Intronic
937341154 2:121091444-121091466 AAGGAAAAGAAGAGAGGGGCTGG + Intergenic
937563277 2:123251431-123251453 AAGGAGAAGAAGAAAGATGGCGG + Intergenic
937687391 2:124713163-124713185 AAGGAGGAAAAGAGAGAGGGAGG - Intronic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
937873019 2:126799255-126799277 AAAGAGAGGAAGAAAGAGGGAGG - Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938168690 2:129056348-129056370 ATGGTGAATTAGAAAGAGGCTGG + Intergenic
938651317 2:133386869-133386891 AAGGAAAACAAAAAAAAGGCAGG - Intronic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
939291313 2:140198923-140198945 AAGGAGAAAAAGAAAGAAGGAGG + Intergenic
939792153 2:146590807-146590829 AAGGGGTATAATAAAGAGCCTGG + Intergenic
939842828 2:147209063-147209085 GAGGAGAATAAGACAGAGAAAGG + Intergenic
940015077 2:149095746-149095768 AGGGAGAGAGAGAAAGAGGCAGG + Intronic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940230602 2:151447237-151447259 GAGGAGGGAAAGAAAGAGGCCGG - Intronic
940809389 2:158225122-158225144 AAGGAAAACAAAAAACAGGCAGG + Intronic
941101844 2:161305485-161305507 GAGGAGAAAAAGAAAAGGGCAGG - Intergenic
941306431 2:163874554-163874576 AAAGAGAATAATTAAGAGACTGG - Intergenic
941471677 2:165896271-165896293 AAAGAGAAAAAGAAAGAGGTGGG - Intronic
941535434 2:166717517-166717539 AAGAAGAATAAGATAGAGAAAGG - Intergenic
941610437 2:167654790-167654812 AAAAAAAAAAAGAAAGAGGCTGG - Intergenic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942280354 2:174356576-174356598 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
942681068 2:178478970-178478992 AAGGAGCGTAAAAAATAGGCTGG + Intergenic
942893572 2:181021452-181021474 AAAGAGAAAAAGAAAGAGAGAGG - Intronic
942964883 2:181880044-181880066 AAGGAGAATAAGGTAGAAGAAGG - Intergenic
943020420 2:182565943-182565965 AAGAAAAAGAAGAAAGAGACAGG + Intergenic
943214707 2:185015665-185015687 AGGGACAAGAAGAAAGATGCTGG + Intergenic
943239701 2:185366669-185366691 GAGGAGGATAAGGAAGAGGAAGG - Intergenic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943321937 2:186455366-186455388 AAGGTGAATAAAGAAGAGGGAGG - Intergenic
943569643 2:189558447-189558469 AAGGAGAACAAGAAAGAACTGGG - Intergenic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944623128 2:201539694-201539716 AAGGAGAGGAAGAAAGATGGGGG - Intronic
945576396 2:211535310-211535332 AATGAGAATAAGAGACAGGTAGG - Intronic
945915110 2:215695561-215695583 AAGAAGACTGATAAAGAGGCAGG + Intergenic
946080029 2:217109893-217109915 AAGGAGAATGAAGAGGAGGCTGG + Intergenic
946089617 2:217209140-217209162 AAAGAGTATTAGAAAGAGGCTGG - Intergenic
946091547 2:217229420-217229442 AAAGAGAAAAAGAAAAAGACAGG - Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946153416 2:217791287-217791309 AAAGAGAATGAGAAAGGGTCTGG - Intergenic
946439285 2:219681442-219681464 AAGGAAAATAAGAAGGAGATAGG - Intergenic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
946872591 2:224097698-224097720 AAGGAGAAAGTGCAAGAGGCTGG - Intergenic
947197352 2:227582298-227582320 AAAGAGAGAAAGAAAGAGACTGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947318786 2:228894567-228894589 AAGAAGAATAAGGGAGAGGCCGG - Intronic
947333645 2:229056866-229056888 GAGGTGAAGAAGAGAGAGGCAGG + Intronic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947682941 2:232052318-232052340 AAAGAAATTAAGAAGGAGGCTGG - Intronic
947706903 2:232283566-232283588 AAGCAGAATAAGAAATAGACTGG - Intronic
947909204 2:233790541-233790563 AAGGAGAAAAAGAAAGGGGGAGG - Intronic
947952006 2:234156235-234156257 AAGAAGAAAAAGAAAGAGGAGGG - Intergenic
947970481 2:234319106-234319128 AAAAAGAAAAAAAAAGAGGCTGG - Intergenic
947981996 2:234418535-234418557 AATGAGATGAAGAAAGAAGCAGG - Intergenic
948096728 2:235341212-235341234 TAGGGGATTAGGAAAGAGGCTGG - Intergenic
948475081 2:238212485-238212507 AAAGAAAGAAAGAAAGAGGCTGG - Intergenic
948704662 2:239781383-239781405 AAGGAGAAAAGCAAAGGGGCTGG + Intronic
948730361 2:239959685-239959707 AAGGAGGGAAGGAAAGAGGCAGG + Exonic
948730373 2:239959742-239959764 AAGGAGGGAAGGAAAGAGGCAGG + Exonic
948766817 2:240226735-240226757 ATGGAGACTAAGAAAGACCCTGG + Intergenic
949037675 2:241824828-241824850 AAAAAGAAGAAGAATGAGGCTGG - Intergenic
1168752340 20:291695-291717 AAGGAGACTGAAAAGGAGGCAGG - Intergenic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1169043338 20:2515016-2515038 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1169046820 20:2539864-2539886 AGTGAGAAGAAGAAAGAGGTTGG + Intronic
1169047474 20:2545673-2545695 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1169150007 20:3282102-3282124 AAAGAAAATAAGCAAGTGGCAGG - Intronic
1169299345 20:4428611-4428633 AAAGAGAATAACAAAGGGCCGGG + Intergenic
1169455060 20:5745187-5745209 AAAAAGAAAAAGAAAAAGGCTGG - Intergenic
1169635848 20:7690559-7690581 AAGGAGCATAAGAGAGAGGGAGG - Intergenic
1169757752 20:9061674-9061696 AAGGAAAGAAAGAAAGAGGAAGG - Intergenic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1169843735 20:9967072-9967094 AGGGATAAAAAGACAGAGGCCGG + Intergenic
1170309017 20:14972365-14972387 AAAGAGAGTGAGAAAGAGGAAGG - Intronic
1170348507 20:15414637-15414659 AAGGATAACCAGGAAGAGGCTGG - Intronic
1170511212 20:17078738-17078760 AAGGAAAAGAAGACAAAGGCTGG - Intergenic
1170966671 20:21078917-21078939 AAAGAGGAAAAGAAAGAGGATGG - Intergenic
1171045324 20:21805161-21805183 AAGGAGAGTAAAAAAGAAGCAGG - Intergenic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1171203554 20:23261167-23261189 GAGGAGAAAAAGATAGAGGTAGG + Intergenic
1172498318 20:35405589-35405611 AAGAACTATAAGAAAGTGGCCGG + Intronic
1172728200 20:37063806-37063828 CAAGAAAAAAAGAAAGAGGCCGG - Intronic
1172728360 20:37064920-37064942 AAAAAAAAAAAGAAAGAGGCCGG - Intronic
1172811659 20:37652346-37652368 AAGAAGAAGAAGAAAGAGCCAGG - Intergenic
1172940292 20:38649386-38649408 AAGGAGGATAGGGAAGGGGCAGG + Intronic
1173442938 20:43094380-43094402 AAAAAAAAAAAGAAAGAGGCCGG - Intronic
1173958418 20:47052607-47052629 AAAGATAAAAAGAAAGAAGCAGG - Intronic
1173991240 20:47305236-47305258 AAGAAAAAAAAAAAAGAGGCAGG - Intronic
1174197932 20:48786407-48786429 CAGGAGAGAAAGAAAGTGGCGGG + Intronic
1174199266 20:48795600-48795622 CAGAAGAAAAAGAAAAAGGCAGG + Intronic
1174501340 20:50987259-50987281 AGGAAGAATGAGAAACAGGCAGG + Intergenic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1174752648 20:53127037-53127059 GAAGAGAAAAAGAAAGAGGGAGG + Intronic
1174828340 20:53789852-53789874 AATGGGAAGAAGAAAGAGGCAGG - Intergenic
1174842697 20:53915261-53915283 AAGGAGAATAAGAGAGAGGGAGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1174998985 20:55605348-55605370 TAAGAGAATGAGAAAGAGCCTGG + Intergenic
1175050402 20:56150397-56150419 AAGAAGGGAAAGAAAGAGGCAGG + Intergenic
1175085734 20:56456984-56457006 AGGGAGTATAAGAATGAAGCAGG - Intronic
1175452084 20:59077886-59077908 AAGGAGAAGGAGAAAAAGGAGGG + Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1176724291 21:10417253-10417275 AAGGAGATCAAGGAAGAAGCAGG + Intergenic
1177160710 21:17545115-17545137 AGGGAGAGGAAGAGAGAGGCAGG + Intronic
1177763108 21:25425211-25425233 AAGGACAATAAGAGAGAGAAAGG + Intergenic
1178080263 21:29056394-29056416 AAGGAGAATAAGAAAACATCAGG + Exonic
1178083484 21:29089915-29089937 AAGGAGAATAAGAAAGAAGGAGG + Intronic
1178198327 21:30374352-30374374 AAAAAGAAAAAGAAAGAGGGAGG - Intronic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1178323317 21:31622783-31622805 AAAGAAAAAAAGAAAGAGGAAGG - Intergenic
1178505266 21:33157439-33157461 AAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1179081848 21:38178722-38178744 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1179262086 21:39766200-39766222 AAGGAGAAAGAGAATGAAGCAGG - Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1181449387 22:23008395-23008417 AAGAAAAAAAAGCAAGAGGCAGG + Intergenic
1181691071 22:24561033-24561055 AAGGAAAAGAAAAAAAAGGCTGG - Intronic
1181943473 22:26497050-26497072 CAAGAGAACAAGGAAGAGGCAGG - Intronic
1181998134 22:26899180-26899202 AATGAGAATAAAAAATAGGATGG - Intergenic
1182041547 22:27242192-27242214 TAGAGGAATAAGAAACAGGCTGG - Intergenic
1182247335 22:28969587-28969609 AGGGTGAACAAGAAAGAGACTGG + Intronic
1182286327 22:29250352-29250374 CAAGAGAAGAAGAAAAAGGCAGG - Intronic
1182367969 22:29791381-29791403 AAGAAGAAGAAGAAGAAGGCTGG + Intronic
1182383890 22:29919040-29919062 AGGGAGAATAAGAAATAGGCTGG - Intronic
1182415670 22:30219917-30219939 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1182477406 22:30583625-30583647 AAAGAGATAAAGAAAAAGGCTGG + Intronic
1182773603 22:32814246-32814268 AAGGAAAGAAAGAAAGAGGGAGG + Intronic
1182850799 22:33472311-33472333 AAGGAGACAAAGAGAGAGACAGG + Intronic
1182860681 22:33556709-33556731 AAGAAAAAAAAAAAAGAGGCTGG + Intronic
1182894882 22:33850836-33850858 GAGGGGCATAAGAGAGAGGCAGG - Intronic
1182997357 22:34826465-34826487 AAGCAGAAAAAAAAGGAGGCTGG + Intergenic
1183058622 22:35321934-35321956 AAGGAGGACAAGAAAAAGGGTGG - Intronic
1183091846 22:35527615-35527637 AAGGAGAGAGAGAAAGAGGAAGG - Intergenic
1183093357 22:35538587-35538609 CAGGAGCAGAAGACAGAGGCTGG + Intergenic
1183229112 22:36569920-36569942 AAGGAAAGAAAGAAAGAGGTCGG + Intronic
1183435957 22:37795330-37795352 AAGAAGAAAAAAAAAAAGGCGGG - Intergenic
1183594684 22:38803556-38803578 AGAGAGAAAGAGAAAGAGGCCGG - Intergenic
1183804179 22:40194166-40194188 AAGGAAAAGAAGAAGGAGTCTGG + Intronic
1183815496 22:40296626-40296648 AAGGAAAAAAAAAAAAAGGCCGG - Intronic
1184003823 22:41694505-41694527 AAGAAGGACAAGAAAGAGGCTGG + Exonic
1184063363 22:42099387-42099409 AAAGAGAAAATAAAAGAGGCCGG - Intergenic
1184185662 22:42863330-42863352 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184458169 22:44623075-44623097 TAGAAAAATGAGAAAGAGGCCGG + Intergenic
1184472870 22:44705619-44705641 AAAGAAAACAAAAAAGAGGCTGG - Intronic
1184581091 22:45418284-45418306 AAGGTGAATGGGAAAGATGCAGG + Intronic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
1184989879 22:48160183-48160205 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
1185177876 22:49340354-49340376 AAGAAGAAAAAGAAGGAGGCTGG - Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949104927 3:192578-192600 AAGGAGAAAAAGAACTAGGCCGG + Intergenic
949127894 3:468499-468521 CAGGAGAATAAGAAAGAAAAAGG + Intergenic
949233950 3:1786186-1786208 TAGGAGAAAAAGTAAGAGGATGG + Intergenic
949257261 3:2063543-2063565 AAAGAGAAAAAGAGAGAGACAGG - Intergenic
949270595 3:2211967-2211989 AAGGAAAAAAAGAAAGAGAAAGG - Intronic
949329740 3:2908475-2908497 AAGCAGAATAAGGAAGAAGGAGG + Intronic
949365713 3:3278397-3278419 AAGGGGAAAAAAAAAGAGGATGG - Intergenic
949765357 3:7520293-7520315 CAGGAAGATAAGAAAAAGGCAGG + Intronic
950357238 3:12421934-12421956 AAGGAGAATAGGGTAGAAGCAGG + Intronic
950360793 3:12448235-12448257 AAAAAGAAAAAGAAAGAGGAAGG + Intergenic
950387934 3:12674550-12674572 GAGGAGAATTAGTAAGAGGAAGG + Intergenic
950611521 3:14130109-14130131 AAGGAGAAAAAGAAAGAGAGAGG - Intronic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
950747797 3:15104565-15104587 AATGAGAAAAAGGATGAGGCTGG + Intergenic
950845546 3:16012086-16012108 AAGAAGGAAAAGAAAGAGGGAGG + Intergenic
951274009 3:20663157-20663179 AAAGAGGATGAGAAAGAGGGTGG - Intergenic
951448351 3:22808204-22808226 AAGGACAAGAAGAGAGTGGCTGG + Intergenic
951682064 3:25305273-25305295 AAGGAAAAAGAGAAAAAGGCTGG + Intronic
952395248 3:32915334-32915356 AATAAAAATGAGAAAGAGGCCGG - Intergenic
953156199 3:40376978-40377000 AAAGAGAAGAAGAGAAAGGCAGG + Intergenic
953200694 3:40776405-40776427 AGGGTGAATAGGATAGAGGCAGG + Intergenic
953203902 3:40803724-40803746 AAGGAGAGAAAGAAAGAGGAAGG + Intergenic
953653689 3:44830358-44830380 AAACTGAATAAGAAACAGGCTGG + Intronic
953660551 3:44888503-44888525 AGGGAGAGGAAGGAAGAGGCCGG - Intronic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
953965304 3:47300182-47300204 AAGGAGGAAAAGAAGGAGGTGGG - Intronic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954191928 3:48969167-48969189 AAAAAAAAAAAGAAAGAGGCTGG - Intronic
954230057 3:49210010-49210032 AAAGAAAGAAAGAAAGAGGCTGG - Intronic
954245370 3:49327239-49327261 AAAGAGAACCAGAAACAGGCTGG + Intronic
954338977 3:49938315-49938337 AAAAAGAAAAAGAAAGAGGTTGG - Intergenic
954339022 3:49938611-49938633 AAGGAAAGAAAGAAAGAGGCCGG - Intergenic
954392775 3:50276109-50276131 AGGGAGAATCCGAAAGAGGCGGG - Intronic
954533075 3:51337613-51337635 AAGGAGAATGAGAACCAGACTGG - Intronic
954577975 3:51687181-51687203 GGGGAGAGTAAGATAGAGGCCGG + Intronic
954653347 3:52178612-52178634 AAGGACAATAAGGAGGAGGCTGG + Intergenic
954726463 3:52615398-52615420 AAGGAGAAAAGGAAAGAGCTGGG - Exonic
954941771 3:54379750-54379772 AAGGAGAACAGGAAGGATGCAGG - Intronic
955469315 3:59269674-59269696 GAGGAGAAAAAGAAAGAGATAGG - Intergenic
955661045 3:61299458-61299480 AAGAAGAGAAAGAGAGAGGCTGG - Intergenic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
956462779 3:69488116-69488138 AAAGAGAAAAAGAAAGAGAAAGG + Intronic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
957188442 3:76974296-76974318 AAGAAAAATAAGAAAAAGGGGGG - Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957398679 3:79679774-79679796 AAGGAAAAAAAGAAAGAATCAGG + Intronic
957411502 3:79847175-79847197 AAAGAAAAAAAGAGAGAGGCAGG - Intergenic
957615612 3:82522816-82522838 AAGCATAATACAAAAGAGGCTGG - Intergenic
957719378 3:83973818-83973840 AAGGAGAGTTAGAAAGAGAGTGG + Intergenic
957756058 3:84489349-84489371 CAGGAACATAAGAAAGAGACTGG - Intergenic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
957892046 3:86372468-86372490 AAGGAGAATTAAAAATAGGAGGG + Intergenic
958475641 3:94577517-94577539 AAGGAGAAGAACAAAGATGGAGG + Intergenic
958914872 3:100038250-100038272 AATGAGAAGAAAAGAGAGGCCGG - Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959440275 3:106365793-106365815 AAGGGGAATATGGAAGATGCTGG + Intergenic
959502754 3:107125267-107125289 AAGGAGAAGAAAAAAAAGGGGGG + Intergenic
959720714 3:109484772-109484794 AAGGAAGAGAAGCAAGAGGCAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960775132 3:121241698-121241720 AAGGAAGAGAAGAAAGAGGGTGG + Intronic
960782799 3:121338661-121338683 AAAGAAAAAAAGAAAGAGGAAGG + Intronic
961004568 3:123396236-123396258 AAAGAGAAAAAGAGAGAGGGAGG + Intronic
961108143 3:124259795-124259817 AAGGAGAAAAATAAAGAGAAGGG + Intronic
961156749 3:124686082-124686104 AAGAAGCATAAGAAGGAGGCAGG + Intronic
961167430 3:124773201-124773223 AAGGTAAATTGGAAAGAGGCCGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961530006 3:127534828-127534850 CAGGAGAAAAAGCAAGTGGCAGG - Intergenic
961618949 3:128207993-128208015 AAGGAAAAAAAGAAACAGGCAGG - Intronic
961973206 3:130991962-130991984 TAGGAGAATAGGAAAGAGAATGG + Intronic
962694085 3:137930495-137930517 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
962767732 3:138580986-138581008 AAAAAGAATAAAAAACAGGCCGG + Intronic
962991169 3:140578607-140578629 AAAGAGAAAAAAAAAGAGGCTGG - Intergenic
963090729 3:141481186-141481208 AAGGAGAAAGGGAAAGAGTCAGG - Intergenic
963493693 3:146033521-146033543 AAGGAAAATAAGGAAAAGGAAGG + Intergenic
963583736 3:147158573-147158595 AAGGAAGAAAAGAAAGAGGAAGG + Intergenic
963588372 3:147224563-147224585 AATGAGAAAAAGAAAGAGAAGGG + Intergenic
963783549 3:149510624-149510646 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
963831228 3:150011801-150011823 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
963933857 3:151032748-151032770 AAAGAAAAAAAGAAAAAGGCAGG + Intergenic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964586786 3:158315442-158315464 AAGGAAACTAAGAAAGAGATAGG + Intronic
964633002 3:158833041-158833063 GAGGAGGATGAGAGAGAGGCTGG + Intergenic
965086596 3:164107455-164107477 AAGGAGAATATGAAAAAGGTAGG - Intergenic
965128611 3:164664681-164664703 AAGGAAAATAAAAAAAAGGAAGG + Intergenic
965862075 3:173160036-173160058 AAGGAGGATTAGAAAGACTCAGG + Intergenic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966226400 3:177602818-177602840 AAGGAGGATGTGAAATAGGCAGG + Intergenic
966377579 3:179312631-179312653 AAGAAGAAGAATAAAGATGCAGG - Intergenic
966630494 3:182069182-182069204 AAGGAAAAAAAGAAAAAGGAAGG - Intergenic
966705276 3:182906790-182906812 AAGAAGAAGAAGAAGAAGGCCGG + Intronic
966759766 3:183407547-183407569 AAGAAGCAGAAGAAAGAGGGAGG - Intronic
966826343 3:183968031-183968053 CAGCAGAATAGGAAAGAGGCTGG - Intronic
966895108 3:184439084-184439106 AAGGAGAAGGAGAAAGGGGGAGG + Intronic
967080632 3:186046285-186046307 AATGAGGGCAAGAAAGAGGCAGG + Intergenic
967275423 3:187769450-187769472 CAGGAGAATGAGAAATAGCCAGG + Intergenic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967616068 3:191568310-191568332 ATGGAGCGTGAGAAAGAGGCAGG + Intergenic
967787273 3:193511261-193511283 AAGGATGCAAAGAAAGAGGCAGG + Intronic
967821678 3:193844528-193844550 AAGGAAAAAGAGAAAGGGGCTGG + Intergenic
968376544 4:47593-47615 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
969140595 4:5067862-5067884 CAGGAGGATAAGAGAGAGGGAGG + Intronic
969939494 4:10716647-10716669 AAAAGGAATAGGAAAGAGGCAGG + Intergenic
969957250 4:10903558-10903580 AATCAGAATTAGAGAGAGGCTGG + Intergenic
970359098 4:15289852-15289874 AGGGAGACTATGCAAGAGGCAGG + Intergenic
970432848 4:16004926-16004948 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
970737548 4:19192298-19192320 AAGGATAAAAAGAAAGTGGAAGG - Intergenic
971090622 4:23340535-23340557 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
971317727 4:25581317-25581339 CAGGAGAGGAAGAAAGAGTCTGG - Intergenic
971481346 4:27117517-27117539 AAGGAGAATAGGAAGGTGGGTGG - Intergenic
972124676 4:35748406-35748428 AAGGAGAAGAAGAAAAACACAGG - Intergenic
972766541 4:42156659-42156681 AAGGAGGAGAGGAGAGAGGCGGG + Intergenic
973185116 4:47317723-47317745 AAGGAAAATTGGAAAGAGGTAGG + Intronic
973270117 4:48254233-48254255 AGGGAGAATGACAAAGAGGTTGG + Intronic
973314978 4:48750162-48750184 AAGAAAAAAAAGGAAGAGGCTGG + Intronic
973660796 4:53104872-53104894 AAAGAGAATTAGAGAGTGGCTGG + Intronic
973808783 4:54550349-54550371 GAGGAGAAAAAGAAAAAGGCAGG - Intergenic
974247505 4:59339626-59339648 AAGGAGATTAGGAAAGAAGAAGG + Intergenic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974385800 4:61201158-61201180 AAGAAGAAAAAGAAAGAGAAGGG + Intergenic
974435897 4:61856933-61856955 AAAGAGAAGAAGAAAGAGGGAGG - Intronic
974490038 4:62552820-62552842 TAGGAAAATAACAAAGAAGCAGG + Intergenic
974682897 4:65186661-65186683 GAGGAGAAGAAGGAAGAGGAAGG + Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975084882 4:70326581-70326603 AAGGAGAAAAAGTAAGAGCTGGG - Intergenic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
975475876 4:74822773-74822795 AGGGAGAATATGAGAGAGGAAGG - Intergenic
975811832 4:78177724-78177746 AAGGTGTATGAGATAGAGGCAGG - Intronic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
977265532 4:94849192-94849214 AAGGAGAATGAGAAAAAGCAAGG + Intronic
977401864 4:96542497-96542519 AAAGAGGATCAGAGAGAGGCAGG + Intergenic
977462665 4:97344281-97344303 AAGGAGAAGAAGAAAAAGAATGG + Intronic
977611193 4:99033641-99033663 AAGGGGTAAAGGAAAGAGGCAGG - Intronic
977895268 4:102357632-102357654 AAGGAGAGAATGAAAGAGGAAGG + Intronic
978021240 4:103815487-103815509 AAGGAGAAGAAAAAAGAGAAGGG - Intergenic
978108005 4:104928140-104928162 AAAGAGAAAAAGAAAGAGAAAGG + Intergenic
978216426 4:106209773-106209795 AAGGAGATTAAAAAAAAGTCAGG - Intronic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978400725 4:108327707-108327729 AAGGAGAAGAAGAAGGAAGTAGG - Intergenic
978515567 4:109565000-109565022 AAAGTGAACAAGAAAGAGACTGG + Intronic
978733805 4:112062514-112062536 AAGGAGAGAAAGACAGAGGGAGG + Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
978992228 4:115098534-115098556 AAGGAGAATAACAAAGTTGGAGG + Intronic
979715457 4:123832204-123832226 TGGGAAAAGAAGAAAGAGGCAGG - Intergenic
979876553 4:125898764-125898786 AAGGAGAAAAAGAGAAAGGAAGG - Intergenic
979938714 4:126731838-126731860 AAGAAGAAAAAAAAAGAGGCTGG + Intergenic
979993162 4:127399827-127399849 AAAGAGAAAAAGGAAGAGGTTGG + Intergenic
980090192 4:128435325-128435347 AAGGAAAACAAAAAAAAGGCAGG - Intergenic
980583830 4:134787958-134787980 AAAGAAAAAAAGAATGAGGCTGG - Intergenic
981092587 4:140747049-140747071 AAGAAGAATACTAAATAGGCTGG + Intronic
981222201 4:142250156-142250178 AGAGAGAATAAGGAAGAGGTGGG - Intronic
981358410 4:143819359-143819381 AAGCAGGATAAGAAAATGGCTGG - Intergenic
981359116 4:143827195-143827217 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981369900 4:143948097-143948119 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981379643 4:144058051-144058073 AAGGTGAAGAAAAAAGAGCCAGG - Intergenic
981572873 4:146172055-146172077 AAGAAGGAAAAGAAAGAGGGAGG - Intergenic
981874453 4:149523740-149523762 ATGGAAAATGAGAAAGAGACTGG + Intergenic
982922073 4:161288368-161288390 AAGAAAAATCAAAAAGAGGCCGG + Intergenic
982970594 4:161980087-161980109 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
983209838 4:164947033-164947055 AATGAGAGTAAGAGAGAAGCTGG + Intergenic
983379732 4:166976656-166976678 AAGGAGAAAAATAAAGAAGGAGG - Intronic
983426715 4:167593458-167593480 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
983449388 4:167891536-167891558 AAGGAGAGGAAAAAAGAGGTGGG + Intergenic
983782593 4:171690111-171690133 AAAGAGAAGAAGAAAGAAACAGG + Intergenic
984004307 4:174290148-174290170 ATTAAGAAGAAGAAAGAGGCAGG - Intronic
984227519 4:177052877-177052899 AAGAATAATAAAAAAGAGGGAGG + Intergenic
984574375 4:181429897-181429919 AGTTAGAATAAGGAAGAGGCAGG - Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
984883307 4:184429147-184429169 AAGGAGAGAAGGAAAGAGTCAGG - Intronic
985209820 4:187580856-187580878 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
985308225 4:188567459-188567481 AAGGAGAATAACAAAGCTGGAGG - Intergenic
985669363 5:1199311-1199333 AAAGAGACAAAGAAAGAGACAGG - Intergenic
985887240 5:2689042-2689064 AAGGAGAGAGGGAAAGAGGCAGG + Intergenic
985932810 5:3072392-3072414 AAGGAGAGAGAGAGAGAGGCAGG - Intergenic
985968288 5:3354167-3354189 AGGGAGAATAAGATGGAGACGGG + Intergenic
986015210 5:3751640-3751662 AAGGAGAAATTGAAAAAGGCAGG + Intergenic
986028732 5:3875183-3875205 AAAGAGAAAAAGAAAGGGGAAGG + Intergenic
986070632 5:4279058-4279080 AAGGAGAAAAAGTGAGAGGGGGG - Intergenic
986229014 5:5844373-5844395 TAGGAAAATAAGAAAATGGCCGG - Intergenic
986362441 5:6993221-6993243 AAGAAGAAGAAGAAAGGAGCGGG - Intergenic
986463041 5:7992916-7992938 AAGGAGAAAAGGAGGGAGGCAGG + Intergenic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987392834 5:17392123-17392145 AAGGAAAAAAATAAAAAGGCTGG + Intergenic
987612853 5:20230000-20230022 AAGGAGAAAAAAATAGATGCTGG - Intronic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988216284 5:28277715-28277737 AAAGAGAGAAAGAAAGAGGGAGG - Intergenic
988839268 5:35067057-35067079 GAGGATAAGAAAAAAGAGGCCGG - Intronic
988994536 5:36702091-36702113 AAGGAGAAAAAGAGAAAGGAAGG + Intergenic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990877333 5:60500331-60500353 AAGGAGAAGAAGGAAGAACCTGG + Intronic
990967982 5:61470379-61470401 AGGGAGCATAAGAGAGAGTCTGG - Intronic
991515264 5:67428055-67428077 AAGAAAACTAAGAAATAGGCGGG - Intergenic
991536829 5:67678498-67678520 GAGTAGAATAAGAAAGAGAATGG + Intergenic
991562656 5:67970953-67970975 AAGGAGGAGGAGAAAGAGGTAGG + Intergenic
991577313 5:68118485-68118507 AAGGAATATAAAAAAGGGGCTGG + Intergenic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
991951682 5:71952791-71952813 AAGCTGAATTAGAAAGAGGCTGG + Intergenic
992014965 5:72566490-72566512 AAAAAGAAAAAAAAAGAGGCCGG + Intergenic
992193824 5:74320229-74320251 AAGGAGATGAAGAAAAAGGAGGG - Intergenic
992279047 5:75154579-75154601 AAAGAGAAAAAGAAAGAAGGAGG + Intronic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
992980549 5:82166616-82166638 AAGGAGAATAAAAAAGACTGGGG - Intronic
993201538 5:84822485-84822507 AAGGAAAATGAAAAAGAGGAGGG - Intergenic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
993881633 5:93369688-93369710 AAGGAGAAAAAGAGTGGGGCAGG - Intergenic
994019560 5:95007108-95007130 GAGGAGAATGAGAAAAAGGGGGG + Intronic
994910466 5:105898884-105898906 CAAGAGAATAAGACACAGGCAGG + Intergenic
994923995 5:106089765-106089787 AAGGATAATAAGAAAGTCGATGG + Intergenic
995034893 5:107522369-107522391 AAAGAGAGTGAGAAAGAGCCAGG - Intronic
995231246 5:109766471-109766493 AAGGACAATAAGGAAAAGTCAGG - Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995499348 5:112786869-112786891 AAAAAGAAAAAGAAAAAGGCAGG - Intronic
995690571 5:114821921-114821943 AAGTAGAAAAAAAAAGAGGGAGG - Intergenic
995735886 5:115298542-115298564 AAGAAGAAAAAGAAAGAAGGAGG + Intergenic
996136070 5:119843955-119843977 AAGGAGAAAAAGAAAGAGAGAGG - Intergenic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
996259877 5:121453905-121453927 AAAGAGAAAATGAACGAGGCTGG + Intergenic
996380976 5:122862317-122862339 AAGAAAAAAAAGAAAGAGGCTGG + Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996512513 5:124332797-124332819 TAGGAGAATAAGAAAGATAGGGG + Intergenic
996946155 5:129070692-129070714 AAAAAGAACAACAAAGAGGCAGG - Intergenic
996947448 5:129087713-129087735 AAAGAGAAGAAAAAGGAGGCAGG + Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997194940 5:131973110-131973132 AGGAAGAATGAGAAAGAGTCAGG + Intronic
997329208 5:133047022-133047044 AAAGAAAAAAAAAAAGAGGCCGG - Intergenic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997882766 5:137605001-137605023 GAGCAGAATTTGAAAGAGGCAGG - Intergenic
997982880 5:138480589-138480611 AAGAAAGAAAAGAAAGAGGCCGG - Intergenic
998535234 5:142924212-142924234 AAGGAGAGTTGGAAAGAGGAGGG - Intronic
998601999 5:143593979-143594001 AAGGAGAAAAAGAACGGAGCCGG + Intergenic
998696835 5:144650499-144650521 AAAGAAAATAGGAAAGAGGATGG + Intergenic
998810811 5:145964126-145964148 AAGGAAAGAAAGGAAGAGGCCGG - Intronic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
998859597 5:146429296-146429318 AGGGAGAGAAAGAAAGAGGTTGG - Intergenic
999148774 5:149413021-149413043 AGGGTGAAGGAGAAAGAGGCTGG + Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999444673 5:151629846-151629868 AAGAAGAAGAAGAAAGAAGAAGG + Intergenic
999839985 5:155414334-155414356 AAGGAGAATAAGAAAAAACATGG + Intergenic
999874013 5:155782319-155782341 AAGAAAAATAAAAATGAGGCCGG - Intergenic
999884434 5:155905414-155905436 AAGGAGGCTTAGAAAGAGGATGG + Intronic
1000127646 5:158262327-158262349 AAAGAGCATGAGAAAGAGGGAGG - Intergenic
1000230010 5:159307046-159307068 AAAGACAATATGAAAGAGGCCGG - Intergenic
1000322714 5:160147678-160147700 AAAGCAAACAAGAAAGAGGCCGG - Intergenic
1000444177 5:161299617-161299639 AGGGAGAGAAAGAAAGAGGAAGG - Intronic
1000822199 5:165998435-165998457 AAGAAGAATAAGAAAGGGCTTGG - Intergenic
1001040728 5:168333244-168333266 GAGGAGAAAGGGAAAGAGGCGGG - Intronic
1001347936 5:170924239-170924261 AAGGAATAAAAGACAGAGGCAGG - Intronic
1001501450 5:172239414-172239436 AAGGAAAAAAAGAGAGAGACGGG - Intronic
1001516531 5:172359101-172359123 AATGACAACAATAAAGAGGCAGG + Intronic
1001786539 5:174418709-174418731 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1001890973 5:175338239-175338261 AAGAAGAAGAAGAAGGAGACAGG - Intergenic
1002658653 5:180774217-180774239 AGGGAGCAAAAGAGAGAGGCAGG + Intergenic
1002676303 5:180916111-180916133 CAAGAGAGTAAGAAAGAGGAAGG + Intronic
1002969140 6:1996162-1996184 TAGAAGAATGAGAAAGAGGAAGG - Intronic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1003548210 6:7079037-7079059 AAGGAGGAAGAGAAAGAGGAAGG + Intergenic
1003698734 6:8439027-8439049 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1003737778 6:8896863-8896885 AAGGAAGAAAAGAAAGAGGAAGG - Intergenic
1003797074 6:9616398-9616420 AGGGAGAAAAAGAAGGAAGCAGG + Intronic
1004266676 6:14154112-14154134 ATGGACAATAAGCAGGAGGCAGG - Intergenic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004563245 6:16771330-16771352 AAGGAGAATCAGAAAGACCAAGG - Intergenic
1004791710 6:19033916-19033938 GAGGAGAATAGGAAATAGGCAGG - Intergenic
1005047968 6:21660161-21660183 AGGAAGAAAAAGAAAAAGGCCGG - Intergenic
1005285005 6:24315867-24315889 AAGGAGACCAAAAAGGAGGCTGG + Intronic
1005870875 6:29974050-29974072 ATATAGAATTAGAAAGAGGCTGG + Intergenic
1005979187 6:30823371-30823393 AAGAAGAAGAAGAAATGGGCTGG - Intergenic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1006137732 6:31906119-31906141 AAGGAGAAAGAGAAAGAAGTTGG - Intronic
1006751316 6:36379579-36379601 AAGAAGAAAAAGAAGAAGGCCGG + Intronic
1006822306 6:36907045-36907067 AAGGAGGAAAAGAAGGAGGGAGG - Intronic
1006911249 6:37565071-37565093 AAGGTGCAAGAGAAAGAGGCAGG - Intergenic
1007075498 6:39063657-39063679 AAGGAGGAGAAGAAAGAGCAGGG + Intronic
1007266813 6:40602529-40602551 AATGGGAAAAAGAAAGAGGCAGG - Intergenic
1007326006 6:41060123-41060145 AAGGAGAAGAAAAAAGAGAAGGG - Intronic
1007603736 6:43101230-43101252 AAAGAAAGAAAGAAAGAGGCTGG + Intronic
1007694521 6:43723920-43723942 AAGGCTAATGAGGAAGAGGCTGG + Intergenic
1007732615 6:43957272-43957294 AAAAAAAATAAGAAAAAGGCAGG + Intergenic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1007880634 6:45162232-45162254 AAGAAGAAGAAGAAAGAGCCAGG + Intronic
1008162134 6:48091632-48091654 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1008199268 6:48565761-48565783 AGAGAGACTAAGAGAGAGGCAGG - Intergenic
1008442147 6:51543913-51543935 AAGGAGGAAGAGAAAGAGGAAGG - Intergenic
1008475520 6:51931843-51931865 AAGGAGAATAAAGGAGAGGGAGG + Intronic
1008761507 6:54857503-54857525 AAGGTGAATAAGTAAGGGGTAGG + Intronic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009590935 6:65670088-65670110 AAGGAGAAACAGAAAGGTGCAGG - Intronic
1009881183 6:69568085-69568107 GAGGAGAATAACCAAGAGGTGGG + Intergenic
1010106686 6:72178291-72178313 AATAAGAATAAGAAAAAGACAGG - Intronic
1010290013 6:74124604-74124626 AAGAAGAAAGAGAAAAAGGCAGG - Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011227510 6:85123826-85123848 AGGGGGAATAAGTAAGAGTCAGG + Intergenic
1011305601 6:85922977-85922999 AAGGAGATGAAGAAGGGGGCGGG - Intergenic
1011675745 6:89731808-89731830 AAGGAGAAAAAGGAAAAGGTGGG - Intronic
1011695690 6:89910649-89910671 AAAGACGAAAAGAAAGAGGCAGG - Intergenic
1011713222 6:90076499-90076521 AAGGAGAATACAAAATAGGCAGG + Intronic
1011749400 6:90440009-90440031 AAAAAGAAAAAGAAAGAGGAAGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1012008849 6:93754110-93754132 AATGAGAGTAAAAAAAAGGCCGG - Intergenic
1012449203 6:99337253-99337275 TAGGAAAAAAAAAAAGAGGCAGG + Intronic
1012528375 6:100204629-100204651 AAAGGGAATAAGAAAGAGAGGGG + Intergenic
1012757411 6:103249440-103249462 AAGGAAAACAAAAAAAAGGCAGG + Intergenic
1013041319 6:106436587-106436609 AAGTAGAATAAGATTGCGGCCGG - Intergenic
1013041701 6:106440561-106440583 AAAGAAAAAAAGAAAGGGGCCGG - Intergenic
1013080599 6:106808640-106808662 AAGGAGAAAAAGAGAGAGCAGGG - Intergenic
1013172636 6:107650683-107650705 AAGGAGAAGGAGAAAGATGGGGG - Intronic
1013183898 6:107740885-107740907 AAGGAGGAGACGCAAGAGGCAGG - Intronic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1014625889 6:123724159-123724181 ATGGAGAAAATGAAATAGGCAGG - Intergenic
1015063392 6:128996209-128996231 CAGGAGAATGAGAAAGAGTTTGG + Intronic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015575576 6:134667399-134667421 AAAGAGAATGAGTAAAAGGCTGG - Intergenic
1015798742 6:137039420-137039442 AAGGGCAATAGGAGAGAGGCTGG + Intronic
1015810908 6:137161385-137161407 AGGGAGAGAAAGAAAGAGGGAGG + Intronic
1015845688 6:137518538-137518560 AAGGAGAAAAAAAAAGTGGGGGG - Intergenic
1015900773 6:138063449-138063471 AAAGAAAGAAAGAAAGAGGCCGG + Intergenic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1016600112 6:145848809-145848831 AAGGAGAATAGGAAGGAAGGAGG + Intergenic
1017049764 6:150379406-150379428 TTGAGGAATAAGAAAGAGGCTGG - Intronic
1017092335 6:150771114-150771136 AAGAAAAATAAGAATGAGGGTGG + Intronic
1017347034 6:153396025-153396047 AAAGAAAGAAAGAAAGAGGCAGG - Intergenic
1017483524 6:154881653-154881675 AAATAAAAAAAGAAAGAGGCAGG + Intronic
1018209387 6:161465811-161465833 AAGAAGAAAAAGAAAGAGAATGG - Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1019693236 7:2429370-2429392 AAGTACAAAAAAAAAGAGGCCGG - Intronic
1019759284 7:2797439-2797461 AAGGAAAAAAAAAAAAAGGCCGG - Intronic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1019993603 7:4709103-4709125 AAGGAAAAAAGAAAAGAGGCTGG + Intronic
1020088718 7:5325226-5325248 AAGAAGAAAGGGAAAGAGGCTGG - Exonic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020237293 7:6366267-6366289 AAAGAAAAGAAGAAAAAGGCCGG + Intergenic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1020446129 7:8269974-8269996 AAGGAGAAAAACAAAGATGAGGG + Intergenic
1021072209 7:16254855-16254877 AAAGAAAGAAAGAAAGAGGCAGG + Intronic
1021079744 7:16349724-16349746 AAAGAGAATGAGAAAGAGTACGG + Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021289544 7:18825640-18825662 AAGGAGAAGAAGAAAAACGTGGG + Intronic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1021874186 7:25033079-25033101 AGGGGGCATGAGAAAGAGGCAGG + Intergenic
1021908119 7:25355793-25355815 TAGGACAATGAGACAGAGGCTGG - Intergenic
1022001850 7:26233494-26233516 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1022157075 7:27671427-27671449 AAGCATAGAAAGAAAGAGGCAGG + Intergenic
1022215234 7:28253204-28253226 AAGGAGAAGGAGAAGGAAGCAGG - Intergenic
1022355973 7:29614861-29614883 AAAGAGAAAAGGAAAGAAGCAGG + Intergenic
1022376128 7:29813121-29813143 ATGGGGAAGAAGAAAGAGCCTGG - Intronic
1023183273 7:37507882-37507904 AAGGAGAATGGGACAGAGACAGG + Intergenic
1023632587 7:42178929-42178951 AAGAGGAAGAAGAAAGAGCCAGG + Intronic
1023679055 7:42664857-42664879 AAGGGGGATAAAAAGGAGGCAGG + Intergenic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024062283 7:45708178-45708200 TAGGAGACTAAGAGAGAGGCAGG - Intronic
1024167055 7:46745841-46745863 CAACAGAATAAGAAAGAGGCAGG + Intronic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024568594 7:50705377-50705399 AAGGGGAAAAAGAGAGAAGCTGG - Intronic
1024741589 7:52360790-52360812 AATGTGTATAAGAATGAGGCAGG - Intergenic
1024922777 7:54577336-54577358 ATGGTGAAAAAGGAAGAGGCAGG - Intergenic
1025220064 7:57099925-57099947 AAAGAGAAAAAGAAACATGCTGG + Intergenic
1025630845 7:63271505-63271527 AAAGAGAAAAAGAAACATGCTGG + Intergenic
1025713694 7:63933527-63933549 AAAGAGAGCAATAAAGAGGCCGG + Intergenic
1026040458 7:66864065-66864087 AAAGAGAGAAAGAAAGAAGCAGG - Intergenic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026229216 7:68468921-68468943 AAGAAGAAAAAGAGAGAGGGAGG + Intergenic
1026250546 7:68666224-68666246 AAGGAGACAGAGAGAGAGGCAGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1026494119 7:70888062-70888084 AAAGAGAAAAAGAGAGAGGAAGG + Intergenic
1026610405 7:71854206-71854228 ATGGAGAGAAAGAAACAGGCCGG + Intronic
1026643537 7:72148606-72148628 AAAGAAAAGAAAAAAGAGGCTGG + Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026875677 7:73877784-73877806 AAAAAGAAAAAGAAAGAGGTCGG - Intergenic
1026967759 7:74451251-74451273 AAAGAAAAAGAGAAAGAGGCAGG + Intergenic
1026988279 7:74568664-74568686 AAGAAGAAAAAGAAAGAAACAGG + Intronic
1027046247 7:74993200-74993222 AAAGAGAAAAAGAAAAAGGAAGG + Intronic
1027365495 7:77453498-77453520 AAGATGAATTAGAAAGATGCAGG + Intergenic
1027522449 7:79226610-79226632 AAGGAGGATAGGAAAGAGAAGGG - Intronic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1027775082 7:82454914-82454936 CAGGAAAATGAGACAGAGGCTGG + Intergenic
1027832846 7:83202111-83202133 AGGGAGGAAAAGAAAGAGGGAGG - Intergenic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1027969901 7:85066239-85066261 AAGGAGAAAAAGAGAGAGAAAGG + Intronic
1028207691 7:88035097-88035119 AAGGAGCAAGAGAATGAGGCAGG - Intronic
1028256013 7:88598482-88598504 AAGAAGAACAAGAAAGCGGAGGG + Intergenic
1028844377 7:95462907-95462929 AAGGTGAATGAGAAAGAGAAAGG + Intergenic
1029181666 7:98706311-98706333 AAGGAGAAAAAGAAAAAGAAGGG - Intergenic
1029187284 7:98748279-98748301 AAGGAGAAAGAGGGAGAGGCAGG + Intergenic
1029520253 7:101056309-101056331 AAGGAGAAGAAGAAAGTCGCAGG - Intronic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1029870963 7:103692424-103692446 AAGAAGAAGAGGCAAGAGGCAGG - Intronic
1030171362 7:106606154-106606176 AAGGAAAATGAGACAGTGGCAGG - Intergenic
1030523828 7:110629953-110629975 AAGGAGAAGAAGAGAGAGCTGGG - Intergenic
1030842527 7:114373550-114373572 AAGTAGAATAAGAAAGAACTGGG - Intronic
1031014899 7:116562875-116562897 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031612327 7:123842821-123842843 AAGGAAAACAAAAAAAAGGCAGG - Intronic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032158093 7:129486900-129486922 AAAGAGAAATATAAAGAGGCTGG - Exonic
1032204535 7:129850508-129850530 AAGGGCAATATGAAAGATGCAGG + Intronic
1032655795 7:133928519-133928541 AAGGTGAGTATGAAAGAGGATGG - Intronic
1032707210 7:134431821-134431843 CAGGAAGAAAAGAAAGAGGCTGG + Intergenic
1032937716 7:136752603-136752625 AAAGAGAAGAACAAAGAGTCAGG + Intergenic
1032989961 7:137382758-137382780 AAGTAGAACAAGAAAGAAGGTGG + Intronic
1033148039 7:138887958-138887980 AAGGAGAACAGGGAAGAGGACGG + Intronic
1033201796 7:139379365-139379387 AATGAGAAAAAAAAAAAGGCAGG - Intronic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1033297717 7:140156395-140156417 AAGGATAATAAGCAAGAGATAGG - Intronic
1033407187 7:141081337-141081359 AAGGATATAAAGAAAGAGCCTGG + Intronic
1033592055 7:142817373-142817395 AAGGAGAATTACAAAGTGGATGG - Intergenic
1033850571 7:145489338-145489360 AAGAAGAACAAGATTGAGGCAGG - Intergenic
1034331161 7:150283325-150283347 AAGGGGAACTAGAAAGAGACTGG - Intronic
1034393345 7:150802033-150802055 AAGGAGAAAGAAGAAGAGGCAGG - Intronic
1034456833 7:151175221-151175243 AAGGAGCAGATAAAAGAGGCAGG + Intergenic
1034613519 7:152394164-152394186 AAGGAGATCAAGGAAGAAGCAGG - Intronic
1034666883 7:152826528-152826550 AAGGGGAACTAGAAAGAGACTGG + Intronic
1035110779 7:156479854-156479876 AACAAGAAAAAGAAAGAGGAGGG + Intergenic
1035110784 7:156479888-156479910 AAGGAGATGAAGACAGAGGGAGG + Intergenic
1035366987 7:158355434-158355456 CAGGAGAGTGAGAGAGAGGCAGG - Intronic
1035702694 8:1648723-1648745 AGGGAGAGGAGGAAAGAGGCCGG - Intronic
1035925351 8:3722044-3722066 CAGAAGCATAAGGAAGAGGCCGG + Intronic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1036978755 8:13444970-13444992 AAGGAGAGAACGAAAAAGGCAGG + Intronic
1037004970 8:13767105-13767127 ATGGAGAATTAGAGAGAGGTGGG + Intergenic
1037180976 8:16005425-16005447 AAGAAGACTAAAGAAGAGGCCGG + Intergenic
1037218216 8:16484057-16484079 AAGGAGAAGAAGAAAGGGTAGGG + Intronic
1037266854 8:17072842-17072864 AAGGAGAACAAGAAGGAACCAGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037754682 8:21703249-21703271 AAGGAGAAAAAGAAGGGGGTGGG + Intronic
1038276487 8:26125732-26125754 AAGGAGAAAAGGGAAGAGGTCGG + Intergenic
1038290882 8:26248887-26248909 AAATAGAAAAATAAAGAGGCTGG - Intergenic
1038353059 8:26798483-26798505 AATGAGAATAAGCAGGAGGTAGG - Intronic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1039557317 8:38485760-38485782 AAGGAAAAGAAGAGAGATGCCGG + Intergenic
1039564831 8:38543855-38543877 AGGGAGAATAGGAAAGAGGAGGG + Intergenic
1039706240 8:40010351-40010373 GGGGAGAATAAGAAAGAGTGAGG + Intronic
1039839543 8:41284156-41284178 AAGAATAATAAGAAAGAGTCTGG + Intronic
1040639086 8:49310822-49310844 AAAGAGAAAAAGAGAGAGGAGGG + Intergenic
1041039951 8:53836842-53836864 AAAGAGAATAGGATAGAAGCTGG + Intronic
1041052159 8:53945617-53945639 AAAGTGATTAAGAAAGTGGCCGG + Intronic
1041100322 8:54390579-54390601 AAAAAGAAAAAGAAAGAGTCGGG - Intergenic
1041507765 8:58620254-58620276 AAGAAGAATAAGCAACAGCCAGG + Intronic
1041551708 8:59110294-59110316 AATGTTAATAATAAAGAGGCAGG - Intronic
1041682070 8:60604136-60604158 CAGGAGAAAGAGAAAGAGGTGGG - Intronic
1041761638 8:61373685-61373707 AAGGAGAATAGGAAGGAGAAAGG - Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042280437 8:67050295-67050317 TAGGAGAAAAAAAAAGAGGCCGG - Intronic
1042548537 8:69972555-69972577 AAGGAGTCAATGAAAGAGGCAGG + Intergenic
1042601730 8:70505632-70505654 AAAGAGAAAAATAAAGAGGGAGG - Intergenic
1042839873 8:73112727-73112749 AAAGAGAAAGAGAAAGAGGGAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043196963 8:77307336-77307358 AAGGAGAATCAAAAAGAGAATGG + Intergenic
1043374744 8:79635918-79635940 AAAGAAAGAAAGAAAGAGGCTGG + Intronic
1043419546 8:80084523-80084545 AAGGAGAAACAGAAACAGACAGG + Intronic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043790105 8:84455061-84455083 AAGGGGAATAAAAATGAGCCAGG + Intronic
1043981987 8:86653635-86653657 TATGAGAACAAGAAAGAAGCGGG + Intronic
1044878971 8:96702397-96702419 AGGGAGAATAAGAGAGAGAAAGG + Intronic
1045024111 8:98070358-98070380 AAAGAAAAGAAAAAAGAGGCCGG + Intronic
1045370147 8:101514913-101514935 AAGGAGAAGAAGAAAGAACAAGG - Intronic
1045828091 8:106425213-106425235 AAAGAAAAGAAAAAAGAGGCAGG - Intronic
1046048300 8:108988772-108988794 AAAGAGAAAGAGAGAGAGGCAGG + Intergenic
1046230123 8:111345290-111345312 AAAAAGAAGAAGAAAGAGGAAGG + Intergenic
1046268326 8:111859914-111859936 AAAGAAAGAAAGAAAGAGGCTGG - Intergenic
1046739588 8:117814025-117814047 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1046750577 8:117922610-117922632 AAGGAGAACAAGAGAGAAGCTGG + Intronic
1046838794 8:118833379-118833401 GAGGAGAAGAAGGAAGAGGAGGG + Intergenic
1046873239 8:119226644-119226666 AAGGCAATTAAGAAAGAGGCTGG + Intronic
1047026192 8:120827047-120827069 TAGGAAAGGAAGAAAGAGGCAGG - Intergenic
1047120889 8:121903357-121903379 AAGGAGGATAAAATAAAGGCAGG + Intergenic
1047135961 8:122078733-122078755 GAGGAGGAGAAGAAAGAAGCAGG + Intergenic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1047371248 8:124257828-124257850 AAATAAAATAAAAAAGAGGCTGG + Intergenic
1047588018 8:126295181-126295203 AATTAGAAAAAGAAAGAGACTGG + Intergenic
1047723985 8:127668825-127668847 TAAGAGAACAAGACAGAGGCAGG + Intergenic
1047809754 8:128395832-128395854 AAGGAAAATAGGAAAGAGAGAGG - Intergenic
1047930447 8:129723399-129723421 AAGGAGAAGAAAAAATAGCCAGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048200427 8:132369510-132369532 AGGGAGTATAAAAATGAGGCTGG + Intronic
1048217693 8:132511550-132511572 GAGGAGAGCAAGAGAGAGGCAGG + Intergenic
1048220096 8:132533183-132533205 GAGGAGGATGAGAAAGAGGAAGG + Intergenic
1050328560 9:4522035-4522057 AAAGAAAAAAAAAAAGAGGCAGG - Intronic
1050574342 9:6977569-6977591 AAGTAAAATAAGATGGAGGCAGG - Intronic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051190609 9:14507723-14507745 AGTGAGAAGAAGAAAGAGGTTGG + Intergenic
1051208231 9:14712882-14712904 AATGAGGATAAGAAAGAGAAGGG + Intergenic
1051534992 9:18147360-18147382 AACCAGAATAAGAAAGACGTTGG + Intergenic
1051546737 9:18283932-18283954 AAGAAGAAGAAGAAGAAGGCTGG + Intergenic
1051594647 9:18812126-18812148 AACTAGAATAGCAAAGAGGCAGG + Intronic
1051822516 9:21184209-21184231 AAGGAGAGAAAGAAAAAGGAAGG - Intergenic
1051931112 9:22387465-22387487 AAAGAGAATATAAAAGAGACTGG - Intergenic
1051989382 9:23133119-23133141 AAGGAGAAAAAGAAACAGAGTGG + Intergenic
1052117995 9:24672186-24672208 AAGGAGAAAAAAAAACATGCAGG - Intergenic
1052179500 9:25506671-25506693 ATGGAGAAGAAGAAAGAGAAAGG + Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052606637 9:30712371-30712393 AAGCAAAATAAGAGAGAGGAAGG + Intergenic
1053018589 9:34678622-34678644 AAAAAGAAAAAGAAAGAGCCAGG - Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053123066 9:35560538-35560560 AGCGAGAAAAAGAAAGGGGCAGG + Exonic
1053242379 9:36506620-36506642 TAAGAGAAGAAGAAAGGGGCTGG - Intergenic
1053512221 9:38697435-38697457 AAGGAGAAAAAGAAGGAGTTAGG - Intergenic
1054887050 9:70210456-70210478 ATGGAAAACAAGAAAAAGGCAGG - Intronic
1055166314 9:73199658-73199680 GAGGAGGAAAAGAAAAAGGCAGG + Intergenic
1055462978 9:76536867-76536889 AAGAAGAGAAAGAGAGAGGCAGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056328016 9:85497166-85497188 AAGAAGAAGAAGAAAGGAGCGGG + Intergenic
1056466910 9:86866096-86866118 ACTGAGAATAAGGAAGAGGTTGG + Intergenic
1056530950 9:87487144-87487166 AAAGAAAGTAAGGAAGAGGCGGG - Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057848658 9:98546624-98546646 AAGGAGGATAAAAAAGTGACAGG - Intronic
1057862492 9:98652593-98652615 AAGGAGAGTGGGGAAGAGGCGGG - Intronic
1058102226 9:100929424-100929446 AAGGAGAATTGGAAAGAGTAAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059226118 9:112674768-112674790 AAGGAGGAGAGGAAAGAGGGGGG - Intergenic
1059428450 9:114235860-114235882 AAAGAGAGAAAGCAAGAGGCTGG - Intronic
1059733230 9:117076847-117076869 AAGGAAAAAAATATAGAGGCAGG - Intronic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1060180840 9:121532638-121532660 AAGTAAAAGAAAAAAGAGGCCGG - Intergenic
1060273411 9:122164234-122164256 AAGGAGAAAAAGAAGAAGGGAGG + Intronic
1060440890 9:123638310-123638332 AAGATGAAAAAGAAAAAGGCAGG + Intronic
1060481056 9:124017188-124017210 AAGGAAAAAAAGAGAGAGGGAGG - Intronic
1060619271 9:125048561-125048583 AAGAAGAAGAAGAAAAGGGCAGG + Intronic
1061358358 9:130123496-130123518 AAGAAAAAAAAGAAATAGGCCGG - Intronic
1061421305 9:130474175-130474197 AAGGAGAGTAAAAAGAAGGCAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062143711 9:134976649-134976671 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1062160927 9:135079323-135079345 AAGAAGAAGAGGACAGAGGCTGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203572686 Un_KI270744v1:146580-146602 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1185501716 X:601800-601822 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185501748 X:602078-602100 AAAGAGAAGAAGAAAAAGGAAGG - Intergenic
1185510425 X:660049-660071 AAGAAGAAGAAGAAGAAGGCTGG - Intergenic
1185534416 X:849484-849506 AAGGAAACAAAGAAAGAGGAAGG - Intergenic
1185545366 X:939389-939411 AAGGAGAAAGAGAGAGAGGGAGG - Intergenic
1185804516 X:3045146-3045168 AAAGAGAAAAATAAAGAGGTGGG + Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1185830196 X:3294303-3294325 AAGGAGAAGGAGAAAGAAGGAGG - Intergenic
1186054117 X:5630558-5630580 AATGAGAACAAGAAAGAAACAGG - Intergenic
1186311067 X:8319684-8319706 ATGGAGAAGAATAAACAGGCTGG - Intergenic
1186312920 X:8339779-8339801 AAGAAGAAAAAGAAAGAAGAGGG + Intergenic
1186443703 X:9607739-9607761 AAGTAGAACATGAAAGAGGATGG + Intronic
1186576759 X:10775088-10775110 GAGGAGAATGAAAAAGAGGGAGG + Intronic
1187177926 X:16913544-16913566 AAGGAAAGAAAGAAAGAGGGAGG - Intergenic
1187414250 X:19078894-19078916 GGGGAGAAAAAGAGAGAGGCAGG + Intronic
1187417902 X:19109045-19109067 AAGAAGAAGAAGAAAGAAGAAGG + Intronic
1187696156 X:21923157-21923179 AAGGAGAGAAAGAAAGAGAAAGG + Intergenic
1188116362 X:26249161-26249183 AAGGAAAATAACAAAAAGACAGG - Intergenic
1188303045 X:28529027-28529049 AGGGAGAAAATGAAAGAGGGAGG + Intergenic
1188450196 X:30301069-30301091 AAGGAAAGAAAGAAAGAGGGAGG + Intergenic
1188538080 X:31219404-31219426 GTGGAGAATAAGAGAGAGGGCGG - Intronic
1188568128 X:31550259-31550281 AAGGAGAATATGAAAAGGGAGGG - Intronic
1188591002 X:31834858-31834880 AAGGAGAAAAAAAAAAAGGAAGG + Intronic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188737610 X:33738209-33738231 AAGGAGAAAAGGAGGGAGGCTGG + Intergenic
1189120914 X:38393978-38394000 CTAGAGAATAAGAGAGAGGCAGG - Intronic
1189164502 X:38847178-38847200 AAGATGAATAGGAAAGAGACAGG + Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189774132 X:44455134-44455156 AAGAAGAAAAAAAAAAAGGCTGG - Intergenic
1189805108 X:44727709-44727731 AAGAAGAAGAAGAAGAAGGCCGG + Intergenic
1190047480 X:47124281-47124303 AAGAAGAAAGAGAAAGAGGCCGG + Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190680082 X:52819069-52819091 AAGGAATAGAAGGAAGAGGCAGG - Intergenic
1190704087 X:53011552-53011574 AAGAAGAAAAAAAAAGAGGCCGG - Intergenic
1190745500 X:53319990-53320012 AAGGAAAAAAAAAAAAAGGCGGG + Intronic
1190757408 X:53412942-53412964 AAGGAGAAGAAGAAGGAGCTGGG - Exonic
1190887548 X:54542929-54542951 AAGGAGAAAAAAAAAGAGAATGG - Intronic
1190921517 X:54857760-54857782 ATGGAAAACAAGAAAAAGGCAGG - Intergenic
1190937384 X:55008912-55008934 AAACAGAATGAGAAAGAGGAAGG - Exonic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191110265 X:56798870-56798892 AAGGAGAACGAGAAAAAGACAGG - Intergenic
1192033255 X:67537627-67537649 AAGTAGTATAAGAAAGAGAGGGG - Intergenic
1192183634 X:68931345-68931367 GAGGAGAGGAAGAAAGATGCAGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192272041 X:69589907-69589929 AAGAAGAAGAAGAAAGAAGAAGG - Intergenic
1192474643 X:71429673-71429695 GAGGAGAATAAGACAGAGACCGG + Intronic
1192482351 X:71496594-71496616 AAGGAGTCAAAGAGAGAGGCAGG - Intronic
1193511909 X:82412586-82412608 AATGAAAAAAAAAAAGAGGCTGG - Intergenic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194390114 X:93307010-93307032 AAGGAGACTGAAAAAGTGGCTGG + Intergenic
1194559065 X:95397690-95397712 AAGGAGCAAGAGAAAGAGGGGGG - Intergenic
1194739324 X:97553687-97553709 AAGAAGAAGAAGAAAATGGCTGG + Intronic
1194975595 X:100393437-100393459 AAGGAGAGAGAGAAAGAAGCAGG - Intronic
1195009070 X:100717525-100717547 AGGGAGAATGCGGAAGAGGCAGG + Intronic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195264365 X:103165679-103165701 AAAGAAAGAAAGAAAGAGGCAGG - Intergenic
1195369718 X:104161551-104161573 AAAAAGAAGAAGAAAGAGGCTGG + Intergenic
1195864840 X:109420238-109420260 AAGAAGAAAAAGAAAGAGAGAGG + Intronic
1195965185 X:110423343-110423365 AAAAAGAAAAAGAAAGAGGAAGG + Intronic
1196001046 X:110786483-110786505 AAGGAGAATAGTATAGGGGCTGG - Intronic
1196050096 X:111295865-111295887 ATGGAGAAGAAGAAAGGGCCAGG + Exonic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196396730 X:115271679-115271701 AATGAGAAAAAAAAAAAGGCTGG + Intergenic
1196416690 X:115478764-115478786 AAGGAAAGAAAGAAAGAGGAAGG + Intergenic
1196552937 X:117051715-117051737 AATGAGTATAAGATACAGGCTGG - Intergenic
1196824959 X:119733730-119733752 AAAGAAAAAAAAAAAGAGGCCGG + Intergenic
1197744528 X:129922711-129922733 AAGGAAAAAAAAAAGGAGGCTGG - Intronic
1198004604 X:132480057-132480079 AAACAGAATAAGATCGAGGCTGG - Intronic
1198217444 X:134568945-134568967 AGAGAGAAAAAGAGAGAGGCAGG - Intronic
1198383359 X:136105001-136105023 AAGGAAAAAAAGAAAGATGGAGG + Intergenic
1198529889 X:137541981-137542003 AAGGAGACTAAGAAACAGCATGG - Intergenic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1198852541 X:140980497-140980519 AAGAAGAATAATGAAGAGGAAGG - Intergenic
1199386961 X:147233919-147233941 AATGAGGATCACAAAGAGGCAGG + Intergenic
1199771302 X:150976896-150976918 AAAGAAAGAAAGAAAGAGGCCGG + Intergenic
1199892558 X:152101323-152101345 AATGAGTATAACAAAGTGGCAGG + Intergenic
1199937907 X:152595148-152595170 AAGGAGAAACAGACACAGGCAGG - Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic
1200414211 Y:2890864-2890886 AAGGAGGAGAAGGAAGAGGGAGG + Intronic
1200692078 Y:6316450-6316472 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1200713636 Y:6512489-6512511 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1200757015 Y:6999607-6999629 AAGTAGAATATGAAAGAGGATGG + Intronic
1200833306 Y:7708947-7708969 ATGGAAAATAAAAAAAAGGCAGG - Intergenic
1201020291 Y:9649552-9649574 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1201043194 Y:9858277-9858299 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201254417 Y:12092731-12092753 AAGGAGAGTAGGAAAAAGGAAGG + Intergenic
1201474283 Y:14364080-14364102 AAGGAGGAGAAGAAAGGGGCAGG + Intergenic
1201498589 Y:14617266-14617288 AAGAAGAAGAAGAAAAAAGCAGG - Intronic
1201536844 Y:15058590-15058612 AAGAAGAAAAAAAAAAAGGCCGG - Intergenic
1201740051 Y:17313939-17313961 ATGGAAAATAAAAAAAAGGCAGG + Intergenic
1201796006 Y:17896950-17896972 ATGGAAAACAAAAAAGAGGCAGG + Intergenic
1201805549 Y:18009035-18009057 ATGGAAAACAAAAAAGAGGCAGG - Intergenic
1201988081 Y:19991688-19991710 ATGGAGAACAAAAAAAAGGCAGG - Intergenic