ID: 946119247

View in Genome Browser
Species Human (GRCh38)
Location 2:217494879-217494901
Sequence GCACAGTGCTCAGCCCGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946119247_946119252 12 Left 946119247 2:217494879-217494901 CCAAAACGGGCTGAGCACTGTGC 0: 1
1: 0
2: 0
3: 10
4: 118
Right 946119252 2:217494914-217494936 CTGGGTCTCAATGTCCTCACCGG 0: 1
1: 0
2: 10
3: 64
4: 344
946119247_946119253 19 Left 946119247 2:217494879-217494901 CCAAAACGGGCTGAGCACTGTGC 0: 1
1: 0
2: 0
3: 10
4: 118
Right 946119253 2:217494921-217494943 TCAATGTCCTCACCGGTGTTAGG 0: 1
1: 0
2: 0
3: 4
4: 80
946119247_946119250 -7 Left 946119247 2:217494879-217494901 CCAAAACGGGCTGAGCACTGTGC 0: 1
1: 0
2: 0
3: 10
4: 118
Right 946119250 2:217494895-217494917 ACTGTGCGGGTCTCTCTCACTGG 0: 1
1: 0
2: 0
3: 7
4: 95
946119247_946119251 -6 Left 946119247 2:217494879-217494901 CCAAAACGGGCTGAGCACTGTGC 0: 1
1: 0
2: 0
3: 10
4: 118
Right 946119251 2:217494896-217494918 CTGTGCGGGTCTCTCTCACTGGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946119247 Original CRISPR GCACAGTGCTCAGCCCGTTT TGG (reversed) Intronic
902833141 1:19030340-19030362 GCACAGTGCTCAACCCATAGGGG + Intergenic
903877468 1:26485285-26485307 GCACAGTGTACAGGCCGCTTGGG + Intergenic
904853507 1:33477756-33477778 GCACAGTGCTCAGCACATATAGG - Intronic
905737391 1:40339197-40339219 GCACAGTGCCCAGAACGCTTTGG + Intergenic
906528090 1:46508151-46508173 GCACAGGGCTGAGCCCATGTGGG - Intronic
912852339 1:113137933-113137955 GCACAGTGCTCAACACATTTTGG + Intergenic
914452228 1:147802782-147802804 GCTCAGTGCACAGCCTGCTTGGG - Intergenic
914911103 1:151787681-151787703 CCACTGTGCCCAGCCTGTTTTGG - Intronic
918561028 1:185867781-185867803 CCACTGCGCTCAGCCTGTTTTGG - Intronic
919860707 1:201737969-201737991 TCATTGTGCTCACCCCGTTTCGG + Intronic
922385886 1:225081981-225082003 ACACAGTACTCAGCTGGTTTGGG - Intronic
924550411 1:245070943-245070965 ACACAGTGCTCATCCCCTCTGGG + Intronic
1064374090 10:14779978-14780000 CCACTGTGTCCAGCCCGTTTGGG - Intergenic
1064759771 10:18606041-18606063 GCACTGTGCTGAACCCTTTTAGG - Intronic
1066220609 10:33334493-33334515 GTACAATCCTCAGCCCGTCTTGG + Exonic
1068051091 10:51950500-51950522 CCACAGTGCTCTGCCCCTTGCGG + Intronic
1069994266 10:72332931-72332953 GCACATGGCTCAGCCCGTCTAGG + Exonic
1070718801 10:78742210-78742232 GCACTGTGCTGAGCCCTTTCTGG + Intergenic
1070740481 10:78900085-78900107 GCCCATTCCTCAGCCCCTTTGGG - Intergenic
1073991624 10:109268228-109268250 GAACAGTGCTCTGCCCCATTGGG + Intergenic
1080800537 11:35605910-35605932 GCAGAGAGCTTAGCCAGTTTAGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1085331901 11:75659192-75659214 CCACCGCGCTCAGCCCCTTTAGG - Intronic
1090205257 11:124880284-124880306 GCACAGGGCTCAGCCAGCCTGGG - Intronic
1091312257 11:134582975-134582997 ACACAGTGCTCATACCCTTTAGG - Intergenic
1094141066 12:27182537-27182559 CCACCGTGCCCAGCCTGTTTAGG - Intergenic
1097052398 12:56231205-56231227 GCACAGTCCTCAGGATGTTTCGG + Exonic
1098164946 12:67685984-67686006 CCACTGTGCCCAGCCTGTTTTGG + Intergenic
1102854205 12:116278510-116278532 GCACTGTGCTAAGGCCGTGTTGG + Intergenic
1103217821 12:119216391-119216413 GCACTGTGCTCAGCACTTTAAGG - Intronic
1104026549 12:125031759-125031781 CCTCAGTGATCCGCCCGTTTCGG + Intergenic
1104087888 12:125492793-125492815 ACACAGGGCCCAGCCCATTTTGG - Intronic
1106082660 13:26513174-26513196 CCACAGCGCCCAGCCTGTTTGGG + Intergenic
1108605297 13:52031187-52031209 GCAATGTGCTGAGCCAGTTTTGG - Exonic
1108746993 13:53405959-53405981 CCACTGTGCTCAGCCCCTTACGG - Intergenic
1113232945 13:108236140-108236162 GCACAGTGCTGAGCATGTTGTGG + Intergenic
1120811361 14:88807150-88807172 CCACAGTGCCCAGCCCGATGGGG + Intergenic
1122558209 14:102592719-102592741 GCTCCGCGCTCTGCCCGTTTGGG + Exonic
1125919833 15:43518724-43518746 ACACAGTGCTCAGCCAGTGCTGG - Intronic
1128596139 15:68951709-68951731 CCACAGCGCCCAGCCCATTTTGG + Intronic
1128993847 15:72282213-72282235 CCACCGTGCCCAGCCAGTTTTGG - Intronic
1130905353 15:88236383-88236405 CCACAGTGCCCAGCCTGTTTTGG - Intronic
1131436294 15:92425440-92425462 GCACAGTGCTTTGCCCCATTGGG - Intronic
1131823329 15:96295028-96295050 GCACAGTGCACCACCTGTTTTGG - Intergenic
1135160975 16:20096092-20096114 GCACAGTGCTGAGCCCATAATGG - Intergenic
1140389401 16:74572221-74572243 CCACCGTGCCCAGCCCCTTTGGG - Intronic
1141860768 16:86714572-86714594 GCACATTACTCAGCCTCTTTGGG + Intergenic
1144526839 17:15997813-15997835 CCACCGTGCCCAGCCAGTTTTGG - Intronic
1144853554 17:18256228-18256250 GAACATTGCTCAGCCAGTCTTGG + Intronic
1145764789 17:27451155-27451177 GCACAGTGCTGAGCACATATTGG + Intergenic
1147564203 17:41526858-41526880 CCACAGTGCCCAGCCCCTGTAGG + Intronic
1148965115 17:51428430-51428452 GCAAACTGCTCAGCCCCTTTAGG + Intergenic
1151606986 17:75143885-75143907 CCACTGTGCCCAGCCCCTTTTGG - Intronic
1154227366 18:12518241-12518263 GCTCAGTGGTCTGCCCGTCTTGG + Intronic
1156477705 18:37416635-37416657 GCACACTGCTCAGCCAGCCTGGG + Intronic
1158949974 18:62485281-62485303 GCACAGTGCTTTGCTGGTTTGGG - Intergenic
1165863438 19:38921514-38921536 GCACGGTGCTCACCACGTCTGGG + Exonic
1166919308 19:46218059-46218081 GAACAGGGCTCAGGCCGTTTGGG + Intergenic
1167566404 19:50260137-50260159 CCACAGTGCCCAGCCAGTATTGG - Intronic
1168553377 19:57318268-57318290 CCACCGTGCCCAGCCCATTTTGG + Intergenic
925493974 2:4425530-4425552 GCACACTGCTCAGCCTTTTCTGG + Intergenic
926174802 2:10581232-10581254 GCAAAGTGCTCAAGCCTTTTTGG + Intronic
929005240 2:37387292-37387314 GGACTGTGCTCAGCTTGTTTGGG - Intergenic
929534068 2:42769731-42769753 GCACACCACTCAGCCTGTTTGGG - Exonic
929816537 2:45237437-45237459 GCACAGTGCTGAGCCTTGTTGGG + Intergenic
934676397 2:96252800-96252822 CCACAGTCCTCAGCCCCTCTGGG + Exonic
937895837 2:126976386-126976408 GCACAGTGGCCAGCCCTTTCGGG + Intergenic
937952983 2:127402446-127402468 GCACAGTGCTCTGCCACTGTTGG - Intergenic
938243955 2:129763319-129763341 GCTCAGTGCTCAGCCCACTAGGG + Intergenic
944343435 2:198631543-198631565 GAACAGTGCTCAGCTCAGTTAGG - Intergenic
946119247 2:217494879-217494901 GCACAGTGCTCAGCCCGTTTTGG - Intronic
946531682 2:220577465-220577487 GCAGAGTGCTCAGCACATATGGG + Intergenic
947195919 2:227567647-227567669 CCACCATGCCCAGCCCGTTTAGG - Intergenic
1169103591 20:2974401-2974423 CCACTGTGCCCAGCCCATTTTGG + Intronic
1170349404 20:15422600-15422622 GCCCAGTGCTCAGCACATTTCGG + Intronic
1171811872 20:29750880-29750902 GGAAAGTTCTCAGCACGTTTAGG + Intergenic
1172547840 20:35775467-35775489 CCACCGTGCCCAGCCAGTTTTGG - Intronic
1176511169 21:7749403-7749425 CCACTGTGCTCAGGCCGTTTTGG + Intronic
1178319083 21:31591278-31591300 CCACTGTGCCCAGCCTGTTTTGG - Intergenic
1178645283 21:34379932-34379954 CCACTGTGCTCAGGCCGTTTTGG + Intronic
1179342543 21:40526238-40526260 GCAAAGTGCTCAGAGGGTTTAGG - Intronic
1179840729 21:44071526-44071548 GCAGAGTGCTCGGCCCCCTTTGG + Intronic
1183301055 22:37059399-37059421 ACTCTGAGCTCAGCCCGTTTGGG - Exonic
1183394234 22:37562115-37562137 GCCCAGTGCTGAGCCCGGTGTGG - Intronic
951466434 3:23004884-23004906 CCGCAGTGCTCAGTCTGTTTAGG - Intergenic
951529077 3:23682049-23682071 CCACTGTGCCCAGCCCATTTGGG - Intergenic
952229488 3:31415173-31415195 CCACAGTGCCCAGCCAGATTTGG - Intergenic
954172528 3:48816361-48816383 GCACAGTGCTCAGCACATGGCGG + Intronic
959313556 3:104772958-104772980 GAACACTGCTCAGGCCGTTCTGG - Intergenic
959932703 3:112000667-112000689 GGACACTGCTCATCCAGTTTGGG - Intronic
961128600 3:124444508-124444530 CCACCGTGCTCAGCCTTTTTTGG - Intronic
968592998 4:1468924-1468946 GCACAGTGCCCAGCCCTTAGTGG - Intergenic
969893169 4:10278457-10278479 GCACTGTCCTCAGCCTGTCTGGG - Intergenic
987486512 5:18533407-18533429 CCACTGTGCTCAACCCGTTGTGG - Intergenic
989023752 5:37042147-37042169 CCACCGTGCCCAGCCCATTTTGG - Intronic
989385970 5:40854875-40854897 CCACAGTGCCCAGCCCGAATTGG + Exonic
997079908 5:130726037-130726059 GCACACTCCCCAGCCCCTTTGGG + Intergenic
997781435 5:136662818-136662840 GCCCAGTGCTAAGCACTTTTTGG - Intergenic
999755285 5:154659641-154659663 GCAAAGTGCTCAACCTTTTTGGG - Intergenic
1000814000 5:165898338-165898360 CCACAGTGCCCAGCCCGTAAGGG - Intergenic
1001256950 5:170190997-170191019 GCACCTAGCTCAGCCCCTTTAGG + Intergenic
1002255467 5:177955090-177955112 GCACAGTGCACAGTTCTTTTGGG - Intergenic
1002380012 5:178820303-178820325 GCACCGTGCCCAGCCTGTTAGGG + Intergenic
1002414407 5:179111959-179111981 GGACAGTGCGCAGCACGTGTGGG + Exonic
1002482585 5:179512987-179513009 GCACAGTGCACAGTTCTTTTGGG + Intergenic
1004078162 6:12364250-12364272 GCACAGTGCTTGGCCAGATTTGG - Intergenic
1014734276 6:125073861-125073883 GCACAGTGCCAAACTCGTTTTGG - Intronic
1016205699 6:141466312-141466334 CCACTGTGCTCAGCCCCTTGTGG + Intergenic
1017046951 6:150355990-150356012 CCACTGTGCTCAGCCCCTTGTGG + Intergenic
1021942159 7:25688521-25688543 GCTCAGTGGACAGCCTGTTTTGG - Intergenic
1034260891 7:149754777-149754799 CCACAGTGCCCAGCCTCTTTTGG + Intergenic
1045990020 8:108295902-108295924 CCACTGTGCCCAGCCCCTTTTGG + Intronic
1048544092 8:135369910-135369932 GCACAGTGCCCAACCCATATGGG - Intergenic
1049022218 8:139965199-139965221 GCACAGTGCTTTGCACGTTCAGG + Intronic
1049297076 8:141847043-141847065 GCACAGAGGTCTGCCTGTTTTGG - Intergenic
1053002589 9:34585575-34585597 GCACAGAGCTGTGCCCGGTTGGG - Intronic
1053176544 9:35929479-35929501 GCAAAGTTCACAGCCCCTTTGGG + Intergenic
1054962623 9:70985681-70985703 GCACTGTGCTGGGCCCTTTTGGG + Intronic
1056332210 9:85530162-85530184 CCACATAGCTCAGCCAGTTTTGG - Intergenic
1056840240 9:89992877-89992899 GCACAGAGCCCAGCCCGCTTGGG - Intergenic
1058711253 9:107681446-107681468 CCACTGTGCCCAGCCCATTTAGG + Intergenic
1058739560 9:107929692-107929714 GCACAGTGCCCAGCATGTTGGGG - Intergenic
1060324930 9:122605042-122605064 CCACCGTGCCCAGCCCGTCTGGG - Intergenic
1189609307 X:42714901-42714923 GCACATTGCACTGCCAGTTTTGG - Intergenic
1192760738 X:74093895-74093917 GCACAGTGCCCAGCAGATTTGGG - Intergenic
1192840374 X:74849295-74849317 GCACTCTGCTCAGCCAGATTGGG + Intronic
1198929560 X:141838888-141838910 GGACAGTGCTCAGTCTGTTGAGG + Intronic
1199536330 X:148906937-148906959 GAACAGTGTTCAGCCTGATTAGG - Intronic
1200055417 X:153457450-153457472 CTGCAGTGCTCAGCCCGTTCTGG - Intronic