ID: 946120524

View in Genome Browser
Species Human (GRCh38)
Location 2:217509035-217509057
Sequence TTGTCTATGAATGAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946120520_946120524 10 Left 946120520 2:217509002-217509024 CCTGTCACTATGTGAGGACACAG 0: 1
1: 5
2: 99
3: 608
4: 1338
Right 946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG 0: 1
1: 0
2: 2
3: 32
4: 315
946120519_946120524 11 Left 946120519 2:217509001-217509023 CCCTGTCACTATGTGAGGACACA 0: 1
1: 9
2: 80
3: 527
4: 1218
Right 946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG 0: 1
1: 0
2: 2
3: 32
4: 315
946120516_946120524 29 Left 946120516 2:217508983-217509005 CCCAGAGAGCTAGCTAGTCCCTG 0: 1
1: 3
2: 33
3: 93
4: 245
Right 946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG 0: 1
1: 0
2: 2
3: 32
4: 315
946120517_946120524 28 Left 946120517 2:217508984-217509006 CCAGAGAGCTAGCTAGTCCCTGT 0: 1
1: 1
2: 14
3: 54
4: 196
Right 946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG 0: 1
1: 0
2: 2
3: 32
4: 315
946120515_946120524 30 Left 946120515 2:217508982-217509004 CCCCAGAGAGCTAGCTAGTCCCT 0: 3
1: 32
2: 83
3: 130
4: 423
Right 946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG 0: 1
1: 0
2: 2
3: 32
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946120524 Original CRISPR TTGTCTATGAATGAGGAGGT AGG Intronic
901670154 1:10851422-10851444 TTGTCTGTGAGTGAGGACGATGG - Intergenic
902933263 1:19746051-19746073 ATGTCTGTGCATGACGAGGTTGG + Intronic
903805791 1:26004897-26004919 GTGACCAAGAATGAGGAGGTGGG - Intergenic
905424282 1:37870640-37870662 CCCTCTATGAATCAGGAGGTAGG + Intronic
905826825 1:41032063-41032085 CTGTCTATGAACCAGGAAGTGGG + Intronic
906812228 1:48839635-48839657 TTGGTGATGAATTAGGAGGTTGG + Intronic
907547120 1:55271775-55271797 TGTTCTATGAACCAGGAGGTGGG + Intergenic
908627796 1:66065669-66065691 TCTTCTATAAATGAGGAAGTTGG - Intronic
908901107 1:68957573-68957595 CTGTCTATGAACAAGGAAGTAGG + Intergenic
909658304 1:78055137-78055159 CTGTCTATGAACCAGGAAGTGGG - Intronic
909662560 1:78100252-78100274 ATGTCAATGAAGGAGGAGTTGGG - Intronic
911366898 1:96949510-96949532 CTGTCTATGAATCAGGAAGTGGG - Intergenic
911944033 1:104083233-104083255 TTCTCTATGAATGATTATGTTGG - Intergenic
913178956 1:116300931-116300953 TTGCCTAGGGCTGAGGAGGTTGG - Intergenic
913668109 1:121069215-121069237 ATGTGTATGAATGAGCATGTAGG + Intergenic
914019856 1:143856656-143856678 ATGTGTATGAATGAGCAAGTAGG + Intergenic
914348511 1:146820083-146820105 CTGTCTTTGAATGTGGAGGAAGG - Intergenic
914658352 1:149764561-149764583 ATGTGTATGAATGAGCATGTAGG + Intergenic
917201616 1:172522833-172522855 CTGTCTATGCATGAGAAAGTGGG + Intergenic
917908417 1:179613609-179613631 CTATCTATGAATGAGGAAGAAGG - Intronic
918106984 1:181424024-181424046 TCGTCTCTGAGTGAGAAGGTTGG - Intronic
923678648 1:236101273-236101295 GTGTGTGTGAATGTGGAGGTGGG + Intergenic
924261510 1:242236147-242236169 CTGTCTATGAACAAGGAAGTGGG + Intronic
1064177938 10:13091425-13091447 ATGTCTATGAACCAGGAGGCAGG + Intronic
1067171658 10:43911973-43911995 CTGTCTATGAATGTGGAAGCAGG - Intergenic
1067427740 10:46222248-46222270 GTGTCTCTGAATGAGGGAGTGGG - Intergenic
1067537320 10:47122894-47122916 CTGTCTATGAAAAAGGAGGCAGG + Intergenic
1067583157 10:47458137-47458159 GTGTCTCTGAATGAGGGAGTGGG - Intergenic
1068265424 10:54642212-54642234 CTGTCAATGAATCAGGAAGTAGG + Intronic
1068878286 10:62021463-62021485 TTGAATATGAAAGAGGAAGTTGG + Intronic
1069073420 10:64013493-64013515 TTGTCTATGAACCAGGAAGCAGG + Intergenic
1070653020 10:78251874-78251896 ACGTCTATGAATAAGGAAGTGGG - Intergenic
1070994006 10:80759476-80759498 TTGTCTATAAATGAAGGGGTTGG + Intergenic
1072292091 10:93973407-93973429 TTGTCCATGTATGAGGAAGAGGG + Intergenic
1073001551 10:100289631-100289653 CTCTCTATGAATCAGGAAGTGGG + Intronic
1073368619 10:102966766-102966788 TTGTCATGGAATTAGGAGGTGGG + Intronic
1074261907 10:111862556-111862578 TTTTCTGTCAATGAAGAGGTTGG + Intergenic
1074971337 10:118541930-118541952 TTGTTCATGAATGTGCAGGTTGG - Intergenic
1077120466 11:905183-905205 TTGGGTTTGAAGGAGGAGGTGGG - Intronic
1078086954 11:8239624-8239646 TTGTGTGTGAATGAGGGGATGGG + Intronic
1078942851 11:16028402-16028424 TTTTCTATGAATATGGAGCTTGG + Intronic
1079548128 11:21660204-21660226 TTGTCTATGAACTAGGAAGAAGG - Intergenic
1080299378 11:30767621-30767643 TTGACTACAAAAGAGGAGGTAGG - Intergenic
1080471397 11:32549199-32549221 TTGTTTATGGATGGGGAGTTGGG + Intergenic
1082815418 11:57505024-57505046 TTGTCTATAAATGTTGGGGTTGG - Intronic
1085096406 11:73763971-73763993 TTGTCTATGAACCAGGAAGTGGG - Intergenic
1085184511 11:74564045-74564067 TTGTGTATGAATGTGCATGTAGG - Intronic
1087551392 11:99654914-99654936 GTGTCCCTGAATGAGGAGATGGG + Intronic
1087937343 11:104050158-104050180 TTGTCTATGAGGGAGGAACTGGG + Intronic
1089304838 11:117520051-117520073 GTGGCAATGAAGGAGGAGGTGGG + Intronic
1089439293 11:118501730-118501752 AGGTTTGTGAATGAGGAGGTCGG - Exonic
1091122325 11:133066374-133066396 TCTTCTATGAAAGGGGAGGTTGG - Intronic
1091985617 12:4908798-4908820 TTGGCTTTGATTAAGGAGGTGGG + Intergenic
1092126109 12:6075968-6075990 TTCACTATGAATGAGGGGGATGG + Intronic
1092634907 12:10433158-10433180 TTGTCTCTGGATGGGGAAGTGGG - Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1094460333 12:30690944-30690966 TTCTCTATTACTAAGGAGGTTGG + Intronic
1096087197 12:48873682-48873704 TGGACTAAGAATGAGGAGGGAGG + Intergenic
1097636221 12:62125434-62125456 TCGTCTGTGAATGCTGAGGTTGG - Intronic
1098469526 12:70827440-70827462 CTGTCTATGAACGAGGAACTGGG - Intronic
1099038819 12:77624544-77624566 TAGTCTATGAATGATGAGGTTGG + Intergenic
1099393096 12:82103541-82103563 TTGTCTATGATGGAGGTGGCAGG - Intergenic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1100598559 12:96092603-96092625 ATGTCAATGATTGAGGTGGTGGG - Intergenic
1101249533 12:102918137-102918159 TGGTCTATGAGTGAGCTGGTGGG + Intronic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102444295 12:112989878-112989900 TGGGCTGTGAGTGAGGAGGTGGG - Intronic
1103033554 12:117638205-117638227 TTGTCTATGCAGGAAGACGTGGG - Intronic
1103429082 12:120866207-120866229 TTTTCTATGGATGGGGAGGAGGG - Intronic
1106844859 13:33727650-33727672 TTGACCAAGAAAGAGGAGGTTGG - Intergenic
1106990934 13:35419288-35419310 TGTTCTATGAACCAGGAGGTGGG - Intronic
1107530861 13:41281058-41281080 TGGTCTGGGAAAGAGGAGGTGGG - Intergenic
1107720425 13:43242664-43242686 TTGTCTAAAAATGAGGGGCTGGG + Intronic
1109299919 13:60580336-60580358 TTGTCTAAAGATGGGGAGGTAGG + Intergenic
1109384092 13:61604665-61604687 TCGTCTATGAACCAGGAAGTTGG + Intergenic
1109512392 13:63396600-63396622 ATGTCTAGGAAGAAGGAGGTAGG - Intergenic
1109700379 13:66017361-66017383 TTGTCTCTCAATGAAAAGGTAGG - Intergenic
1109964571 13:69675085-69675107 CCATCTATGAATGAGGAAGTGGG - Intergenic
1110077679 13:71269462-71269484 TTTTCCATGGATGGGGAGGTGGG + Intergenic
1110709145 13:78630700-78630722 CTGTCTATGAAGCAGGAAGTGGG + Intronic
1110733492 13:78908530-78908552 TTTTCTTGGAATGAGGAGGCTGG - Intergenic
1114243608 14:20892206-20892228 TTGGCTATGATTGAGGAGCTTGG - Exonic
1114246589 14:20920158-20920180 TTGGCTATGATTGAGGAGCTTGG - Intergenic
1114250536 14:20956294-20956316 TTGGCTATGATTGAGGAGCTTGG - Exonic
1114271405 14:21102520-21102542 TGGTCAATGAAGGAGAAGGTGGG + Intronic
1114861532 14:26529001-26529023 TTGGCTCTGGATGAGGAGCTTGG + Intronic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1116135075 14:40912777-40912799 TTGTCTATGAAAGAAGAGAATGG - Intergenic
1116412432 14:44640835-44640857 TTGTATGTGAAGGAGGAGGAAGG + Intergenic
1117342234 14:54802408-54802430 TTTTGTCTGGATGAGGAGGTGGG - Intergenic
1117833921 14:59782108-59782130 CTGTCTATGAATCAGGAAATGGG + Intronic
1117863414 14:60118154-60118176 TTGTTTATTAATTATGAGGTTGG + Intronic
1118067996 14:62213025-62213047 ATGTATGTGAATGTGGAGGTGGG - Intergenic
1118068010 14:62213147-62213169 ATGTATGTGAATGTGGAGGTGGG - Intergenic
1118350018 14:64967041-64967063 TTGCTTTTGACTGAGGAGGTGGG - Intronic
1118780225 14:69003051-69003073 TTGGCCATGAAGGAGGAGGGAGG - Intergenic
1118849609 14:69573698-69573720 GTGACTATGGATGAGGAGGGGGG - Intronic
1120614824 14:86690306-86690328 CTGTCTATGAATCAGGAAGAAGG + Intergenic
1120643242 14:87040811-87040833 GTGTCAGTGAATGTGGAGGTGGG - Intergenic
1123971050 15:25508078-25508100 TTGTCTATGGCTGTGCAGGTGGG + Intergenic
1124247566 15:28084165-28084187 CTGTCTGTGAACCAGGAGGTGGG + Intronic
1125647115 15:41282188-41282210 CTGCACATGAATGAGGAGGTGGG - Intergenic
1126777737 15:52113569-52113591 TTGTCTATGAACCAGGAAGCAGG - Intergenic
1126875631 15:53038248-53038270 AAGTCTATGATTGAGGATGTGGG + Intergenic
1126978312 15:54211529-54211551 TTATCTCTGAATGCGGAGTTAGG + Intronic
1127633704 15:60849738-60849760 ATGTCTCTGAATGTGGAGCTGGG + Intronic
1128090689 15:64916883-64916905 TGGTCTGAGAATGAGGTGGTGGG + Intronic
1131632745 15:94196274-94196296 GAGTCTATGAATGTGGATGTAGG + Intergenic
1132930943 16:2459045-2459067 TTCTCTGTGAAGGAGGAGGCAGG - Intergenic
1135091460 16:19521587-19521609 TTGTGGACGAATGAGGAAGTGGG + Intronic
1137947136 16:52744405-52744427 ATGTCACTGAATGTGGAGGTGGG + Intergenic
1138317484 16:56082647-56082669 TTGTCTATGAACCAGGAAGAGGG - Intergenic
1138398787 16:56729349-56729371 CTATCTATGAATTAGGAGGCAGG + Intronic
1140816593 16:78627040-78627062 TTGTGTATGTATGAGGTGGGGGG - Intronic
1144669437 17:17124715-17124737 TTGTCTAGGGAGGTGGAGGTGGG + Intronic
1144783111 17:17817588-17817610 CTGTCTATGAAATGGGAGGTAGG + Intronic
1148620467 17:49030967-49030989 TTGTGTGTGTATGTGGAGGTGGG + Intronic
1149301959 17:55313535-55313557 CTGTGTAAGAATGGGGAGGTGGG + Intronic
1150831704 17:68527092-68527114 TTGTCAAAGAAGGAAGAGGTAGG + Intronic
1151385913 17:73755225-73755247 TGTCCTATGAAAGAGGAGGTGGG + Intergenic
1151774897 17:76193900-76193922 CTGTCTGTGGATGTGGAGGTGGG - Intronic
1151867121 17:76811202-76811224 CTGTCTAAGAAGGGGGAGGTGGG + Intergenic
1152284119 17:79402673-79402695 TTGTCTGTGAAACAGGAGGCTGG + Intronic
1153818294 18:8809866-8809888 CTGGGTGTGAATGAGGAGGTGGG + Intronic
1153982211 18:10320176-10320198 TTGTCTATGGGTGAGGATGTAGG + Intergenic
1155831334 18:30518123-30518145 TTGTGTAGGAATGAAAAGGTAGG + Intergenic
1156885938 18:42136024-42136046 AAGTCTGTGAATGAGGAGGAGGG + Intergenic
1157258336 18:46157766-46157788 GTGTCACTGAATGAGGAGATGGG + Intergenic
1157972802 18:52289444-52289466 TTGTTTATGGAGGAGGAGATAGG - Intergenic
1158864654 18:61626681-61626703 TTGTCTGTGTGTGTGGAGGTAGG - Intergenic
1161358775 19:3834469-3834491 GTGACTATGAAGGAGGAGGAGGG - Intronic
1162467777 19:10852829-10852851 TGATCTCTGAATGAGGAGGCTGG + Intronic
1165231733 19:34391526-34391548 CTGTCAATGTCTGAGGAGGTAGG + Intronic
1165231781 19:34391828-34391850 CTGTCAGTGACTGAGGAGGTAGG + Intronic
1165231889 19:34392625-34392647 TTTTCAATGTCTGAGGAGGTAGG + Intronic
1165232256 19:34394484-34394506 CTGTCCATGTCTGAGGAGGTGGG + Intronic
1167346112 19:48946678-48946700 GTGTCTATGGATGTGGATGTGGG + Intergenic
926041750 2:9679257-9679279 CTGTCTATGAACCAGGAAGTGGG + Intergenic
926078830 2:9966861-9966883 TTGTATGTGACTGAGGTGGTTGG - Intronic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
930157728 2:48122996-48123018 CTGTCTATGAACTAGGAAGTGGG + Intergenic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
931010976 2:57912988-57913010 CTGTCTATGAACCAGGAAGTGGG + Intronic
931084069 2:58809367-58809389 TTGGCTTTGAATGAGCAGATAGG + Intergenic
931779658 2:65568035-65568057 TTGTCTTAGAATGAAGAGTTTGG + Intergenic
931904770 2:66830739-66830761 TTGCCTATGGTAGAGGAGGTGGG + Intergenic
932988954 2:76763062-76763084 TCGCCTAGGATTGAGGAGGTAGG + Intronic
933155029 2:78963900-78963922 TTATCTTGGAGTGAGGAGGTGGG - Intergenic
933720959 2:85397389-85397411 TTGTCTAGAATTTAGGAGGTGGG + Intronic
933996137 2:87671444-87671466 CTGTCTATGAACCAGGAAGTGGG - Intergenic
933998517 2:87687375-87687397 TTGACTATGATTGAGGAAGGAGG - Intergenic
934694123 2:96386311-96386333 TTGCCTATGTATGAGGAGAAGGG - Intergenic
934898987 2:98142108-98142130 GTGTTTATGCATCAGGAGGTGGG + Intronic
935655664 2:105420675-105420697 TTTTCCATGAATTGGGAGGTGGG + Intronic
936295332 2:111263498-111263520 TTGACTATGATTGAGGAAGGAGG + Intergenic
936297718 2:111279468-111279490 CTGTCTATGAACCAGGAAGTGGG + Intergenic
936758954 2:115750207-115750229 CTGTCTCTGAATGAGGGAGTAGG - Intronic
937636711 2:124164370-124164392 CTATCTATGAATGAGCAGGCTGG - Intronic
937991291 2:127663842-127663864 TTGGCTCTGGATGGGGAGGTTGG - Intronic
938946051 2:136212928-136212950 TTATCTATGAAGCAGGATGTGGG - Intergenic
939982892 2:148802094-148802116 CTGTCTATGAACTAGGAGGTGGG - Intergenic
940713686 2:157193066-157193088 TTGTGTATGAATGGGGATGTGGG - Intergenic
941944637 2:171081411-171081433 ATGTCTATGAAACAGGAGGCAGG + Intronic
942511306 2:176705066-176705088 TTATATATGAATAAGGTGGTTGG + Intergenic
942572184 2:177325761-177325783 TTGTCTATGTATGTGTATGTTGG - Intronic
942804427 2:179912847-179912869 GTGTCTAAGAATGAGGAATTTGG - Intergenic
943379621 2:187127943-187127965 TTGTCTATGAACCAGGAAATGGG + Intergenic
944184964 2:196937681-196937703 TTATCTATAGATAAGGAGGTTGG + Intergenic
944400484 2:199320244-199320266 TTCTCTGTGAATTAGGAGTTAGG - Intronic
944555717 2:200886127-200886149 TTTTCTATAAATAAGGATGTTGG - Intronic
944935182 2:204560625-204560647 TTTTGTTTGAAGGAGGAGGTTGG + Intronic
946120524 2:217509035-217509057 TTGTCTATGAATGAGGAGGTAGG + Intronic
946186871 2:217986046-217986068 TTTTCCCTAAATGAGGAGGTGGG - Intronic
1169747130 20:8953872-8953894 GTGTCTATGAACCAGGAAGTGGG - Intronic
1170200226 20:13734900-13734922 TTGTCTAAGAACATGGAGGTAGG + Intronic
1171766426 20:29285466-29285488 TTTTCTTTGATTGAGCAGGTTGG - Intergenic
1172168395 20:32913274-32913296 CTGTCTATGAATCAGGAAGTAGG - Intronic
1172473282 20:35217101-35217123 ATGTATATGAGTGAGGAGGTTGG - Intergenic
1173234166 20:41228537-41228559 TTGTCTGTCTATGAGGAAGTAGG - Intronic
1173386306 20:42591591-42591613 TTTTCCAGGAATGAGGTGGTAGG - Intronic
1173937615 20:46880939-46880961 TTGCCTGAGAGTGAGGAGGTGGG + Intergenic
1174941291 20:54931401-54931423 TTGTCTATGAACCAGGAGTTGGG + Intergenic
1175192579 20:57221509-57221531 TTGTCTGTGAAAGAGGGTGTGGG + Intronic
1175480781 20:59309184-59309206 GTGTCTGTGAAATAGGAGGTAGG + Intronic
1176969955 21:15253670-15253692 TTGTAAGTGAAAGAGGAGGTAGG + Intergenic
1178296187 21:31412410-31412432 TTTTCCATGGATGAGGGGGTGGG + Intronic
1184765914 22:46572466-46572488 TTCTCTAAAAATGATGAGGTTGG + Intergenic
1184840702 22:47050902-47050924 GTGTCTCTGGATGAGGAGGGCGG + Intronic
951577829 3:24131730-24131752 CTGTCTATGAATCAGGAAGCAGG + Intronic
952093763 3:29923392-29923414 TTGTGTTTTAATGATGAGGTGGG + Intronic
952138566 3:30452660-30452682 TTGTCTAATAATGAACAGGTGGG + Intergenic
954519619 3:51213073-51213095 TGGTCTAGGAATGGGGAGGGAGG - Intronic
954525943 3:51271382-51271404 CTGTCTATGAACCAGGAAGTGGG - Intronic
955617620 3:60825739-60825761 TTTTCCATGGATGGGGAGGTGGG - Intronic
956358034 3:68415478-68415500 TTGTGTTGGAGTGAGGAGGTTGG + Intronic
956603166 3:71045037-71045059 ATCTCTCTGAATCAGGAGGTTGG - Intronic
957198928 3:77107115-77107137 CCGTCTATGAACCAGGAGGTGGG - Intronic
959508965 3:107188618-107188640 TTGTCTATGAACTAGGAAGTGGG - Intergenic
960288540 3:115856703-115856725 CTGTCTCTGAATCAGGAAGTGGG + Intronic
960435219 3:117618424-117618446 TTGTCTAAAATTGAAGAGGTTGG + Intergenic
961096104 3:124158190-124158212 TTGTGGCTGAATGAGGAGGGTGG + Intronic
962119013 3:132542228-132542250 GCGTCTAGGAATGAGGAGCTGGG + Intergenic
962373719 3:134842193-134842215 CTGTCTATGAATCAGAAAGTGGG + Intronic
963348100 3:144120220-144120242 TTGCTTATCAATGTGGAGGTGGG - Intergenic
965666422 3:171098434-171098456 TTTTCTATGCATGAGGAATTGGG + Intronic
966062064 3:175769787-175769809 GTTCATATGAATGAGGAGGTTGG + Intronic
966175208 3:177131227-177131249 GTGTCTTTGAATGAAGAGTTAGG - Intronic
966772078 3:183512975-183512997 TTCTCTATAAATGAGAAAGTTGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967475326 3:189909818-189909840 CTGTCTATGATTCAGCAGGTAGG + Intergenic
967763632 3:193252862-193252884 TTGTCTAAAAATGAGGAGATTGG + Intronic
969360640 4:6661165-6661187 TTGTCTATTGATGAGATGGTTGG + Intergenic
969975892 4:11101120-11101142 TTGGCCTTGAATGAGGTGGTGGG - Intergenic
970442031 4:16089288-16089310 TTTACTATGAATGAGGCGCTGGG + Intergenic
970462796 4:16292409-16292431 CTGTTTATCAATGAGGAAGTGGG + Intergenic
971112603 4:23605842-23605864 CTGTCTATGCATCAGGAAGTGGG - Intergenic
972662541 4:41130242-41130264 TTATCTAGGAATGAGGAGAAGGG + Intronic
972884076 4:43463793-43463815 TTATCTATGAATGAACATGTGGG + Intergenic
973652808 4:53013720-53013742 TCATCTATAAATGAGGAGATGGG - Intronic
975347310 4:73306930-73306952 ATGTCTAATAATAAGGAGGTTGG - Intergenic
975960040 4:79891372-79891394 CTTTGTATGAATGGGGAGGTTGG + Intergenic
977320815 4:95513485-95513507 TTGTCTATTAATGAGGGGAAAGG - Intronic
980119922 4:128717219-128717241 TTGGCTCTGAATGGGGAGGTAGG - Intergenic
981872611 4:149504949-149504971 CTGTCTATGAACCAGGAGGCAGG + Intergenic
982102703 4:151983827-151983849 TTCTGTAGGAGTGAGGAGGTGGG - Intergenic
983682271 4:170367274-170367296 TTGCCTAGGGATGAGGAAGTGGG - Intergenic
983810469 4:172054524-172054546 TGGTCTATGAACTAGGAAGTGGG - Intronic
983850018 4:172569232-172569254 CTGTCTATGAACCAGGAGGTGGG - Intronic
987257251 5:16168700-16168722 TTGTGTGGGAATGAGTAGGTGGG - Intronic
987315602 5:16720344-16720366 TAGTCTAGCAATGTGGAGGTTGG - Intronic
987546988 5:19323327-19323349 CTGTCTATGAATGAAGAGCTGGG - Intergenic
988821236 5:34888163-34888185 CTGTCAATGAATCAGGAAGTGGG + Intronic
989993605 5:50799882-50799904 TGGTCTATGAATCAGCAGATGGG + Intronic
990128602 5:52550824-52550846 CTGTCAATGACTGAGGAGCTGGG - Intergenic
991703252 5:69334766-69334788 TTGTCTTAAAAAGAGGAGGTGGG + Intergenic
992607491 5:78473984-78474006 CTGTCTATGAACCAGGAAGTTGG - Intronic
992613542 5:78528490-78528512 TTTTCTATGTATGATGGGGTGGG - Intronic
993495869 5:88608221-88608243 TTGTCTATAAACCAGGAAGTGGG + Intergenic
993979589 5:94529136-94529158 TGGTTTATGTGTGAGGAGGTAGG + Intronic
995388673 5:111615544-111615566 AATTCTGTGAATGAGGAGGTGGG + Intergenic
996058606 5:119008117-119008139 CTGTCTATGAACCAGGAAGTGGG - Intergenic
996589733 5:125133071-125133093 TTGGCAATGAATGAGGTGGGAGG - Intergenic
996981561 5:129502014-129502036 TGGACTATGAGTGAGGGGGTTGG + Intronic
997828409 5:137128178-137128200 CTGTCTATGAAACAGGAAGTAGG + Intronic
998810584 5:145962459-145962481 TTGTCGAATAATGAAGAGGTTGG - Intronic
999350167 5:150862443-150862465 TTGTCTCTCAATGAGGAGGCTGG - Intronic
999671508 5:153962718-153962740 GTGTCTATGAATCAGGAAGCTGG - Intergenic
999725335 5:154432278-154432300 TAGTCTATGAACCAGGAAGTGGG - Intergenic
1000222898 5:159231227-159231249 ATGTCACTGAATGAGGAGTTGGG - Intergenic
1000476002 5:161708068-161708090 TAATCTTTGAATGAGGATGTAGG - Intergenic
1000577194 5:162988889-162988911 TCCTCTATGAATGAGAAAGTGGG - Intergenic
1000841198 5:166220627-166220649 TTGTCTATGAACAAGGAAGCAGG - Intergenic
1001017257 5:168152843-168152865 CTGTGTATGAATGCGGATGTGGG - Intronic
1003097622 6:3154984-3155006 TTGACTATGGAGGAGAAGGTAGG + Intronic
1003101206 6:3177664-3177686 TTGACTATGGAGGAGGAGGTAGG + Intergenic
1003972704 6:11314302-11314324 TTGGCTTTAAATGAGGACGTAGG + Intronic
1007342057 6:41197354-41197376 GAGGCAATGAATGAGGAGGTTGG - Intronic
1008048777 6:46878800-46878822 TTTTCTCTGCATGATGAGGTGGG - Intronic
1009811995 6:68680072-68680094 TTGTCTATGAACCAGAAAGTTGG + Intronic
1010329419 6:74605676-74605698 TAGTCTATGGATGGGCAGGTCGG - Intergenic
1010339586 6:74732590-74732612 TTGTCTATGACCCAGGAAGTGGG + Intergenic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1011264264 6:85498706-85498728 CCGTCTATGAATCAGGAGGCAGG - Intergenic
1011840146 6:91487496-91487518 TTGTCTGTGAATGAGATGGGCGG + Intergenic
1012956034 6:105571197-105571219 TTCTCTAAGAATGTGGAGGTGGG + Intergenic
1013042075 6:106445305-106445327 TAGTCTCTGAGTGAGGAGTTGGG + Intergenic
1016982684 6:149867464-149867486 CTGTCTATGAACCAGGAAGTGGG - Intergenic
1017454716 6:154591102-154591124 TTGTTTCTGAGTGAGGAGGTGGG + Intergenic
1017542607 6:155418154-155418176 GTGTGTATGAATGGGGAGGGAGG - Intronic
1018347577 6:162918004-162918026 TTGTCTATGTCTGAAGAGGTTGG - Intronic
1019570737 7:1710869-1710891 TTATCTATAAATGAGAAAGTTGG - Intronic
1019714237 7:2530999-2531021 TTGTCTGTGATTGGGGAGGGGGG - Intergenic
1021254748 7:18377157-18377179 CTGTCTATGAATCAGGAAGCAGG - Intronic
1021688564 7:23211041-23211063 TTCTCTGTGAAGCAGGAGGTGGG - Intergenic
1021808956 7:24384049-24384071 CTGTCTATGAATCAGGAAGCAGG + Intergenic
1023109047 7:36791839-36791861 TTGGCAATGAATGATGGGGTGGG + Intergenic
1027891245 7:83978383-83978405 TTGCCTGGGAAGGAGGAGGTAGG + Intronic
1030198670 7:106879186-106879208 CTGTCTATTAAAGAGGATGTGGG + Intronic
1031070609 7:117157254-117157276 TTGTCTATGAGGCAGGATGTAGG - Intronic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1032758943 7:134919617-134919639 ATGTCTATGTATGGGGAGATGGG + Intronic
1033468433 7:141620467-141620489 TTGTATCTGAAGGAGAAGGTAGG + Intronic
1033939150 7:146630130-146630152 CTGTCTAGGAATGAGGGGCTAGG - Intronic
1034008038 7:147496224-147496246 TTTTCCATGGATCAGGAGGTAGG - Intronic
1034362916 7:150516816-150516838 ATTTATATGAATGGGGAGGTTGG + Intronic
1034856701 7:154556199-154556221 TTGTGTATCAATTATGAGGTAGG + Intronic
1036494104 8:9253718-9253740 TTGTCTTTGCATGAGTAGGCTGG + Intergenic
1036532168 8:9601947-9601969 TTGCATGTGTATGAGGAGGTGGG + Intronic
1039199063 8:35067321-35067343 TTGTCTATGAATGTGAAACTTGG + Intergenic
1039668760 8:39570317-39570339 CTATCTATGAATGAGGAAGCAGG + Intergenic
1039860664 8:41454525-41454547 TTCTCTATCAATTAGGAAGTGGG - Intergenic
1040123015 8:43702990-43703012 TTTCCTATGATTGAGCAGGTTGG + Intergenic
1041188998 8:55333914-55333936 TTTTCTCTTAATGAGGAGATTGG + Intronic
1043741814 8:83823931-83823953 TTGTCAATGAATGAAAAGGAAGG - Intergenic
1045099995 8:98834608-98834630 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045100203 8:98836302-98836324 CTGTCTATGAATCAGGAAGTTGG - Intronic
1046238785 8:111463580-111463602 CTGTCTATGAATCAGTAAGTGGG - Intergenic
1046803625 8:118455906-118455928 TTGCCTTTGAATGAGGTGGAAGG - Intronic
1047619181 8:126588888-126588910 TTTTGTATGACTGGGGAGGTGGG - Intergenic
1048967403 8:139624759-139624781 TTGCCTCTGACTGTGGAGGTGGG - Intronic
1049487264 8:142872932-142872954 TTATCTATGAAACAAGAGGTGGG + Intronic
1050012592 9:1200223-1200245 CTGTCTGTGAGTGAGCAGGTAGG + Intergenic
1050017184 9:1246359-1246381 CTGTCTATGAACCAGGAAGTGGG + Intergenic
1050050889 9:1600337-1600359 ATCTGTAGGAATGAGGAGGTAGG - Intergenic
1050275398 9:3992453-3992475 CTGTTTATGCATGAGGAGGAAGG - Intronic
1050655842 9:7828030-7828052 TTGTTTATGGATGAAGTGGTAGG - Intronic
1051130631 9:13856279-13856301 TCATCTATGAATGAGAAGGCAGG - Intergenic
1051508517 9:17851526-17851548 TTCTCTCTGAATGAGGAGCCTGG + Intergenic
1052083406 9:24234738-24234760 TGATCTATGAATCAGGAAGTGGG - Intergenic
1052587944 9:30453038-30453060 TTGACTATGAATCAGGAAGTGGG - Intergenic
1052849788 9:33370781-33370803 TTCTCTATCAAAGAGGAGTTAGG - Exonic
1053624189 9:39851944-39851966 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1053880677 9:42591284-42591306 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1053891992 9:42703048-42703070 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054219708 9:62398754-62398776 TAGTGTATGTATGAGGAGGAGGG - Intergenic
1054231007 9:62510419-62510441 TAGTGTATGTATGAGGAGGAGGG + Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1055516331 9:77037183-77037205 TGCTTTAAGAATGAGGAGGTGGG - Intergenic
1055984700 9:82045441-82045463 TTATAAATGAAAGAGGAGGTCGG - Intergenic
1056761129 9:89415620-89415642 CTGTCTATGAACCAGGAGGAGGG + Intronic
1056844072 9:90022450-90022472 TTGTGTATGGAGGAAGAGGTGGG - Intergenic
1057917058 9:99065136-99065158 TTGTTTCTGAATGACGAGATTGG - Intronic
1058779317 9:108317526-108317548 TTTTCCATGGATGAGGTGGTGGG - Intergenic
1059786732 9:117594317-117594339 TTATGTATGGATGAGGAAGTTGG - Intergenic
1059897001 9:118877483-118877505 TTCTGTACAAATGAGGAGGTTGG - Intergenic
1060839068 9:126780177-126780199 TTGTCTATGAGACAGGAGGAGGG + Intergenic
1061145951 9:128798558-128798580 TTGTCTAGGCAAGAGGTGGTGGG + Intronic
1061427735 9:130510720-130510742 TTCTCTATACATGAGGAGATTGG + Intergenic
1061663598 9:132147363-132147385 TTGTCTAGGAAGGAGGAAGGGGG - Intergenic
1185512447 X:673674-673696 TAGTCAAGGAATGTGGAGGTTGG + Intergenic
1185670991 X:1810083-1810105 CTGTCTATGAACCAGGAAGTGGG + Intergenic
1185938519 X:4286041-4286063 CTGTCTATGAATCAGGAAGCGGG + Intergenic
1185962712 X:4563313-4563335 CTGTCTATGAACCAGGAAGTGGG - Intergenic
1186096006 X:6102476-6102498 CTGTCTATGAATCAGGAAGTGGG + Intronic
1186147850 X:6643632-6643654 CTATATTTGAATGAGGAGGTGGG - Intergenic
1186379297 X:9040243-9040265 TTAGCAATAAATGAGGAGGTTGG + Intronic
1186451460 X:9677264-9677286 TCCGCTATGAATAAGGAGGTTGG + Intronic
1187049999 X:15686357-15686379 TTGTTTAAAAAGGAGGAGGTGGG + Intergenic
1188485140 X:30674307-30674329 TTCTCCATGAAGCAGGAGGTAGG - Intronic
1189997057 X:46648995-46649017 ATCTCTATGAATCAGGAGGTGGG - Intronic
1190434495 X:50409925-50409947 TTGTCTATGAACCAGGAAGTGGG + Intronic
1191734578 X:64375696-64375718 CTGTCTATGAACCAGGAAGTAGG + Intronic
1194695473 X:97044440-97044462 TTGTTAATGAATTATGAGGTAGG - Intronic
1194831390 X:98626579-98626601 TTTTCAATGAATGAGGAGATAGG + Intergenic
1195474172 X:105265166-105265188 TTGTCTTTGAATGAGTGTGTGGG + Intronic
1196988277 X:121298983-121299005 TGATCTATAAAGGAGGAGGTTGG + Intergenic
1198718135 X:139584469-139584491 TGGGCTATTAAAGAGGAGGTAGG - Intronic
1199438046 X:147836303-147836325 ATGTCTATGAATGAAGGGCTAGG + Intergenic
1199838484 X:151618803-151618825 TTGGATGTGAATGAGGAGTTGGG + Intronic
1201885012 Y:18872679-18872701 CTGTCTATGAATGAGAAAGTGGG - Intergenic