ID: 946125938

View in Genome Browser
Species Human (GRCh38)
Location 2:217562724-217562746
Sequence TGACTTGCAAATTAACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946125938_946125941 7 Left 946125938 2:217562724-217562746 CCAGGCTGTTAATTTGCAAGTCA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 946125941 2:217562754-217562776 CTTTACTGCCCCTCTTCTAAAGG 0: 1
1: 0
2: 0
3: 13
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946125938 Original CRISPR TGACTTGCAAATTAACAGCC TGG (reversed) Intronic
905386611 1:37608799-37608821 AGACTTGCAAAAACACAGCCAGG + Intergenic
911790874 1:102014209-102014231 TGTCTTGGCAATTAACAGTCGGG - Intergenic
914391515 1:147227562-147227584 TTACTTGCAAATTGTCAGCTAGG - Intronic
921985856 1:221311115-221311137 TAACTTTCAAAATAACAGCAGGG - Intergenic
1063898106 10:10703329-10703351 TCACTTGAGAATTCACAGCCAGG + Intergenic
1063966824 10:11352497-11352519 TTACATGCAAATTAAAGGCCAGG + Intergenic
1064730161 10:18322231-18322253 TGATTTCCAAATTAACATCTTGG + Intronic
1065022930 10:21516100-21516122 TGACCTGACAATTAACTGCCTGG - Exonic
1068701761 10:60027806-60027828 TGGGTTGCAAATTCACAGTCAGG + Exonic
1072576052 10:96701198-96701220 TGACTTGGAAATTTATGGCCTGG + Intronic
1074216791 10:111393157-111393179 TGACTTGCACTTTAGGAGCCTGG + Intergenic
1074273520 10:111978824-111978846 TGACTTGTTAATTAAGAGTCAGG - Intergenic
1075175420 10:120156072-120156094 TGACTTGCAAAGAAACATCCTGG + Intergenic
1081143821 11:39536530-39536552 TGACCTGCAAGGCAACAGCCTGG - Intergenic
1084436928 11:69148281-69148303 TGACTTGAAAGTTCACACCCAGG - Intergenic
1087645996 11:100808964-100808986 TGACTTGCAAATGAGTATCCTGG - Intronic
1088564066 11:111149039-111149061 TGGCTTCCAAATTAAGAGGCAGG - Intergenic
1089111256 11:116059087-116059109 TGACTTGCAAATAGACAAACTGG - Intergenic
1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG + Intronic
1094419641 12:30257179-30257201 TGACTCTTAAATTAACAGCATGG + Intergenic
1101397535 12:104361655-104361677 TTACATGCAAATTAAGAGGCAGG - Intergenic
1101698077 12:107145485-107145507 GGGCTTCCAAATTAACTGCCTGG + Intergenic
1105904929 13:24798788-24798810 TGGATTACAAATTAACAACCAGG - Intronic
1107280754 13:38731707-38731729 TAACTTGGAAATGAACAGACAGG + Intronic
1108757369 13:53520196-53520218 TGACTTTCAATTTAAAATCCAGG - Intergenic
1109979420 13:69887415-69887437 AGATTTGAAAATTATCAGCCTGG - Intronic
1110126307 13:71947321-71947343 TGACTGGCACACTAAGAGCCTGG + Intergenic
1116160635 14:41263336-41263358 TTACGTGCAAATTAAGAGTCAGG - Intergenic
1121116974 14:91350720-91350742 GGACCTGCAAATGACCAGCCAGG + Intronic
1121946525 14:98128161-98128183 TGCACTGCAAATTAACAGCAGGG - Intergenic
1130759811 15:86807222-86807244 AGCCTTGCAAATAGACAGCCAGG + Intronic
1131970200 15:97884472-97884494 TAACTTGAAAATTACCAGCATGG + Intergenic
1134568185 16:15269046-15269068 TGGCTTGCAAATTTAATGCCTGG - Intergenic
1134568428 16:15271007-15271029 TGGCTTGCAAATTTAATGCCTGG - Intergenic
1134734001 16:16485353-16485375 TGGCTTGCAAATTTAATGCCTGG + Intergenic
1134734248 16:16487309-16487331 TGGCTTGCAAATTTAATGCCTGG + Intergenic
1134933253 16:18224970-18224992 TGGCTTGCAAATTTAATGCCTGG - Intergenic
1134933497 16:18226928-18226950 TGGCTTGCAAATTTAATGCCTGG - Intergenic
1135378684 16:21974269-21974291 AGACTTGCAAATAAACCTCCTGG - Intronic
1137034734 16:35560119-35560141 TGACTTTCAAATTTGGAGCCAGG - Intergenic
1144154265 17:12483576-12483598 TTTCTTGCAAAACAACAGCCAGG + Intergenic
1149068252 17:52506425-52506447 TGACTTCCAAATTTATATCCAGG + Intergenic
1150191875 17:63250810-63250832 TTACTTATAAATTACCAGCCTGG - Intronic
1150762544 17:67975625-67975647 TGAATTGCAAAATAACCTCCAGG + Intronic
1155455770 18:26011170-26011192 TGCCTTGAAAATTAAGAGCAAGG - Intergenic
1156164638 18:34403532-34403554 TGACCTGCAAATAAACAGTTGGG - Intergenic
1156400906 18:36739242-36739264 TTATATGCAAATTAAAAGCCAGG - Intronic
1159589837 18:70321811-70321833 AGCTTTGCAAATAAACAGCCAGG + Intronic
1159649145 18:70956613-70956635 TGATTTGCAAATTAAAGGACAGG + Intergenic
1160591849 18:79949363-79949385 TGACTTAAAAACTAACAGGCGGG + Intronic
1164085633 19:21899697-21899719 TGACCTGCAAGGTCACAGCCTGG - Intergenic
1164818387 19:31224894-31224916 TAAATGGCAAATTACCAGCCAGG + Intergenic
1165087376 19:33360595-33360617 TGACTTTGAACTGAACAGCCAGG - Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168411588 19:56143536-56143558 GGACTTGCACATCCACAGCCAGG - Intronic
1168486445 19:56766528-56766550 TGACCTGCACATTAGGAGCCAGG - Intergenic
928289933 2:30028121-30028143 TGAGTTGCAAAATAAAATCCCGG - Intergenic
928875934 2:36039660-36039682 TGACTTGAAAATTTACACGCAGG - Intergenic
929201323 2:39240112-39240134 TAACTTAAAAATTAACCGCCAGG + Intergenic
933520961 2:83372925-83372947 TGAGTTGTATATTAACACCCTGG + Intergenic
944331780 2:198476887-198476909 TTTCTTGCAAATTAACAACAAGG + Intronic
946125938 2:217562724-217562746 TGACTTGCAAATTAACAGCCTGG - Intronic
946801121 2:223417118-223417140 TGATTTGTAACTTACCAGCCAGG + Intergenic
1169807333 20:9572936-9572958 TGTCTTGCAAATTATCACCCAGG + Intronic
1170560434 20:17552513-17552535 TGACCTACAACTTAACAGCATGG + Intronic
1170980836 20:21211334-21211356 GGACTTGGAAATTAAATGCCAGG - Intronic
1171976314 20:31596870-31596892 TGAATTAGAAATAAACAGCCTGG - Intergenic
1174906398 20:54556747-54556769 TGAATTGCAAAGTTACAGACCGG - Intronic
1175014211 20:55771214-55771236 TTACGTGGAAATTAACTGCCAGG + Intergenic
1177315278 21:19452459-19452481 TGAGTTGCAAACTAAAAGTCTGG - Intergenic
1179200443 21:39214244-39214266 TGACTTGGAAATTCAGACCCAGG - Intronic
1179372296 21:40817709-40817731 GGACTTTCAAATTTACAGCTAGG + Intronic
1179924120 21:44523130-44523152 TGACTGACAAATTAACTGACTGG - Intronic
1179924127 21:44523214-44523236 TGACTGACAAATTAACTGACTGG - Intronic
1182743792 22:32589007-32589029 TTACATGCAAATTAAGAGGCGGG - Intronic
1184258151 22:43298718-43298740 TGACTTGTAGAGCAACAGCCAGG - Intronic
1184583663 22:45433706-45433728 TGACTTGGAAATTGCCAGGCAGG + Intergenic
950959549 3:17091017-17091039 TGATTTGCAAAATAAAAGCTTGG - Intergenic
955874422 3:63474949-63474971 TGACTTGCAAATTAACCAGAAGG + Intronic
955986919 3:64583263-64583285 TGATTTGCAGATTCACAGTCTGG + Intronic
956090577 3:65662271-65662293 TGACATTCAAATGAGCAGCCTGG + Intronic
963762581 3:149298581-149298603 TGACTTGAAAATTCACATTCTGG + Intergenic
965897125 3:173592126-173592148 TGACTTCCAAATGAACAGGGAGG - Intronic
968230048 3:197000187-197000209 TGATGTGCACATTAACTGCCTGG - Intronic
972862897 4:43193015-43193037 TGACTTGCAGATTAAAAACATGG + Intergenic
974917046 4:68190868-68190890 TGACTTGCAAGTCAAAAGACAGG + Intergenic
974935547 4:68405935-68405957 TGACTTGCACATACACATCCCGG + Intergenic
984072917 4:175138839-175138861 TAAGCTGCAAAATAACAGCCTGG - Intergenic
984489996 4:180421876-180421898 TGACTTGGAAATTGACAGATAGG - Intergenic
986289392 5:6387613-6387635 TGTCTTGCGTATTAATAGCCAGG - Intergenic
988448539 5:31315556-31315578 TTAATTCCAAATGAACAGCCTGG + Intronic
989189953 5:38661089-38661111 TGACCTGCAAATTAGAAGCCAGG + Intergenic
989435062 5:41402579-41402601 AGACTTGCACATTATCAACCAGG - Intronic
990079336 5:51893474-51893496 TGACTTTCCAATTTCCAGCCTGG + Intergenic
990158398 5:52906370-52906392 TGAATGGCAAATTAAGAGCTTGG + Intronic
993089606 5:83409012-83409034 TGGATTGCAAATTAACAGAAAGG - Intergenic
994849829 5:105040029-105040051 TGACTTTCAAATATTCAGCCAGG - Intergenic
1001233271 5:170008327-170008349 TGACTCTGAAATTAACATCCTGG - Intronic
1001597958 5:172910224-172910246 TGACATGGATAATAACAGCCTGG - Intronic
1002685533 5:181006198-181006220 TGACTAGCAAATGAGGAGCCTGG - Exonic
1006899788 6:37492641-37492663 TCACTTGCTAATTCACAGCCTGG + Intronic
1007123368 6:39401958-39401980 TGACTCCCAAAATACCAGCCAGG - Intronic
1009757018 6:67953246-67953268 TTACATGCAAATTAAGAGGCAGG - Intergenic
1015708517 6:136114125-136114147 AGATTAGCAAATTAACAGTCAGG - Intronic
1016150416 6:140734855-140734877 GAACTTGCAAATTAAGTGCCTGG - Intergenic
1017659928 6:156663897-156663919 GGACTTGCAAGGTAGCAGCCTGG + Intergenic
1018186831 6:161272916-161272938 TGAGTAACAAATTAACTGCCGGG - Intronic
1021454664 7:20816708-20816730 GGAATTGCAAAATCACAGCCAGG - Intergenic
1022472187 7:30688787-30688809 GGACTTGCAAAGCAGCAGCCCGG - Intronic
1023115267 7:36856080-36856102 TGACTTGCAATGTAACACCTAGG + Intronic
1023584085 7:41710686-41710708 TGACTTGTAACTTTCCAGCCAGG - Intergenic
1025736955 7:64159080-64159102 TGACGTGAAAATTATAAGCCTGG - Intronic
1026523550 7:71135905-71135927 TGACTTGCAAGTTGGCAGCAAGG + Intronic
1026792116 7:73340849-73340871 TGACTTGGGAATAAACACCCAGG + Intronic
1028146469 7:87325432-87325454 TGCCTTGCAGATAAACTGCCAGG - Intergenic
1029576665 7:101407900-101407922 TGGTATGCAAATTAACAGGCAGG - Intronic
1034729154 7:153368591-153368613 TGACTTACACATTAATAGCTGGG + Intergenic
1036035173 8:5010810-5010832 TGATAAGCAAATTAACAGCCAGG - Intergenic
1039708507 8:40031921-40031943 TGAATTTCAAAGTAACAGCAAGG - Intergenic
1039898280 8:41731757-41731779 TCACTTGCAAAATCACAACCTGG + Intronic
1041406829 8:57508785-57508807 TAATTTGCAAAGCAACAGCCAGG - Intergenic
1042856174 8:73270369-73270391 TTACTTGAAAATTAACAGAATGG + Intergenic
1046858780 8:119067069-119067091 TCACTTGAAAATAAACAGTCTGG + Intronic
1047064477 8:121265055-121265077 TGAACTGCAAATAAACAGCATGG - Intergenic
1048343037 8:133555346-133555368 TGACTTGGAGATTACGAGCCTGG - Intronic
1051843753 9:21428469-21428491 TCAGTTGAAAATGAACAGCCAGG - Intronic
1056386000 9:86097979-86098001 TGACTTGGATATTAAGGGCCAGG - Intronic
1058480694 9:105391444-105391466 TGAGTTGCAAATTAATTGCCAGG + Exonic
1059090237 9:111348865-111348887 AGACTCCCAAATTAACTGCCTGG + Intergenic
1060253152 9:122002206-122002228 TTCCTTGCAAATGAACACCCAGG - Intronic
1060679808 9:125552222-125552244 CAACTTGCAAATTAGGAGCCTGG - Intronic
1187389087 X:18874098-18874120 TGACATGCAAATTAACGGGGCGG - Intergenic
1187486817 X:19711875-19711897 TGCCTTGCATTTTAACAGTCTGG - Intronic
1199851019 X:151725029-151725051 TGAGTTGCAAACAAACAGCACGG + Intergenic