ID: 946127092

View in Genome Browser
Species Human (GRCh38)
Location 2:217572461-217572483
Sequence CTAAGGGTCTGGAGGGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946127083_946127092 0 Left 946127083 2:217572438-217572460 CCCTCAAGTATGCCTGAGATGAG 0: 1
1: 0
2: 0
3: 6
4: 105
Right 946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 211
946127082_946127092 1 Left 946127082 2:217572437-217572459 CCCCTCAAGTATGCCTGAGATGA 0: 1
1: 0
2: 0
3: 9
4: 126
Right 946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 211
946127084_946127092 -1 Left 946127084 2:217572439-217572461 CCTCAAGTATGCCTGAGATGAGC 0: 1
1: 0
2: 0
3: 6
4: 109
Right 946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG 0: 1
1: 0
2: 1
3: 19
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946127092 Original CRISPR CTAAGGGTCTGGAGGGCACA GGG Intronic
900306356 1:2010799-2010821 CTTAGGGGGTGGGGGGCACAGGG - Intergenic
900413007 1:2521544-2521566 CAAAGGGTCTTGAAGGGACACGG + Intronic
900558918 1:3294071-3294093 CCAAGGCTCAGGTGGGCACATGG - Intronic
901490998 1:9596131-9596153 CTCAGGGCCTGGAGAGGACAGGG - Intronic
903661450 1:24981300-24981322 CTGAGGGTCTGGAAGGCATCAGG + Intergenic
904356344 1:29942565-29942587 CACAGGGTCTGGGGGGCAGAGGG + Intergenic
904896895 1:33824380-33824402 CTCAGGGACTGGATGGCAGAGGG - Intronic
905004317 1:34697947-34697969 CTGAGGCCCTGGAGGGGACATGG + Intergenic
905888577 1:41505298-41505320 CTAAGGGTCGGGAGGACGAAGGG - Intergenic
907035766 1:51214887-51214909 CTTAGAGTCTGGAGGGCAGTTGG - Intergenic
911230636 1:95357646-95357668 CCATGAGTCTGGAGGGGACATGG + Intergenic
914814747 1:151055217-151055239 CTAAGGGCCTGGTGGGAAGAGGG + Intronic
916056866 1:161074041-161074063 CTAAGGGTCTGGAGCACAGATGG - Intronic
919128747 1:193428117-193428139 CTGAGGGTCAGGTGTGCACAAGG + Intergenic
923093916 1:230760087-230760109 CTGAGGGTCTGCGGGTCACACGG - Intronic
924099354 1:240587906-240587928 GTAAGGGACTGGAGGGAATAGGG - Intronic
1063187752 10:3665985-3666007 CTCAGGGTCTGGTGGCCCCAGGG - Intergenic
1064672852 10:17733695-17733717 ATAAGGGTCTGAACGTCACAAGG - Intergenic
1064796618 10:19019286-19019308 CTAATGCACTGCAGGGCACATGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1069426160 10:68290358-68290380 CTAAGGCTCTGGAGAACAGATGG - Intronic
1069910358 10:71755143-71755165 CAAAGGGGCTGGTGGGCACTTGG + Intronic
1070112341 10:73497753-73497775 CCTAAGGTTTGGAGGGCACAGGG + Exonic
1070503337 10:77091593-77091615 CTATGAGCCTGGGGGGCACAGGG - Intronic
1072172418 10:92878467-92878489 CAAAGGGTAAGGAGGGCACTGGG - Intronic
1072983390 10:100118361-100118383 CTAATGGAATGGAGGACACATGG - Intergenic
1075657980 10:124174428-124174450 CTTTGGGGCTGGAGGGCACTGGG - Intergenic
1075698975 10:124456221-124456243 CCAAGGTACTGGTGGGCACAGGG - Intergenic
1075889183 10:125930858-125930880 GTAAGGGTGTGGAGGGGGCAAGG - Intronic
1077047297 11:552204-552226 CTCAGGGCCTGGAGGGAACATGG + Exonic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1080100547 11:28454869-28454891 CTAAAGGTTTGGAAAGCACAAGG + Intergenic
1081657726 11:44868448-44868470 GTATGGGTGTGGAGGGCACCTGG + Intronic
1081659584 11:44879804-44879826 ATAAGTGTCTGGAGGCCAGATGG + Intronic
1083144508 11:60748603-60748625 CTAAGGGGCTGGACGGCTCCTGG + Intergenic
1083254080 11:61485732-61485754 CTGAGCCTCTGGAGGACACATGG + Intronic
1083831069 11:65233925-65233947 CTAAGCAGCTGGAGAGCACAGGG + Intergenic
1084889529 11:72229909-72229931 TTCAGGGCCTGGAGGGAACAAGG - Exonic
1085086959 11:73674866-73674888 CTACTAGTCTGGAAGGCACAAGG + Intergenic
1086401788 11:86466711-86466733 CTAAGGTTCTGGAAGGACCACGG - Intronic
1086700994 11:89900325-89900347 CTAAGTTTCTGGACGGCAGAGGG + Intergenic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1086705173 11:89944202-89944224 CTAAGTTTCTGGACGGCAGAGGG - Intergenic
1089349661 11:117815196-117815218 CCAAGGGGCGGGAGGGAACAAGG + Intronic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1090280435 11:125451678-125451700 CCAAAGGGCTGGGGGGCACATGG - Intronic
1090803280 11:130187854-130187876 CTCAGGGTCTGGACAGCACCAGG - Intronic
1091804718 12:3347668-3347690 CTAAGGCTCCAGAGGTCACAGGG - Intergenic
1093723553 12:22475528-22475550 CTAAGTGTCTGTCGGCCACAAGG + Intronic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1095949903 12:47776223-47776245 CTAAGGGTAAGGAAGGCATAGGG - Intronic
1100029156 12:90164607-90164629 CCAAGGGTGTGGAGGACACAAGG - Intergenic
1103817942 12:123673696-123673718 AGAAGGGTCTGGAGGATACAGGG - Exonic
1104491885 12:129201375-129201397 CTAAGTGGCTGCAGGGGACATGG + Intronic
1105029584 12:132873548-132873570 CTACGGGGCTGGAGTGCACACGG + Intronic
1105029602 12:132873638-132873660 CTACGGGGCTGGAGTGCACACGG + Intronic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1107073860 13:36299953-36299975 CTAAGAGTCTAGAGAGAACAAGG + Intergenic
1107662994 13:42658613-42658635 CTCATGGGCTGGAGGGGACAAGG - Intergenic
1109721679 13:66283449-66283471 CCACTGCTCTGGAGGGCACAAGG - Intergenic
1110123646 13:71913845-71913867 CTAAAGGTCTGGAGGGCCAGTGG - Intergenic
1114976834 14:28112322-28112344 CTAAGGATCTGGGAGGCAGATGG - Intergenic
1115160245 14:30385824-30385846 ATCAGGGTCTGGAAGGTACATGG - Intergenic
1116097639 14:40391687-40391709 CAAAGGATCTGGAGGGGGCAGGG - Intergenic
1118349957 14:64966711-64966733 CAAAGTGTCTGAAGGTCACAGGG + Intronic
1119182605 14:72614815-72614837 CTAAGGAGCTGGAGGGCAGCAGG - Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1125394188 15:39229039-39229061 AGAAGGGACTGGAGGGCAAAAGG - Intergenic
1127987239 15:64083329-64083351 CTTAGGGTTTGGAGGTCAGAAGG - Intronic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1129245532 15:74276669-74276691 CCAGGAGGCTGGAGGGCACAGGG - Intronic
1130135283 15:81176925-81176947 CTGAGGGGCTGGGGGGCACAAGG + Intronic
1130154404 15:81337266-81337288 CTTGGGGTCTGGAGGACCCAGGG + Intronic
1132555932 16:572673-572695 CTAAGGGCGTGGTGGGCACTGGG + Intronic
1132555947 16:572728-572750 CTAAGGATGTGGTGGGCACTGGG + Intronic
1132713595 16:1279808-1279830 TCAAGGTTCTGGAGGGCTCAGGG - Intergenic
1135282580 16:21165488-21165510 CTTAGGGACTGTATGGCACAGGG - Intronic
1135759562 16:25126267-25126289 CGCAGGGTCTGGAGGGCATCTGG - Intronic
1138152900 16:54675665-54675687 TTAAGGGTATGGGGGCCACAGGG + Intergenic
1138320372 16:56106154-56106176 AGAAGGGGCTGGAGGGCTCAGGG + Intergenic
1138712583 16:58986355-58986377 CTCAGGCTCTGGAGAGCACATGG - Intergenic
1138791435 16:59908220-59908242 TTCAGGGGCCGGAGGGCACATGG + Intergenic
1139955662 16:70691822-70691844 CCAGCGGTGTGGAGGGCACAGGG + Intronic
1140961125 16:79914165-79914187 CTAAGGGTATGGGGGGTCCAAGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142777555 17:2153521-2153543 CTAAGAGTCTCTATGGCACAGGG + Intronic
1143135944 17:4712286-4712308 CAAAGGGTATGGAGGGCCCCAGG - Intronic
1143443725 17:6995537-6995559 CTCAGGTACTGGAGGACACATGG + Intronic
1145004978 17:19332637-19332659 CCAAGGGGCTGGATGTCACAAGG - Intronic
1145913331 17:28555197-28555219 CTCAGGGTCTTGGGGGCATAAGG + Intronic
1149423599 17:56533645-56533667 CTCAGGGTGGGGAAGGCACATGG - Intergenic
1149544897 17:57496259-57496281 CTGTGGCTCTGTAGGGCACACGG - Intronic
1151021567 17:70623254-70623276 CTAAGTGGCTGGCTGGCACATGG + Intergenic
1151906933 17:77054845-77054867 CTCAGGGGCTGGAGAGCAGAGGG + Intergenic
1153537408 18:6116861-6116883 CACAGGGTTTGGAAGGCACATGG - Intronic
1153656519 18:7287638-7287660 TTAAGGGTCTGGAGGAGGCAGGG - Intergenic
1157170920 18:45404382-45404404 TTAATGGTCTTGAGGGCTCAGGG + Intronic
1157393043 18:47318870-47318892 GGAAGGGTGAGGAGGGCACATGG + Intergenic
1158419590 18:57280967-57280989 CAAAGGGTCTGGAAAGTACAAGG - Intergenic
1159883778 18:73885066-73885088 CTCAGGCTCTGCAGGGAACAGGG - Intergenic
1159895213 18:73989710-73989732 CTAAAAGTGAGGAGGGCACATGG - Intergenic
1160153969 18:76418898-76418920 CAGAGGGTCTGCAGGGCAGATGG + Intronic
1161586716 19:5109666-5109688 CTGAGGGTCTGGGAGGCTCAGGG - Intronic
1164593388 19:29518315-29518337 CCATGGGTCTGGAGAGCACAAGG + Intergenic
1165849066 19:38838657-38838679 CTAAGCCTCTGGAGGCCACAGGG - Intronic
1165902447 19:39175101-39175123 CTAGTGGTCTGGAGGGGACTTGG - Intronic
1166174734 19:41059272-41059294 CCAAGGGTATGGGGGCCACAAGG - Intergenic
1167417839 19:49386545-49386567 ATCAGGGGCTTGAGGGCACATGG + Intergenic
1167774026 19:51543099-51543121 CTAAGGGGCAGGAGGGGACTGGG + Intergenic
1168361593 19:55745379-55745401 CTGAAGGTCTGGAGTGCATAAGG - Intergenic
925084991 2:1100952-1100974 ATGAGGCTCGGGAGGGCACACGG - Intronic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925542282 2:4978890-4978912 CCAAGGGGCAGGAGAGCACACGG + Intergenic
927711281 2:25327946-25327968 CAAAGGGCCTGGAGGGAATAGGG - Intronic
929528133 2:42725557-42725579 CTCAGGGTTGGGAGAGCACAAGG + Intronic
930296441 2:49560474-49560496 CTTAGGGGCTGAAGGGCACTAGG + Intergenic
931881767 2:66576620-66576642 CCTGGGGGCTGGAGGGCACATGG + Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
934935893 2:98465208-98465230 CTAAGCTACTGGAGGGAACATGG - Intronic
935360401 2:102241630-102241652 CTTAGGGTCTGTCTGGCACATGG - Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
941223196 2:162811119-162811141 CTAATGTTCTAGAGGGCAAAGGG - Intronic
943322520 2:186463103-186463125 ATAAGGGTGTGGAGGGCAGGGGG - Intergenic
944324946 2:198393164-198393186 CTATTGGGATGGAGGGCACATGG + Intronic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
948545725 2:238727335-238727357 ATAGGTGTCAGGAGGGCACAGGG + Intergenic
1172183388 20:33016979-33017001 CCCTGGGGCTGGAGGGCACAAGG - Intronic
1173433974 20:43016222-43016244 CCCAGGGTCTGGAGGAAACATGG - Intronic
1177971358 21:27793924-27793946 CTAAGTGTCTGGAGGCAACTGGG - Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1179959169 21:44758705-44758727 ATCATTGTCTGGAGGGCACATGG + Intergenic
1181307978 22:21927655-21927677 CCAAAGGGCAGGAGGGCACAGGG + Intronic
1181463061 22:23096630-23096652 CTCAGGGTGTGGAGGCCACAGGG + Intronic
1181680982 22:24495584-24495606 CTCAGGGTCTGAAGGGCTCAGGG + Intronic
1183360101 22:37378929-37378951 CTAAGGGTCCAGCGGTCACATGG + Intronic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1184521503 22:44997179-44997201 GTAAGGGACTGGAGGGGACGAGG - Intronic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
953510774 3:43536367-43536389 CTAACCGTTTTGAGGGCACAGGG - Intronic
955043226 3:55336449-55336471 ATAAGGGTTTGGAGGGCTGATGG + Intergenic
956673131 3:71709988-71710010 CTAAAGGTTTAGAGGTCACATGG - Intronic
959443368 3:106406766-106406788 CATAGGGACTGGAGGGAACAAGG - Intergenic
960167541 3:114420640-114420662 CTTAGGGTCTCTAGGGCACAGGG + Intronic
960494241 3:118355643-118355665 CTAAGGTTTGGGAGGGCAAATGG + Intergenic
960885594 3:122390837-122390859 CTAAGGCTCTGGGTGGCAAACGG - Intronic
961325716 3:126108239-126108261 CTCAGGGTCTAGAGGGGACAGGG - Intronic
961871027 3:129988410-129988432 GAATGGGTCTGGAGGGCAAATGG - Intergenic
961871278 3:129990085-129990107 AAATGGGTCTGGAGGGCAAATGG + Intergenic
962725154 3:138218207-138218229 ATAGGGGTCTGGAGATCACAAGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
967080314 3:186043730-186043752 CTTAGGGGGTTGAGGGCACATGG - Intergenic
976888917 4:90020974-90020996 CTCAGCTACTGGAGGGCACAGGG + Intergenic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
981667681 4:147247895-147247917 GTCAGAGTCTGGAGAGCACATGG + Intergenic
982988884 4:162245164-162245186 GTAAGGGTCAGAAGGGCAGAAGG + Intergenic
984724713 4:183009668-183009690 CTAAGGAGCTGGAGGACAAAAGG + Intergenic
985699337 5:1361110-1361132 CTAGGGGTTTTGAGGGCAGAGGG + Intergenic
985836409 5:2275315-2275337 CTAAGGGTTCCGAAGGCACATGG + Intergenic
990529043 5:56655658-56655680 CTAAGGGCTTGGAGGGGGCATGG - Intergenic
995504700 5:112848124-112848146 CTAAGGGTCTGGATTCCAAAAGG - Intronic
997603523 5:135156555-135156577 GGATGGGTCTGGAGGGAACAAGG + Intronic
998154127 5:139774835-139774857 CTCGGGGTCCGCAGGGCACAGGG + Intergenic
999188664 5:149730968-149730990 ATAAGGGTCTGCGGGGCACGTGG + Intronic
1001308858 5:170596281-170596303 CTATGGGTGTGATGGGCACAGGG - Intronic
1002437114 5:179238449-179238471 GGAAGGGGCTGGAGGGCACAGGG + Intronic
1004094419 6:12538625-12538647 TTAAGGGTATGGAGGGCAAAGGG + Intergenic
1005394696 6:25369264-25369286 CTAATGGTGTCGATGGCACAGGG - Intronic
1006671018 6:35729746-35729768 CTATGGGGCTGGAGGGGAAAGGG - Intergenic
1007282941 6:40725750-40725772 TCAAGAGTCTGCAGGGCACAAGG + Intergenic
1007734976 6:43976293-43976315 ATGAGAGTCTGGAGGACACAAGG + Intergenic
1007820690 6:44558671-44558693 CTAAGGGGCTGGAGGGCACCAGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1018058610 6:160072485-160072507 CTAAGAGTCTGGTGGGCATGGGG - Intronic
1018452193 6:163919484-163919506 CTACGGTTCCGGAGGGCACGTGG + Intergenic
1019495696 7:1339419-1339441 CTAAGGGTCTGGAGAGAAAAAGG - Intergenic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1020676336 7:11189113-11189135 CAAGGGATCTGGAGGGCACTGGG + Intergenic
1022369828 7:29759943-29759965 CTCAGGGTCTGAAGGGGATACGG + Intergenic
1026903266 7:74048579-74048601 CTAGGGGCCTGGAGGCCACCAGG - Intronic
1028220816 7:88194747-88194769 ATAATGGTCTGGAGGGCTAAAGG - Intronic
1028281995 7:88941935-88941957 CTAAGGGACTTCAGGGCCCAAGG - Intronic
1032543615 7:132724449-132724471 AGAAGGGGCTGGAGGGGACAAGG - Intronic
1033406858 7:141078189-141078211 CTAAGGGTCTGGAAGTCTCTTGG - Intronic
1034928963 7:155145154-155145176 CTAATGGCCTGGTTGGCACAGGG + Intergenic
1035022802 7:155809080-155809102 CTAAGGGGCAGGAGGCCAGAGGG - Intronic
1035089528 7:156295672-156295694 CTAAGGGTGGGGGAGGCACAGGG + Intergenic
1035673660 8:1439391-1439413 CAGAGGCTCCGGAGGGCACAGGG - Intergenic
1035706357 8:1678447-1678469 CCAGGGGTCTGGAGGGGGCAGGG - Exonic
1037882975 8:22581822-22581844 CCAAGAGTGTGCAGGGCACAGGG + Intronic
1037897039 8:22664500-22664522 CTAGAGGTCTGCAGGACACAAGG + Intronic
1038402559 8:27296528-27296550 CTAAGGGTAATGAGGTCACATGG - Intronic
1038892446 8:31741213-31741235 CTTAGGGGCAGGAGGGAACAGGG + Intronic
1038992449 8:32883530-32883552 CTAAGGATCTGGAAGGCTAATGG - Intergenic
1040546763 8:48404053-48404075 CTACGGGCCTGGAGGGCAGAGGG - Intergenic
1040658478 8:49541775-49541797 CTAATGGTCTTGAGGGGACTGGG + Intronic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1042837670 8:73092738-73092760 TAAAGGGTCTGGAGGACACCTGG + Intronic
1044461922 8:92455598-92455620 CTAATGGTTTGCAGTGCACACGG + Intergenic
1045343643 8:101275165-101275187 CAAAGGGTGTGGAGAGCAGATGG - Intergenic
1046255778 8:111694583-111694605 CTTAGGTTCTGGAGGGAGCAGGG - Intergenic
1048047382 8:130785657-130785679 CTAAGGGTCAGGAGTGGAGATGG + Intronic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048540147 8:135334921-135334943 CTAAGAGGCTGCAGGGCATAGGG - Intergenic
1049159977 8:141090898-141090920 CTCAGGGTCTGAGGGGCCCAAGG + Intergenic
1049335069 8:142079933-142079955 CTGCAGGTATGGAGGGCACACGG + Intergenic
1050317993 9:4423009-4423031 CTAAGGGTCAGGTGGACAGAAGG + Intergenic
1050365039 9:4866208-4866230 CTAAGGGTCAGAAGGACAGAGGG - Intronic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1052465305 9:28822113-28822135 CCATGGGACTGGAGGGCATAAGG - Intergenic
1056845822 9:90037321-90037343 CTAAGGATCAGCAGTGCACATGG - Intergenic
1058348966 9:103999329-103999351 CGAAGGGCCTGGAGGGCCCTGGG - Intergenic
1059568395 9:115407600-115407622 CTAAGGATCTGAACGGCAAAAGG + Intergenic
1059684749 9:116624344-116624366 CTTAGTTTCTGGAAGGCACAAGG - Intronic
1059976524 9:119723852-119723874 CTCAGGCTCTGGAGGGCAGCAGG + Intergenic
1060274375 9:122171344-122171366 GTAAGTGTCAGGAGGGCAAAGGG - Intronic
1061435755 9:130560700-130560722 ATAAGCCTCTGGAGAGCACAGGG - Intergenic
1061872470 9:133528209-133528231 CCCAGAGTCTGGAGGGCATATGG - Intronic
1062025837 9:134340243-134340265 CTAAGGGTCCTGAGGGCTCGGGG + Intronic
1062319626 9:135984385-135984407 CAGAGGGGCTGGAGGGGACAAGG + Intergenic
1062396471 9:136354849-136354871 CACAGGGTGTGGTGGGCACAGGG + Intronic
1062644900 9:137542858-137542880 CCAAGAGTCTCGAGAGCACACGG + Intronic
1186441210 X:9588246-9588268 CTAAGGGACTGGAGGATACTCGG + Intronic
1186788452 X:12974770-12974792 CTAAGGGTCGGGGTGGCACCTGG - Intergenic
1188016430 X:25112277-25112299 CTAAGGCTGAGCAGGGCACAGGG + Intergenic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1191877694 X:65812928-65812950 CTAAGGTTGTGCAGGGCACTAGG - Intergenic
1195740545 X:108060888-108060910 CCAGGGGTATGGAGGGAACAGGG - Intronic
1196848102 X:119912792-119912814 CTAAGGGACTTGAGCGCACGTGG - Intronic
1198673199 X:139103879-139103901 TTAAGGTTCTAGAAGGCACAAGG - Intronic
1200063982 X:153496089-153496111 CCAGGGATCTGCAGGGCACAGGG + Intronic
1201400476 Y:13599229-13599251 CTGAGGCTCTGGAGGGCAACAGG - Intergenic