ID: 946129403

View in Genome Browser
Species Human (GRCh38)
Location 2:217594122-217594144
Sequence TAGGGGATAAGAAGGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1141
Summary {0: 1, 1: 0, 2: 2, 3: 91, 4: 1047}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946129395_946129403 2 Left 946129395 2:217594097-217594119 CCAAGGACTCAGCTTCTATTTCT 0: 1
1: 0
2: 2
3: 35
4: 378
Right 946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 1047
946129393_946129403 20 Left 946129393 2:217594079-217594101 CCTGGTTAAACTCAGAGGCCAAG 0: 1
1: 0
2: 1
3: 9
4: 126
Right 946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG 0: 1
1: 0
2: 2
3: 91
4: 1047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946129403 Original CRISPR TAGGGGATAAGAAGGGAGGA AGG Intronic
900391504 1:2435959-2435981 GAGGAGGGAAGAAGGGAGGAGGG - Intronic
900391531 1:2436033-2436055 AAGGAGAGAGGAAGGGAGGAGGG - Intronic
900391540 1:2436060-2436082 GAGGAGAGAGGAAGGGAGGAGGG - Intronic
900493536 1:2965417-2965439 TAGATGATAAGAAGGATGGATGG - Intergenic
900622548 1:3593934-3593956 AAGGGGAAGAGAAGGGATGATGG - Intronic
900647951 1:3717528-3717550 TAGGGAAGGAGAAGGCAGGAGGG + Intronic
901224190 1:7602158-7602180 GAGGGGAAGGGAAGGGAGGAGGG - Intronic
901741180 1:11343010-11343032 CAGGGGAGAAGAGGGGAGGTGGG + Intergenic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902984974 1:20149608-20149630 GAGGGGAGAAGATGGGAGCATGG + Exonic
903012602 1:20342319-20342341 TGGGGGAGCAGAAGGAAGGAGGG + Intronic
903331782 1:22600302-22600324 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
903787548 1:25871527-25871549 GAGGGGAGGGGAAGGGAGGAAGG - Intergenic
903883993 1:26530639-26530661 AGGGGCATAAGAAGGGAGGCAGG - Intronic
903964338 1:27077059-27077081 AAGGGGAGGAGAAGGGAAGAAGG - Intergenic
904308189 1:29604180-29604202 AAGGGGGAAAGAAGGGTGGAAGG - Intergenic
904319225 1:29685690-29685712 AAGGGGAAAGGAAGGAAGGAGGG - Intergenic
904320726 1:29696472-29696494 AAGGGGATCAGTAGGGAGGGTGG - Intergenic
904471147 1:30737154-30737176 TTGGTGATGAGAAGGCAGGAGGG - Intronic
904747930 1:32722491-32722513 AAGGAGAAAAGAAGGAAGGAAGG + Intergenic
904890625 1:33776829-33776851 TAGAGGATGGGAAGGGATGATGG + Intronic
905173885 1:36124813-36124835 TCTGGGAGAGGAAGGGAGGAGGG + Intronic
905421695 1:37850494-37850516 AAAGGGAAAAGAAGGAAGGAAGG + Intronic
905429132 1:37908919-37908941 TAAAGGAGAAGAAGGGAGAATGG - Intronic
906956611 1:50380843-50380865 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
907097822 1:51797623-51797645 TAGAGGCTAAAATGGGAGGAAGG - Intronic
907516078 1:54994292-54994314 TAGAGGAGAGGAAGGGAGGGAGG - Intergenic
907623019 1:56001302-56001324 AAGTGGGTAAGAAGGAAGGAAGG + Intergenic
907943345 1:59109822-59109844 AAGAGGAAAAGAAGGGAGGCGGG + Intergenic
907987998 1:59552084-59552106 GAGGGACTAAGGAGGGAGGAGGG + Intronic
908787369 1:67748518-67748540 GGGGGGATAAGAAGAGAGGGTGG + Intronic
908795180 1:67824149-67824171 ATGGGGATAAGATGGGAGCAAGG + Intronic
908800912 1:67879796-67879818 GAGGGAAAAAGAAGGAAGGAAGG - Intergenic
908849738 1:68363747-68363769 TAGAGGATAGAAAGGCAGGATGG + Intergenic
908874287 1:68652652-68652674 TATGGGAGAAGATGAGAGGAAGG - Intergenic
909056267 1:70824802-70824824 TATGGGAGAAGCAGAGAGGAGGG - Intergenic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909190434 1:72542643-72542665 TATGGGATGGGAAGAGAGGATGG + Intergenic
909250811 1:73353700-73353722 TAGGGAATAAGAGGATAGGAAGG - Intergenic
909582927 1:77258365-77258387 AAGGGGATATGAAGAGAGGCCGG + Intergenic
910402047 1:86847277-86847299 TAGGGGAAAAGAGATGAGGATGG - Intergenic
910520854 1:88120731-88120753 TGGGGAATCAGAAAGGAGGATGG + Intergenic
910528109 1:88204284-88204306 TAGGGGAGAAGAGGGGACGCTGG - Intergenic
911070412 1:93827717-93827739 GAGAGGAAGAGAAGGGAGGAGGG + Intronic
911070928 1:93831301-93831323 TAAGGGAGAAGAAGGGGGAATGG - Intronic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911568356 1:99491962-99491984 CAGCTGATGAGAAGGGAGGAGGG - Intergenic
911908252 1:103596591-103596613 TAGAGGCTGAGAAGGGTGGATGG + Intergenic
911910621 1:103629634-103629656 TAGAGGCTGAGAAGGGTGGATGG + Intergenic
911914666 1:103682875-103682897 TAGAGGCTGAGAAGGGTGGATGG - Intronic
911918036 1:103723759-103723781 TAGAGGCTGAGAAGGGTGGATGG + Intronic
912000435 1:104827173-104827195 AAATGGAAAAGAAGGGAGGAAGG - Intergenic
912813420 1:112810678-112810700 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
912897902 1:113612450-113612472 AGGAGGATGAGAAGGGAGGAAGG + Intronic
913404172 1:118470426-118470448 TAGGGAATTAGAAGGGAAGAAGG + Intergenic
913944262 1:125142885-125142907 AAGAGGAAAAGAAGGGAGGGAGG + Intergenic
913954924 1:143280877-143280899 AAGGGGAAAGGAAGGGAGGGAGG - Intergenic
914330279 1:146662914-146662936 CAGAGGATAAGAAGGGTAGAGGG + Intergenic
914924371 1:151871711-151871733 AAGTGGATACGAAGGGAGGCAGG + Intergenic
914956784 1:152169704-152169726 TAGGGGAGAAAAAGTGAGAAGGG + Intergenic
915350474 1:155221901-155221923 GAGGAGAAAAGAAGGAAGGAAGG - Intergenic
915425263 1:155820739-155820761 TAGGGGCCAAGGTGGGAGGATGG + Intronic
915519559 1:156433868-156433890 TGGGGGAGAAGCAGGCAGGAGGG - Intergenic
915720633 1:157982578-157982600 TAGGGGGTATGAGGGGAGGCAGG + Intergenic
916197500 1:162238198-162238220 TGGGGGAGAAGGAGGGAGAATGG + Intronic
916226396 1:162493952-162493974 TTGGGGATGGGATGGGAGGAGGG + Intergenic
916275953 1:162993418-162993440 TGGGGTATAAGAAAGGAGAAAGG + Intergenic
916443620 1:164851996-164852018 CAGGAAATAAGAAGGAAGGAAGG + Intronic
916524763 1:165598881-165598903 GAGAGGAGAAGAGGGGAGGAGGG + Intergenic
916878136 1:168992283-168992305 TAGGGGAGAAGAGGGAAGTAGGG + Intergenic
917021247 1:170590758-170590780 AAGGGGAAAGGAAGGAAGGAAGG + Intergenic
917045587 1:170856330-170856352 GAGAAGAGAAGAAGGGAGGAGGG + Intergenic
917105008 1:171483330-171483352 GAGGGGAGAAGGAGGGAGGGAGG + Intergenic
918023803 1:180722161-180722183 TAGAGGCTGAGATGGGAGGATGG + Intronic
918122230 1:181550038-181550060 TTGGGGGTAATTAGGGAGGAAGG + Intronic
918543268 1:185654444-185654466 ATAGGGGTAAGAAGGGAGGAAGG - Intergenic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918625646 1:186653399-186653421 AAAGGGATAGGTAGGGAGGATGG + Intergenic
919493506 1:198235369-198235391 AGGGGGAAAAGAAGGGAGGGTGG - Intronic
919613555 1:199776937-199776959 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
919689428 1:200515777-200515799 GAAGGGGAAAGAAGGGAGGAAGG + Intergenic
919710312 1:200720994-200721016 GAGGGGAAGGGAAGGGAGGAAGG - Intergenic
919834908 1:201566980-201567002 TTGGGGATTATAAGTGAGGAGGG - Intergenic
919926118 1:202192740-202192762 TAGGGCAAAAAAAGGAAGGAGGG + Intergenic
920058159 1:203207708-203207730 CAGGGGAGAAGAAAGAAGGAGGG + Intergenic
920073717 1:203321771-203321793 GAGGGGAGAAGAAGAGGGGAAGG - Intergenic
920363000 1:205432184-205432206 GAAGGGAAAAGGAGGGAGGAGGG + Intronic
920577914 1:207075865-207075887 TAGGAGATAAGAAGAGAAGCAGG - Exonic
920716429 1:208344523-208344545 GAGGGAAGAAGAGGGGAGGAGGG - Intergenic
920812878 1:209303677-209303699 TAGGGGATAAGTAGGATAGAAGG - Intergenic
921132225 1:212229689-212229711 GTGGGGAGAGGAAGGGAGGAGGG - Intergenic
921133527 1:212239763-212239785 TACAGCATAAGTAGGGAGGAAGG - Intergenic
921266887 1:213428410-213428432 GAGGGGAGAGGAAGGGAGGGAGG - Intergenic
921711249 1:218375761-218375783 TACGGGATATTGAGGGAGGAGGG + Intronic
921750681 1:218789697-218789719 TTGGGGATGAGAAGAGAAGAGGG - Intergenic
922526008 1:226304690-226304712 TAAGTCCTAAGAAGGGAGGAGGG + Intronic
922598828 1:226834508-226834530 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
922788280 1:228294556-228294578 TCCTGGATAAGAAGGGAGGAGGG - Intronic
922995158 1:229951586-229951608 GAAGAGAGAAGAAGGGAGGAAGG + Intergenic
923261006 1:232268069-232268091 GAGGGGAGAGGAAGGAAGGAAGG - Intergenic
923263886 1:232293982-232294004 TAGGGGAAAGGCAGGGAGGGGGG - Intergenic
923283818 1:232471205-232471227 AAGGGGATAAAATGGGAAGAAGG + Intronic
923751820 1:236753822-236753844 AAGGAGAAACGAAGGGAGGAGGG - Intronic
923885182 1:238146591-238146613 TAAGCAATAAAAAGGGAGGAGGG - Intergenic
924537570 1:244950175-244950197 TCGGGGGAAAGAAGGGAGGCAGG + Intergenic
1062812563 10:477525-477547 TGGGAGATATGAGGGGAGGAAGG + Intronic
1063664622 10:8053899-8053921 TGAGGGATGAGAAGGGGGGAGGG - Intronic
1064134867 10:12741852-12741874 TTTGGGACAAGGAGGGAGGATGG + Intronic
1064268927 10:13848091-13848113 TGGGGGATAAGAAGGGATTGGGG - Intronic
1064388783 10:14923123-14923145 TAGGGGAGATAAAGGGAGGCTGG + Intronic
1064648263 10:17482303-17482325 GAGGGGAGAGGAAGAGAGGAAGG + Intergenic
1065485309 10:26231205-26231227 TAGGAGACAGGGAGGGAGGAAGG + Intronic
1065608509 10:27446607-27446629 AAGGAAAGAAGAAGGGAGGAAGG - Intergenic
1065620676 10:27577839-27577861 TAGGATACAGGAAGGGAGGAAGG - Intergenic
1067178560 10:43968075-43968097 AAGGGGTTAGGAAGGGAGGTAGG + Intergenic
1068168341 10:53360072-53360094 TAGGGGATTGGGAGGGAGGTGGG - Intergenic
1069160286 10:65084277-65084299 TATGGGCTCAGAATGGAGGAGGG + Intergenic
1069558315 10:69412403-69412425 GAGCAGATAAGAGGGGAGGAGGG + Intronic
1069750058 10:70739480-70739502 GAGGGGATGAGAAGGGAGAATGG - Intronic
1070408037 10:76113877-76113899 AAAGGGACAAGAAGAGAGGAGGG - Intronic
1071187091 10:83058404-83058426 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071279724 10:84089643-84089665 AAAGAGATAAGAAGGTAGGATGG - Intergenic
1071444765 10:85735783-85735805 AAGGAGAGAGGAAGGGAGGAAGG + Intronic
1071444889 10:85736261-85736283 AAGGAGAGAAGGAGGGAGGAGGG + Intronic
1071854977 10:89614914-89614936 TTAGGGAGAGGAAGGGAGGAAGG + Intronic
1071876247 10:89846366-89846388 GAAGGGAGAAGGAGGGAGGAAGG + Intergenic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072086764 10:92087331-92087353 TAGGGGAAAAAAAGAAAGGAAGG + Intronic
1072313224 10:94177314-94177336 TAGGGCATGAGAAGGGGGAATGG - Intronic
1072512297 10:96139810-96139832 CAGTGGATAGGAAGAGAGGAAGG + Intronic
1072757164 10:98029334-98029356 AAGTGGAAAAGAAGGGAAGAGGG - Intronic
1073031056 10:100526263-100526285 TAGGAGATAGGAAGATAGGAGGG - Intronic
1073146556 10:101285378-101285400 GAGGGGATGAAAATGGAGGATGG - Intergenic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073564402 10:104522682-104522704 GAGGGGAGGAGAAGGGAAGAAGG + Intergenic
1074197562 10:111202926-111202948 TGGAGGAAAAGAAAGGAGGAAGG - Intergenic
1074679317 10:115887912-115887934 GAGGGGATAAGAATGGAAGCAGG - Intronic
1074827996 10:117228491-117228513 AAGGGGAGAAGGAGGGAGGGAGG - Intergenic
1075576085 10:123578487-123578509 GAGGGTATGAGAAGGGAGGGAGG + Intergenic
1075912415 10:126136113-126136135 TGGGGGTGAAGAAGGAAGGAGGG + Intronic
1076516149 10:131045451-131045473 AAAGGGAGAAGAAAGGAGGAAGG + Intergenic
1077307161 11:1873575-1873597 GAGGGAGGAAGAAGGGAGGATGG + Intronic
1077478900 11:2803774-2803796 GTGGGGATGAGAGGGGAGGAGGG - Intronic
1077871844 11:6269589-6269611 TTGGGGATAAGACGGAAGGAGGG + Intronic
1078410640 11:11114081-11114103 TAGTACATAAGAAAGGAGGAGGG - Intergenic
1078469511 11:11575764-11575786 AAGAGGAAAAGAAGGGAGGAAGG + Intronic
1079017195 11:16879267-16879289 TAGGAGATAAGTAAGGAGTAAGG - Intronic
1079074919 11:17378681-17378703 CAGGGAATGAGAAAGGAGGAAGG + Intergenic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1079329266 11:19520596-19520618 TAGAGGATGGGAAAGGAGGAAGG - Intronic
1079358926 11:19754174-19754196 AAGGGGAAAAGTTGGGAGGAAGG - Intronic
1079637473 11:22762009-22762031 TGGGGGATAAAAAGGTGGGAGGG - Intronic
1080064105 11:27989589-27989611 TAGGAGAGAAGAAAGGAAGAAGG - Intergenic
1080824578 11:35837225-35837247 GAGGGGCTAGGAAGGGTGGAGGG - Intergenic
1080891408 11:36411760-36411782 GAAAGGATAAGAAGGTAGGAAGG - Intronic
1080918989 11:36689734-36689756 TAGGAGACAGGAAGGGAGAAAGG - Intergenic
1080971045 11:37277359-37277381 AAGGGAAAAAGAAGGAAGGAGGG - Intergenic
1081002502 11:37692343-37692365 AAGGGGAGAGGAGGGGAGGAGGG + Intergenic
1081055935 11:38411297-38411319 GAGCTGATAAGAAGGGAAGAAGG + Intergenic
1081402782 11:42662094-42662116 TAGGGACTAACAAGGGAGTAAGG - Intergenic
1081738397 11:45421261-45421283 TAGAGGATAAGAAGGGAGAATGG - Intergenic
1082099181 11:48157713-48157735 TAGGGGCTGAGGATGGAGGAGGG + Intronic
1082131485 11:48495130-48495152 AAGAGGAGAAGAAGGAAGGAAGG - Intergenic
1082244467 11:49905275-49905297 GAGGGGAAAGGAAGGGAGAATGG + Intergenic
1082745269 11:56954305-56954327 TAGGGGACAGAAAGGGAAGAGGG + Intergenic
1083116773 11:60467722-60467744 TAGGTGAAAAGGAGGGAAGAGGG - Intronic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1084441814 11:69178957-69178979 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1084515364 11:69635062-69635084 TAGGGGAGAAGAAAGAAGGAAGG + Intergenic
1084792505 11:71483469-71483491 CAGGGGAAGAGAAAGGAGGAGGG - Intronic
1085350432 11:75794941-75794963 GAGGGGAGAGGAACGGAGGAGGG - Intronic
1085507660 11:77069377-77069399 TTTGGGAGAAGAAGGGTGGAAGG + Intronic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085570039 11:77551173-77551195 TAAGGGAGAAGAAGGGGGAATGG - Intronic
1085784024 11:79436099-79436121 AAGGGGATAAGGAGGTAGAAAGG + Intronic
1085806692 11:79643157-79643179 TAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1085847536 11:80083291-80083313 AAGGAGAGAAGAAGGGAGGGAGG - Intergenic
1085987881 11:81807475-81807497 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1085992249 11:81863330-81863352 AAGAGGAGAAGAAGGGAAGAAGG + Intergenic
1086136417 11:83447355-83447377 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1086955662 11:92932479-92932501 GAGGGAGAAAGAAGGGAGGAAGG - Intergenic
1087174755 11:95086366-95086388 GAGTGGATTAGAAGGGATGACGG + Intergenic
1087786223 11:102357247-102357269 GAGGGAGTAAGGAGGGAGGAGGG - Intronic
1088327657 11:108617283-108617305 GAGAGGATAAGGAGGGAGGATGG + Intergenic
1088572589 11:111237758-111237780 AAGGGGTTCAGAAAGGAGGAAGG - Intergenic
1088686967 11:112292259-112292281 AAGGGGAAGAGAAGGGAGGGAGG - Intergenic
1089144260 11:116312984-116313006 TTGGGGATAAAAATGGGGGAAGG + Intergenic
1089147608 11:116341346-116341368 TAAGGTAAAAGCAGGGAGGAGGG + Intergenic
1089391483 11:118104881-118104903 AAAGAGAGAAGAAGGGAGGAAGG - Intronic
1089459069 11:118642206-118642228 AAGGGGACAGGAGGGGAGGATGG - Intronic
1089642745 11:119858499-119858521 TAGGGGAGAGGCAGGGAGGGAGG + Intergenic
1089833287 11:121347927-121347949 CAGGGGATGTGAAGGAAGGAGGG + Intergenic
1089965888 11:122655079-122655101 AAGGGAAAAAGAAAGGAGGAAGG - Intergenic
1090020651 11:123125488-123125510 AAGGGAGGAAGAAGGGAGGAAGG - Intronic
1090264719 11:125346780-125346802 GAAGGGACAGGAAGGGAGGAAGG + Intronic
1090630655 11:128644369-128644391 TAGGGGCCAAGAAGGGAACATGG - Intergenic
1091154426 11:133360610-133360632 GAGGAGGGAAGAAGGGAGGAGGG + Intronic
1091568445 12:1663864-1663886 AGGGGGAAAGGAAGGGAGGAAGG + Intergenic
1091658220 12:2361482-2361504 AAGGAGAAATGAAGGGAGGAAGG - Intronic
1091703081 12:2677050-2677072 GAGGGGGTAAGAGGGGAGCAGGG - Intronic
1091758033 12:3068179-3068201 GAGGGGCTGAGAAGGGAGTAGGG - Intergenic
1091842019 12:3628137-3628159 TGGGGGAGAGGGAGGGAGGAAGG - Intronic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1092385806 12:8034616-8034638 TCCTGGATACGAAGGGAGGAGGG + Intronic
1092391381 12:8083059-8083081 GAGAGGTTAAGAAGGGAGGTAGG - Intronic
1092592892 12:9967519-9967541 TAAGGGAGAAGAAGGGGGAATGG + Intronic
1092943955 12:13436051-13436073 TGGAGGAGAAGAAGTGAGGAAGG - Intergenic
1093195456 12:16125068-16125090 GAGGGGAAAGGAAGGAAGGAAGG - Intergenic
1093302082 12:17470841-17470863 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1093322127 12:17724726-17724748 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1093418770 12:18950698-18950720 TAGGGGAGGAGAATGGAGAAAGG + Intergenic
1093569996 12:20655797-20655819 TTGGGGTTGAGAAGGGAGCAAGG + Intronic
1093873115 12:24316247-24316269 AAGGGGAGTAGAAGGGTGGAGGG + Intergenic
1095860705 12:46914832-46914854 GGGGAGATAAGAAGTGAGGATGG + Intergenic
1095999398 12:48116197-48116219 AAGGAGAAAAGAAGGAAGGAGGG - Intronic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096483697 12:51961124-51961146 GAGGGGAAAAGCAGAGAGGATGG - Intronic
1096568185 12:52498620-52498642 GATGGGATAAGAAGGGAGATGGG - Intergenic
1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG + Intergenic
1096694204 12:53338519-53338541 AAGGGGAAAAGGAGGAAGGATGG + Intronic
1096898285 12:54847158-54847180 TAGAGGAAAAGAAAGAAGGAAGG - Intronic
1097308455 12:58093958-58093980 TTGGGGAAGAGAAGGAAGGAAGG + Intergenic
1097326710 12:58285394-58285416 CTGGGAATAAGAATGGAGGAAGG + Intergenic
1097542341 12:60956435-60956457 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1097694042 12:62760006-62760028 TAAGGGAGAAGAAGGAAGAATGG - Intronic
1097989072 12:65815507-65815529 TTGGGGATAGGCGGGGAGGAGGG + Intergenic
1098167338 12:67711797-67711819 TGTGGCAGAAGAAGGGAGGATGG + Intergenic
1098397999 12:70042629-70042651 TAAGGAAGAAGAAGGAAGGAAGG + Intergenic
1098486856 12:71031509-71031531 GAGGGGAGAGGAAGGGAGGAAGG + Intergenic
1098908004 12:76181160-76181182 GAGAGGATAAGAAGGGAGAAAGG - Intergenic
1099389293 12:82059380-82059402 AAGGGAAGAAGAAGGGAAGAAGG + Intergenic
1099617220 12:84951339-84951361 TAGAAGAGAGGAAGGGAGGAAGG - Intergenic
1099907855 12:88793080-88793102 AAGGAGAAAAGAACGGAGGAAGG - Intergenic
1100255530 12:92879546-92879568 GAGGGGAAAAGAAGGGAGAGAGG + Intronic
1100309007 12:93377632-93377654 GAGGGTATAAGCAGGGAGGGAGG + Intergenic
1100638505 12:96458836-96458858 AAAGGGATATGAAGGGAGGCTGG - Intergenic
1100658537 12:96672489-96672511 TAGGAGAAAGGAAGGGAGAAGGG + Intronic
1100811321 12:98341307-98341329 AAAGGGATAAGGAGGAAGGAAGG + Intergenic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101064527 12:101005885-101005907 TAGGGGAAAAGAAAGGAGAAAGG - Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101673306 12:106896634-106896656 GAGGGGAGAGGAGGGGAGGAAGG + Intergenic
1101723561 12:107371415-107371437 TAGGGGAGAAGTATGGAGGTGGG + Intronic
1101952617 12:109188361-109188383 GAGGGCAGAAGAGGGGAGGAAGG - Intronic
1102513312 12:113430021-113430043 AAGGAGAAAAGAAGGAAGGAAGG - Intronic
1102531121 12:113547303-113547325 AAGGGGAAAAGAAGGAAGAAAGG + Intergenic
1102577162 12:113863060-113863082 TGGGGGGAGAGAAGGGAGGAGGG + Intronic
1102652454 12:114451835-114451857 AGGGAGAAAAGAAGGGAGGAAGG - Intergenic
1103330384 12:120150045-120150067 TAGGGGAAAAGAAGGTGGGACGG + Intronic
1103366753 12:120389481-120389503 GAGGGGAGAGGAAGGGAGAAGGG + Intergenic
1103397471 12:120619143-120619165 GAGGGGCTAAGGAAGGAGGAGGG - Intergenic
1104063092 12:125284488-125284510 GGGGGTATAAGAAGGGAGCAGGG - Intronic
1104500025 12:129276131-129276153 TAGGGGTTAGGGAGGGTGGAGGG - Intronic
1105591500 13:21796826-21796848 GAGAGGAGAAGAAGGCAGGATGG - Intergenic
1106320614 13:28634442-28634464 TAGTGGAAAAGGAGGAAGGAAGG + Intergenic
1107240615 13:38230117-38230139 GAGGGTATAGGATGGGAGGAAGG + Intergenic
1108722358 13:53145347-53145369 GAGGAGAGGAGAAGGGAGGAGGG - Intergenic
1108881983 13:55131685-55131707 AAGGGAATAGGAAGGAAGGAAGG - Intergenic
1108903631 13:55444114-55444136 AAGAGGAAAAGAAGGAAGGAAGG - Intergenic
1108962449 13:56251679-56251701 TTGGGGATGGGTAGGGAGGATGG - Intergenic
1109783767 13:67147878-67147900 TAGGGGGTGGGAAGAGAGGAAGG - Intronic
1110329331 13:74252761-74252783 ATGGGGAAGAGAAGGGAGGATGG - Intergenic
1110578781 13:77093712-77093734 TAGGGAATGAGAAGAGAGAATGG - Intronic
1110983372 13:81932571-81932593 AAGGGGATGGGAGGGGAGGAAGG + Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1112076747 13:95922298-95922320 AAGGGGATGGGAAGGGAGAAAGG + Intronic
1112497532 13:99916534-99916556 TGGGGGATGAAGAGGGAGGAAGG - Intergenic
1112662076 13:101521538-101521560 AAGGGAATGAGAAGGGAGGGTGG + Intronic
1112734185 13:102399729-102399751 GAGGAGTTAAGAAGAGAGGAGGG + Intronic
1113375196 13:109758943-109758965 AAGGGAAGGAGAAGGGAGGAAGG + Intronic
1113933443 13:113980832-113980854 GAGGGGTTAAGAAGGAAGGAAGG + Intronic
1114423230 14:22602049-22602071 TGGGGGAGAAGGAAGGAGGAAGG - Intronic
1114492273 14:23110661-23110683 ATGGGGATAAGGAGAGAGGATGG + Intergenic
1114560887 14:23589638-23589660 AATGGGCTAAGGAGGGAGGAGGG - Intergenic
1115027809 14:28764498-28764520 TAAGGGAGAAGGAGGGAGGAGGG + Intergenic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1115506608 14:34099482-34099504 TAGGGGATAGCAAGGGAGAGAGG + Intronic
1115631197 14:35247309-35247331 TAAGAGAAAGGAAGGGAGGAAGG - Intronic
1115834031 14:37377355-37377377 CATGTAATAAGAAGGGAGGAAGG - Intronic
1117617282 14:57546432-57546454 GGGGGGACCAGAAGGGAGGAGGG + Intergenic
1117834341 14:59786624-59786646 TATAGGATAAAGAGGGAGGATGG + Intronic
1118235119 14:63996191-63996213 GAGTGGAAAGGAAGGGAGGAAGG - Intronic
1118451230 14:65904282-65904304 TAGGGGCTCAGATGAGAGGAAGG + Intergenic
1118737668 14:68713694-68713716 TGGGGGATACGAAGGTAGGATGG + Intronic
1119184856 14:72632864-72632886 AAGGGGAGGGGAAGGGAGGAAGG + Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1119855714 14:77899016-77899038 TAGGGGAGAACCAGGCAGGAAGG + Intronic
1120206012 14:81588591-81588613 AAGGCAATAAGAAGGGAGCAGGG + Intergenic
1120251537 14:82065531-82065553 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1120420883 14:84284323-84284345 GAGGGGATGGGAAGGGGGGAGGG + Intergenic
1120539705 14:85737424-85737446 TAAGGGAGAAGAAGGGAGAATGG + Intergenic
1120716200 14:87843510-87843532 GAGGGGAGAAGGAGGGAGGAAGG - Intronic
1120749861 14:88187309-88187331 GAGAGGAAAAGAAAGGAGGAAGG - Intronic
1121409351 14:93738434-93738456 AAGGGGATGATGAGGGAGGAAGG + Intronic
1121447605 14:93988467-93988489 TGGGAGACAAGATGGGAGGAGGG + Intergenic
1121562509 14:94885750-94885772 TAGGTGAAAGGAAGGAAGGAAGG + Intergenic
1121777157 14:96598381-96598403 AAGGGGAGAGGAGGGGAGGAAGG - Intergenic
1121908084 14:97765746-97765768 AAGGGGAGAAGAGTGGAGGAGGG - Intergenic
1122045460 14:99020088-99020110 TAGGGAATCAGAGGGGAGGAAGG + Intergenic
1122153096 14:99735062-99735084 TAGGGGATGCGGAGGGACGAGGG + Intergenic
1122635582 14:103128153-103128175 TAGGGGAGAAGGTGAGAGGAAGG + Intronic
1124069493 15:26378376-26378398 AAAGGGAAAAGAAGGGAGAAAGG - Intergenic
1124443163 15:29704318-29704340 AAGGGGATAGGCAGAGAGGATGG + Intronic
1124587623 15:31024324-31024346 CAAGGGATAAGGTGGGAGGATGG - Intronic
1124954510 15:34351306-34351328 TAGAGGCTAAGGTGGGAGGATGG + Intronic
1125294261 15:38185198-38185220 TAGAGGAAATGGAGGGAGGAGGG + Intergenic
1125300714 15:38252015-38252037 TTTGGGAAATGAAGGGAGGAGGG + Intergenic
1125747045 15:42004367-42004389 AAAGGGAGAAAAAGGGAGGAAGG + Intronic
1125898711 15:43325696-43325718 GGGGGGAAAAGAAGGGAGGAGGG - Exonic
1126367037 15:47904731-47904753 AAGGAGAGAAGAAGGGAGGGAGG + Intergenic
1126790214 15:52214124-52214146 AAGGAGGGAAGAAGGGAGGAGGG + Intronic
1126924378 15:53566687-53566709 TAAGAGATAAGAAGACAGGAAGG + Intronic
1127517808 15:59713373-59713395 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1127633547 15:60848373-60848395 TAAGGGAAAAAGAGGGAGGAAGG + Intronic
1127657688 15:61071418-61071440 GAGGGGATAAGAAGGGAGAGGGG + Intronic
1127657703 15:61071462-61071484 GTGGGGATAAGAAGGGAGAGGGG + Intronic
1128291525 15:66481976-66481998 TAGGGGACAAGAAGTGAGGGAGG + Intronic
1128746072 15:70115068-70115090 CAGGGGATTAGAAGGGGAGAAGG - Intergenic
1128896198 15:71376320-71376342 TAGGGCATAAGGAAGGAGGCTGG - Intronic
1129142359 15:73611581-73611603 CAGGAGATAAGAAGGAAGGAGGG + Intronic
1129332131 15:74833148-74833170 AAGGGGAAAAGGAGGGAGGGAGG - Intergenic
1129683450 15:77671340-77671362 GAGGGGGTGAGAAGGGAGGAAGG + Intronic
1129889067 15:79059130-79059152 GAAGGGAAAAGAAAGGAGGAAGG - Intronic
1130069806 15:80636840-80636862 AAGGGGAGCAGAGGGGAGGAGGG + Intergenic
1130803070 15:87287112-87287134 GAGGGGAAAAGAAAGAAGGAAGG + Intergenic
1130967192 15:88706029-88706051 AGGGGGACAAGAAGGGAGGCAGG - Intergenic
1131075227 15:89491211-89491233 GAGGGGACAGGCAGGGAGGATGG - Intronic
1131447590 15:92512777-92512799 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1131449285 15:92525860-92525882 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1131937432 15:97522181-97522203 GAGGGGAAAAGAAGGGGGGTAGG + Intergenic
1132070422 15:98771881-98771903 CAGTGGAGAAGAAGGAAGGAGGG - Intronic
1132262868 15:100441545-100441567 TAAGGGAGAAGAAGGGGGAATGG - Intronic
1132947679 16:2540928-2540950 GAGGGGAGAAGCAGGGAGCATGG + Intronic
1132968058 16:2670697-2670719 GAGGGGAGAAGCAGGGAGCATGG - Intergenic
1133037739 16:3043809-3043831 TAGGGGATAAAGTGGGATGAGGG - Intergenic
1133445644 16:5858746-5858768 TAGGAGATGGGAAGGGAGGTAGG + Intergenic
1133755753 16:8761300-8761322 GAGGGGGTGAGAAGGGAGGTGGG - Intronic
1133813272 16:9177457-9177479 GAGGGGAGAGGAGGGGAGGAGGG - Intergenic
1134140488 16:11714144-11714166 TAGGGGCTGAGGTGGGAGGATGG - Intronic
1134212441 16:12289075-12289097 GAAGAGATAAGGAGGGAGGATGG + Intronic
1134299889 16:12981391-12981413 TGGGGGATTAGAAGGGTTGAAGG - Intronic
1134317413 16:13131868-13131890 CAGTGGTTAATAAGGGAGGATGG - Intronic
1134692043 16:16197516-16197538 TAGAGGAGAAGAAGGGAGAAGGG + Intronic
1135012729 16:18896717-18896739 GGGGGTATAAGAAGGCAGGAAGG + Intronic
1135025556 16:18996623-18996645 TAAGGGAGAAGAAGGGGGAATGG + Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1135920390 16:26644087-26644109 AAAGGGAGAAGGAGGGAGGAAGG - Intergenic
1135943178 16:26840586-26840608 TGGAAGATAAGAAGGAAGGAAGG + Intergenic
1136597381 16:31260687-31260709 TAGGTGCTCAGAAGGGAGGCTGG + Intronic
1136946090 16:34652795-34652817 AAGAGGAAAGGAAGGGAGGAAGG + Intergenic
1137435303 16:48449593-48449615 GAGGGGCTAAAAAGGTAGGATGG - Intergenic
1137791629 16:51179919-51179941 TAGAAGAGAAGGAGGGAGGAGGG - Intergenic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138644233 16:58411610-58411632 GAAGGGAGAGGAAGGGAGGAAGG + Intergenic
1138644239 16:58411628-58411650 GAAGGGAGAGGAAGGGAGGAAGG + Intergenic
1138880774 16:61012493-61012515 CAAGGGTTCAGAAGGGAGGATGG - Intergenic
1138891606 16:61150131-61150153 TAGGGGACAAGAGGAGTGGAGGG + Intergenic
1139320436 16:66109779-66109801 GAGGGGAGAAGAAGGCAGAAGGG + Intergenic
1139320451 16:66109812-66109834 AAGGGGGAAGGAAGGGAGGAGGG + Intergenic
1139364157 16:66423389-66423411 TAGATGAGAGGAAGGGAGGAAGG + Intergenic
1139933785 16:70552109-70552131 ATGGGGCAAAGAAGGGAGGAGGG - Intronic
1140003274 16:71047994-71048016 CAGAGGATAAGAAGGGTAGAGGG - Intronic
1140087883 16:71812553-71812575 GAGGGGGGAGGAAGGGAGGAAGG - Intergenic
1140276651 16:73514892-73514914 GAGAGGAAAAGATGGGAGGAGGG - Intergenic
1140547086 16:75821125-75821147 TAAGAGAAAAGAAGGGTGGAAGG - Intergenic
1140579581 16:76213723-76213745 GAGGGGAGAGGAAGGGAGGGAGG + Intergenic
1141393188 16:83681548-83681570 AAGGGGAGAAGAACGGAGGAGGG - Intronic
1141639110 16:85330834-85330856 CCTGGGGTAAGAAGGGAGGAGGG - Intergenic
1141658081 16:85426667-85426689 AAGGAAAGAAGAAGGGAGGATGG + Intergenic
1141775793 16:86121865-86121887 TAGGAGGGAGGAAGGGAGGAAGG - Intergenic
1141782075 16:86169234-86169256 AAGGGGATGAGAAGTGAGGAGGG + Intergenic
1142340447 16:89518765-89518787 TAGGGGTTAAGGATGGGGGAAGG + Intronic
1142529081 17:566553-566575 TAGGGGATGGGAATGGAGGGTGG + Intronic
1142829976 17:2541562-2541584 TGGGGTAGAAGAAGGTAGGAAGG + Intergenic
1142887886 17:2924545-2924567 GAGGGGAAAAGAGGGAAGGAGGG + Intronic
1142958252 17:3535475-3535497 AAGGAGGGAAGAAGGGAGGAGGG - Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143336899 17:6178233-6178255 TGGGGGATGGGAAGGCAGGAAGG + Intergenic
1143542941 17:7580341-7580363 TGGGGGATGAGAGGGGAGGGAGG + Intronic
1143936318 17:10488791-10488813 TAGGAGAGAGGAAGGAAGGAAGG - Intergenic
1143961733 17:10726904-10726926 CAGGGAATAAGTAGGGAGGGTGG + Intronic
1143963481 17:10739187-10739209 GAGGAGAGAGGAAGGGAGGAAGG - Intergenic
1144333196 17:14243205-14243227 GAGGGGAGAAGAAAGGAGGAGGG + Intergenic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144754240 17:17669725-17669747 TGGGGGAGGGGAAGGGAGGATGG - Intergenic
1145280362 17:21463448-21463470 TGAGGGAGAAAAAGGGAGGAGGG - Intergenic
1145397526 17:22507031-22507053 TGAGGGAGAAAAAGGGAGGAGGG + Intergenic
1145911625 17:28546660-28546682 TATGGGCAAAGAAGGGAGCAGGG - Intronic
1145961116 17:28887009-28887031 TAGGGGAGAGGGAGGGAGGGAGG + Intronic
1146274305 17:31506532-31506554 GAGGGTAGGAGAAGGGAGGACGG - Intronic
1146567212 17:33923793-33923815 TAGAGTATGAGAGGGGAGGAGGG + Intronic
1146950043 17:36899636-36899658 AAGGGGAGAGGAGGGGAGGAAGG + Intergenic
1146950051 17:36899655-36899677 AAGGGGAGAGGAGGGGAGGAAGG + Intergenic
1147050143 17:37788239-37788261 AAGGGGAGAGGGAGGGAGGAGGG - Intergenic
1147276132 17:39318234-39318256 TAGTGGATAAGAACAAAGGAAGG + Intronic
1147312352 17:39603001-39603023 TAAGGGCTTAGAAGGGAGGAAGG - Intergenic
1147754477 17:42759586-42759608 TGAGTGATAAGATGGGAGGAAGG - Intronic
1147761562 17:42800742-42800764 GAGGGAATAACAAGGGAGGGTGG + Intronic
1148079605 17:44960406-44960428 GAGAGGATGAGAAGGGAGGGAGG + Intronic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148518387 17:48244286-48244308 TAGGGGCAAAGGAGGAAGGAAGG - Intronic
1148751805 17:49949475-49949497 TGGGGGTGGAGAAGGGAGGAAGG + Intergenic
1149098208 17:52870672-52870694 GAGGGGGAAAGAAGAGAGGAAGG + Intronic
1149319369 17:55468738-55468760 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1149444320 17:56701804-56701826 TAGGGGGGAAGAAGAGAGGCAGG + Intergenic
1149560474 17:57604728-57604750 AGAAGGATAAGAAGGGAGGAGGG + Intronic
1149742091 17:59056281-59056303 TGGAGGCTAAGATGGGAGGACGG - Intronic
1149937159 17:60819707-60819729 AAGGGGAGGGGAAGGGAGGAAGG - Intronic
1150062394 17:62079821-62079843 TTGGTGATAAGAAAGGAAGATGG + Intergenic
1150067378 17:62122942-62122964 AAGGAGAAAAGAAGGAAGGAAGG + Intergenic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151290839 17:73148705-73148727 AGGGGGAGAAGAAGAGAGGATGG - Intergenic
1151368149 17:73630465-73630487 TGGGGGTTGAGGAGGGAGGAGGG - Intronic
1151518100 17:74609945-74609967 TAGGGGAAAAAAAGGGAGTAAGG + Exonic
1151553324 17:74834426-74834448 TCGGGGACAGGAGGGGAGGAGGG - Intronic
1151699370 17:75734815-75734837 TATGAGAGAGGAAGGGAGGAAGG + Intronic
1151761588 17:76106680-76106702 AAGGAGGTAAGAAGGAAGGAAGG + Intronic
1152105187 17:78324594-78324616 AAGGGGAAAAAAAGGGAGGGAGG - Intergenic
1152126412 17:78450017-78450039 CAGGGGAAGAGCAGGGAGGAGGG + Intronic
1152187076 17:78864262-78864284 GAGGGAAGAAGAAGGAAGGAAGG - Intronic
1152439112 17:80294591-80294613 TGGGGCAGAGGAAGGGAGGAAGG - Intronic
1152638428 17:81439612-81439634 TGGGGGATGAGAAGGGAGGTGGG + Intronic
1154031218 18:10755964-10755986 TAGGGGATGAGGAGGAAAGATGG + Intronic
1154031253 18:10756102-10756124 TAGGGGATGAGGAGGAAAGATGG + Intronic
1154031275 18:10756196-10756218 AAGGGGATAAGGAGGAGGGATGG + Intronic
1154095775 18:11413744-11413766 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1155517939 18:26641571-26641593 TTGGGGATAAGAGGGGTGGGAGG - Intronic
1155656068 18:28194646-28194668 TAGGGGAAAAGAAGGGAACAGGG - Intergenic
1155684879 18:28536387-28536409 TAGGGAGAAGGAAGGGAGGATGG + Intergenic
1155822705 18:30398207-30398229 TAGGAGCAAAGAAGGGAGGTGGG + Intergenic
1156987541 18:43366003-43366025 GAGGGGAAAAGAAGGGAAGCAGG + Intergenic
1157150024 18:45207362-45207384 GAGGGGAAAAGAAGGAAGGAAGG + Intergenic
1157168125 18:45377267-45377289 TAGGGGAAAAGAAAAGAAGAAGG - Intronic
1157392926 18:47317873-47317895 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1157523428 18:48361036-48361058 TAGAGGCTAGGGAGGGAGGAAGG + Intronic
1157575812 18:48742291-48742313 TAGGGGAAAAGAAAGGAGCAGGG + Intronic
1158058715 18:53312965-53312987 GTGGGGAGAGGAAGGGAGGAGGG + Intronic
1158311704 18:56166442-56166464 AAGGGGGAAAGAAGGCAGGAAGG + Intergenic
1158398376 18:57097711-57097733 TAGGTAACAAGAAGGGAGGAGGG + Intergenic
1158438614 18:57453148-57453170 TAGGGGACAGGCAGGGAAGAAGG - Intronic
1158851089 18:61496184-61496206 GGGGGGAGAGGAAGGGAGGAGGG - Intronic
1159005777 18:63009148-63009170 TTGGGGCAAGGAAGGGAGGAAGG - Intergenic
1159164326 18:64682906-64682928 TAAGGGAGAAGAAGGAAGAATGG - Intergenic
1159217017 18:65405629-65405651 GAGGGGAGAAGGAGGTAGGAGGG + Intergenic
1159788170 18:72740874-72740896 TAGGGGCTAGTAAGGCAGGAAGG - Intergenic
1160070042 18:75620646-75620668 TTAGGAATAAGAAGGTAGGAAGG + Intergenic
1160985266 19:1835762-1835784 TTGGGGTGAAGCAGGGAGGAAGG - Intronic
1161022258 19:2015830-2015852 GAGGGGAAAGGAGGGGAGGAGGG + Intronic
1161095408 19:2387545-2387567 GAAGGGAAAGGAAGGGAGGAAGG + Intergenic
1161374668 19:3933351-3933373 AAGGGGAGGAGAGGGGAGGAGGG + Intronic
1161403853 19:4081071-4081093 AAAGGGAAAAGAGGGGAGGAGGG + Intergenic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1161608456 19:5227991-5228013 AAGGGGATAAGGAGGGGTGACGG + Intronic
1161803509 19:6429385-6429407 GAGGGGAGGAGAAGGGAGAAAGG + Intronic
1161803516 19:6429410-6429432 GAGGGGAGGAGAAGGGAGAAAGG + Intronic
1161878055 19:6927199-6927221 GAGGGAGGAAGAAGGGAGGAGGG - Intronic
1162014875 19:7840004-7840026 TAGAACATGAGAAGGGAGGAGGG + Intronic
1162459018 19:10803333-10803355 TAGGTGAGGAGAAGGGAGGAAGG + Intronic
1162549690 19:11351583-11351605 CAGGGGATCAGAAAGGGGGATGG + Intronic
1162977344 19:14214570-14214592 AGGAAGATAAGAAGGGAGGAAGG + Intergenic
1163210609 19:15836997-15837019 ACGGGGATTAGAGGGGAGGAGGG + Intergenic
1163507797 19:17718576-17718598 GAGGGGAGAAGAGGAGAGGAGGG + Intergenic
1163583432 19:18151713-18151735 GAGGGGCTGAGAAAGGAGGAAGG + Intergenic
1163619066 19:18347345-18347367 GAGGGGCTAAGACAGGAGGATGG - Intronic
1164080655 19:21859025-21859047 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1164202640 19:23031257-23031279 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1164258617 19:23550506-23550528 TAAGGGAGAAGAAGGGGGAATGG - Intronic
1164592088 19:29512732-29512754 GAGGGGATGAGGAGGAAGGAGGG + Intergenic
1164592189 19:29513121-29513143 GGGGGGATAAGGAGGAAGGAGGG + Intergenic
1164703489 19:30302911-30302933 CAGGGGGTAAAAAGGGATGAAGG - Intronic
1164794377 19:31014488-31014510 AGGGAGAAAAGAAGGGAGGAAGG + Intergenic
1164916735 19:32058132-32058154 TAGGAGGAAAGAAGGAAGGAGGG - Intergenic
1165028683 19:32981441-32981463 GAGGGGAAAGGAAGGGAAGAGGG + Intronic
1165066485 19:33232143-33232165 TTGGGGATAGGAACTGAGGAGGG + Intergenic
1165527936 19:36371962-36371984 AGGGAGATAAGAAGGAAGGAGGG + Intronic
1165862218 19:38915307-38915329 TAGGAGGAAAGAAGGAAGGAGGG + Intronic
1165910286 19:39221805-39221827 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
1165998517 19:39863104-39863126 TAGGTGATTAGAAGAGTGGATGG - Intergenic
1166109601 19:40614064-40614086 TCGGGGAGTCGAAGGGAGGAGGG - Intronic
1166145153 19:40829182-40829204 TTGAGGGTAAGATGGGAGGAGGG - Intronic
1166226535 19:41399173-41399195 TAGGGGAACAAACGGGAGGAGGG + Intronic
1166524381 19:43501940-43501962 TACCGGATTCGAAGGGAGGATGG + Intronic
1166911279 19:46160072-46160094 AAGGTGATAAGGAAGGAGGAAGG - Intronic
1166993980 19:46710618-46710640 TAGGGGAGCAGAAGGGTGGCGGG - Intronic
1167195123 19:48023191-48023213 GAGGGGAAAGGAAGGAAGGAGGG + Intronic
1167273084 19:48517397-48517419 TAAGGGACAAGAAGGGGGTAAGG - Intergenic
1167626497 19:50593019-50593041 AAAGGAATAAGAAAGGAGGAAGG - Intergenic
1167718522 19:51160855-51160877 GAGGGGAGCAGAGGGGAGGATGG + Intergenic
1167796162 19:51710488-51710510 ACGGGGATTAGCAGGGAGGAAGG + Intergenic
1168049688 19:53819892-53819914 GAAGGGAAAAGAAGGAAGGAAGG + Intronic
1168507487 19:56948753-56948775 AAGGGGACAGGAAGGGAGAAAGG + Intergenic
1168509370 19:56961895-56961917 GAGGAGAGAAGAAGAGAGGAGGG - Intergenic
925229457 2:2220042-2220064 GAGTGGAGAAGAGGGGAGGATGG + Intronic
925372940 2:3360932-3360954 AAGGGGAGGAGAAGGGAGGAGGG + Intronic
925433995 2:3820346-3820368 TAAGGGAGAAGAAGGGGGAATGG + Intronic
925548683 2:5044959-5044981 TGGAGGAAAAGAAGAGAGGAAGG + Intergenic
925659208 2:6184425-6184447 AAGGAGAGAAGAAGGAAGGAAGG + Intergenic
925791015 2:7488538-7488560 AAGGAGATAGGAAGGGAGGAAGG + Intergenic
925791036 2:7488608-7488630 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791080 2:7488759-7488781 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791094 2:7488805-7488827 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791114 2:7488875-7488897 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791155 2:7489015-7489037 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791186 2:7489123-7489145 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925791200 2:7489169-7489191 AAGGAGAAAGGAAGGGAGGAAGG + Intergenic
925902060 2:8515849-8515871 TAGGGAAGAGGAAGGGAGGAAGG - Intergenic
925941137 2:8820197-8820219 TAGGGGATCAGTAAGGAGGTGGG - Intronic
926094991 2:10075399-10075421 CAGGGGACAAGAAGAAAGGATGG - Intronic
926244680 2:11113848-11113870 AAGGGGAAAGGAAGGAAGGAAGG - Intergenic
926725482 2:15994233-15994255 AAGGGGAAGGGAAGGGAGGAAGG - Intergenic
926920721 2:17937360-17937382 GAGGGGATAAGAAGGAGGCAGGG - Intronic
927067011 2:19481941-19481963 TAGGGGATGGGTAGGGAGAAAGG - Intergenic
927149772 2:20188936-20188958 TAGGGGATCGGAAGTGAGGGTGG - Intergenic
927212142 2:20645510-20645532 CAGGGGAAAAGAAGGCAGGTGGG + Intronic
927538774 2:23887942-23887964 GAGGGGAAAAGAAGGGAGATGGG - Exonic
928361212 2:30663649-30663671 TTGGCCATAAGCAGGGAGGATGG + Intergenic
928377573 2:30788010-30788032 TAGAGCATCAGAAGGGAAGATGG + Intronic
928770030 2:34695113-34695135 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
928921656 2:36534085-36534107 GAGGGGAAAGGAAGGAAGGAGGG + Intronic
929423454 2:41818965-41818987 GAGGGGGGAGGAAGGGAGGAAGG + Intergenic
930246592 2:48989969-48989991 AAGGAGATAAGCAGGGAGGGAGG - Intronic
930785162 2:55264691-55264713 TAGGGGGTGAGATGGGAAGATGG - Intronic
931622797 2:64228268-64228290 TAGGGAGTTAGAAGGAAGGAAGG - Intergenic
931769735 2:65487188-65487210 GAGAGGCTAAGATGGGAGGATGG - Intergenic
931784530 2:65607498-65607520 AAGGGGATGAGGAGGGTGGAGGG + Intergenic
931910766 2:66897255-66897277 GAGGGGGCAAGAAGGAAGGAGGG + Intergenic
932334470 2:70922277-70922299 AAGTGGAGAGGAAGGGAGGAGGG + Intronic
932547075 2:72724185-72724207 TAGGTAAAAAGAAGGAAGGAAGG + Intronic
933137793 2:78759139-78759161 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
933734750 2:85486876-85486898 GAGGGGAAGGGAAGGGAGGAGGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934502790 2:94872789-94872811 GAAGGGTAAAGAAGGGAGGAGGG - Intronic
934564144 2:95329241-95329263 TATGGGATAAGAAGGTTGTAGGG - Intronic
934606364 2:95698553-95698575 CAGGGGATAAGTAGGAAAGATGG + Intergenic
934788792 2:97038089-97038111 GAGAGGAAAAGAAGGAAGGAAGG + Intergenic
935007603 2:99095242-99095264 TAGGGGAAAGGATGGGAGGTGGG + Intronic
935028629 2:99301454-99301476 AAGGGAAGAGGAAGGGAGGAAGG + Intronic
935029358 2:99307051-99307073 AAGGGAAGAGGAAGGGAGGAAGG - Intronic
935098800 2:99972430-99972452 TAGGGAATCATAAGGGAAGAAGG + Intronic
935516675 2:104048941-104048963 GCGGGGAAGAGAAGGGAGGAAGG - Intergenic
935788016 2:106566690-106566712 AAGGGGAGAGGAAGGGAGGAAGG - Intergenic
935863058 2:107354871-107354893 AAGAGGGGAAGAAGGGAGGAGGG + Intergenic
936539765 2:113340681-113340703 CAGGGGATAAGTAGGAAAGATGG + Intergenic
936870646 2:117131560-117131582 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
937201953 2:120209594-120209616 AAGGGGATAAGAAGTGGGCAGGG + Intergenic
937280171 2:120712393-120712415 GATGAGATAAGAAGGGAAGATGG + Intergenic
937376852 2:121342829-121342851 GAGGGGCTGAGATGGGAGGATGG + Intronic
937693685 2:124784166-124784188 TGGGAGGGAAGAAGGGAGGATGG + Intronic
937752293 2:125490905-125490927 TGGGGGAAAAGATGGGAGCAGGG - Intergenic
937952598 2:127400389-127400411 CAGGGGCCAAGAGGGGAGGATGG + Intergenic
938941924 2:136177216-136177238 AAGGAGAGAGGAAGGGAGGAAGG - Intergenic
939346625 2:140974588-140974610 TAGGAGATTAGAAGGGAGAAAGG + Intronic
939367447 2:141251402-141251424 TTGTGGATAATAAAGGAGGAGGG + Intronic
939623229 2:144446325-144446347 AGGGAGAAAAGAAGGGAGGAAGG - Intronic
939694059 2:145301868-145301890 TTGGGGATACTAAGGCAGGAGGG + Intergenic
940179685 2:150918448-150918470 GAAGGGAAGAGAAGGGAGGAAGG + Intergenic
940393537 2:153161492-153161514 AAGGGGATCAGGAGGGATGAGGG + Intergenic
940681116 2:156786505-156786527 GATGGAATAAGAAGGGAGAAGGG + Intergenic
941169419 2:162118705-162118727 GAGGGCATCAGAAGGGAGGAGGG + Intergenic
941339350 2:164287131-164287153 AAGGGAAGAAGAAGGAAGGAAGG + Intergenic
941464971 2:165814663-165814685 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
941749631 2:169120904-169120926 CAGGGGAAAAGAAGGGAGAGAGG + Intergenic
941961777 2:171261110-171261132 AAGGGGAAAAGTAGGCAGGAGGG - Intergenic
942096942 2:172543001-172543023 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
942184840 2:173415230-173415252 AAGGAGGGAAGAAGGGAGGAAGG - Intergenic
942211789 2:173678353-173678375 GAAGGGGAAAGAAGGGAGGAAGG + Intergenic
942301012 2:174562460-174562482 AAGGGAAGAAGCAGGGAGGAGGG + Exonic
942334730 2:174871028-174871050 TGGGTGATAAGATGGAAGGATGG + Intronic
943093931 2:183405602-183405624 TAAAGGATAAAAAGGGAAGATGG - Intergenic
943388676 2:187233999-187234021 TAAGTCATGAGAAGGGAGGAGGG - Intergenic
943858434 2:192828504-192828526 TGGGGGTTCAGAGGGGAGGAAGG - Intergenic
944136544 2:196405950-196405972 TAGGGGATAATCAAGTAGGAGGG - Intronic
944318265 2:198306828-198306850 TAGGGGATAAGAAAGAAGACAGG - Intronic
944931866 2:204528167-204528189 TGAAGAATAAGAAGGGAGGAGGG + Intergenic
945555838 2:211274826-211274848 TCTGGTATAAGAGGGGAGGAGGG - Intergenic
945851181 2:215009294-215009316 GAGGGGAACAGAAGGGTGGAGGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946053042 2:216880040-216880062 AAGGGGAAAGGAAGGGAAGAGGG + Intergenic
946129403 2:217594122-217594144 TAGGGGATAAGAAGGGAGGAAGG + Intronic
946419897 2:219558798-219558820 AAGGGGATAGGAAGTGGGGATGG - Intronic
946519116 2:220446683-220446705 GAGGGGAGAAGGGGGGAGGAAGG - Intergenic
946688258 2:222292665-222292687 GAGGTGCTGAGAAGGGAGGAAGG - Intronic
947159117 2:227194013-227194035 AAGGAGAGAAGAAGGAAGGAAGG + Intronic
947305362 2:228740542-228740564 TTGGGGAAAGGAAGGAAGGAAGG - Intergenic
947502842 2:230683808-230683830 GAGTGGGTAAGAAAGGAGGAGGG + Intergenic
947840075 2:233202160-233202182 CAGGGGCTGAGATGGGAGGAGGG - Intronic
947978367 2:234386978-234387000 TAGTGGAAAAAAAGGAAGGAAGG + Intergenic
948302881 2:236921349-236921371 TAGGGGAAATCAAGGGAGGTAGG + Intergenic
948812983 2:240494475-240494497 TAGGGGCTAGGAAGTGAGCAAGG - Intronic
1168749323 20:271032-271054 AAGGGGGGAAGAAGGGAGGGAGG + Exonic
1168978807 20:1987924-1987946 TAGGGGATAGGAAAAGAAGAGGG + Intronic
1169036396 20:2455927-2455949 AAGGGGAAAGGAAGGAAGGATGG + Intergenic
1169064845 20:2689364-2689386 AAGGGGTGATGAAGGGAGGAAGG - Intergenic
1169071978 20:2738381-2738403 TAGAGAAAAAGGAGGGAGGAGGG - Intronic
1169226138 20:3858185-3858207 TGGGGGAGAAGAAATGAGGAAGG - Intronic
1170281243 20:14651383-14651405 TAGGGGACCAGAAGAAAGGAGGG + Intronic
1170334273 20:15250703-15250725 CAAAGGATAAGAAGGGAGGCAGG - Intronic
1170501836 20:16982510-16982532 AAGAAGAAAAGAAGGGAGGAAGG - Intergenic
1170501865 20:16982606-16982628 GAGGGAGGAAGAAGGGAGGAAGG - Intergenic
1170633915 20:18088464-18088486 AAGGAGAGAAGGAGGGAGGAAGG - Intergenic
1170717470 20:18844414-18844436 TAGGGGATGACCAAGGAGGAGGG + Intergenic
1171338278 20:24407743-24407765 GAGGGGAAAAGGAGGGAGCATGG + Intergenic
1171358911 20:24572828-24572850 CAGGGGTTAAGGATGGAGGAAGG + Intronic
1171907198 20:30908814-30908836 TAGGGGAGAAGGAGAGAGAAAGG + Intergenic
1172174482 20:32963833-32963855 GAGGAGAAAAGAAGGAAGGAAGG - Intergenic
1172233787 20:33355660-33355682 TAGGGGATTAGTAGGCGGGAAGG + Intergenic
1172283673 20:33726002-33726024 AAGGGGTCAAGCAGGGAGGAGGG - Intergenic
1172298315 20:33829878-33829900 TAGTAGATAGGAAGGGAAGAAGG + Intronic
1172307667 20:33892843-33892865 TAGGGGACAAGAATGGAGCTGGG - Intergenic
1172477064 20:35247076-35247098 TAAAAGATAGGAAGGGAGGATGG - Intronic
1172488221 20:35312890-35312912 TAGGGGATATGAGGGAAGGAGGG + Intronic
1172883014 20:38213745-38213767 TGGGGGACAAGAAGAGAGGGAGG + Intronic
1173101715 20:40094313-40094335 TAAGGGAGAAGAAGGAAGAATGG - Intergenic
1173150812 20:40565313-40565335 TAGGGGAGAGGGAGGGAGAATGG + Intergenic
1173431399 20:42990160-42990182 TATGGGAAAAGAAGGCATGATGG + Intronic
1173438886 20:43057421-43057443 GAGGGGAAGAGAGGGGAGGAAGG + Intronic
1173484848 20:43433446-43433468 AAGGGAATAAGGAGGAAGGAAGG + Intergenic
1174063663 20:47849583-47849605 AAGGGGAAAAGAAGGGAGGGGGG - Intergenic
1174079879 20:47963056-47963078 GTGGGGAAAAGAAGGGAGGGAGG - Intergenic
1174221523 20:48959456-48959478 AAGGAGAGAAGAAGGGAGGGAGG - Intronic
1174283287 20:49454623-49454645 AGGGAGATAAGAAGGCAGGAGGG + Intronic
1174684982 20:52446038-52446060 TGAGGGAAAAGAAGGCAGGAGGG + Intergenic
1174835611 20:53853608-53853630 GAGGGGAGGGGAAGGGAGGAGGG + Intergenic
1174865724 20:54133883-54133905 AAGGGGCTAAGAAGGGATGATGG + Intergenic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1175238077 20:57526578-57526600 GAAAGGATAAGGAGGGAGGAGGG + Intergenic
1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG + Intergenic
1175293657 20:57894595-57894617 GAGGGAACAAGAAAGGAGGAAGG + Intergenic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175565007 20:59967737-59967759 AAGGGGAAGGGAAGGGAGGAAGG - Intronic
1175779060 20:61670810-61670832 TACGGGATAGAAAGGAAGGAAGG + Intronic
1175790319 20:61736592-61736614 AAGGGGAGAGGGAGGGAGGAAGG + Intronic
1176920606 21:14683607-14683629 GAGGAGAGAAGAAGGAAGGAAGG + Intergenic
1176949722 21:15030726-15030748 TAGGTGGTAAGGAGGGAAGAAGG + Intronic
1176998751 21:15585967-15585989 AAGAAGATAAGAAGGAAGGAAGG + Intergenic
1177708593 21:24740916-24740938 GAGGGGAGAGAAAGGGAGGAGGG - Intergenic
1178480669 21:32977143-32977165 GAGGGAAAAAGAAGGGAGGAGGG - Intergenic
1178553855 21:33568644-33568666 TATGAGATAGGAAGGGAGGGTGG + Intronic
1178857221 21:36260225-36260247 AAGGGGAAGGGAAGGGAGGAAGG + Intronic
1179084908 21:38207762-38207784 GAGGGAAGAAGAGGGGAGGAGGG - Intronic
1179084942 21:38207850-38207872 GAGGGAAGAAGAGGGGAGGAGGG - Intronic
1179188590 21:39104467-39104489 GAGGGCAGAAGAAGGGAAGATGG + Intergenic
1179296812 21:40070223-40070245 AAGGGGAAAGGAAGGAAGGAAGG + Intronic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1181167806 22:20992770-20992792 TGGGGGACAAGAAGGCAGGGTGG - Intronic
1181389803 22:22571959-22571981 AAGGGGAAGGGAAGGGAGGAAGG + Intergenic
1181427825 22:22855740-22855762 GAGGGGATGAGAAGGGACCAGGG + Intronic
1182103573 22:27673647-27673669 TAAAGGAAGAGAAGGGAGGAAGG + Intergenic
1182349231 22:29689613-29689635 GAGGAGAAAAGAAGGTAGGAGGG - Intronic
1182526418 22:30923149-30923171 GAGGGGACAAGAAAAGAGGAGGG + Intergenic
1182673865 22:32021735-32021757 TAGGGGCTAAGTGGGGAGGATGG + Intergenic
1182970721 22:34573607-34573629 TAGGGGAAAAGGTGGGAGGGGGG - Intergenic
1183293190 22:37015304-37015326 TGAGGGTGAAGAAGGGAGGAGGG - Intronic
1183469321 22:37997228-37997250 AAGTGGAAAAGAAGGGAGAAAGG - Intronic
1183555562 22:38524065-38524087 GAGGGGATAAGAATGGAAAAGGG - Intronic
949625474 3:5861875-5861897 AAGGAGGTAAGAAAGGAGGAAGG - Intergenic
949924299 3:9028780-9028802 TAAGGGTCAAGAGGGGAGGAAGG - Intronic
951330606 3:21363928-21363950 AAGGGAATAAGAAGAGAGGAAGG + Intergenic
951670891 3:25180754-25180776 TAGGGGAGAAGGAAAGAGGAAGG + Intronic
952314789 3:32223333-32223355 TTGGGGATCTGAAGGGAGTATGG + Intergenic
952459567 3:33510207-33510229 TGGGGGGGATGAAGGGAGGAAGG + Intronic
952534241 3:34293673-34293695 TGAAGGAAAAGAAGGGAGGAAGG - Intergenic
953147198 3:40289756-40289778 TGGGAAATAAGAAAGGAGGAGGG + Intergenic
953886499 3:46717342-46717364 TAGGGGAGCAGAAGGGACGGGGG - Intronic
954794834 3:53156311-53156333 TATGGGATGAGAGGGGAAGAGGG - Intronic
955123977 3:56091119-56091141 TAGGGGACAGGAATGGAGGCCGG + Intronic
955512484 3:59695370-59695392 TAGGGGAAATGGAGGGTGGAGGG - Intergenic
955625739 3:60917360-60917382 AAGGGGACAAGAAGAGAGGCAGG - Intronic
955683998 3:61531614-61531636 GAGGGGAAGAGAGGGGAGGAGGG + Intergenic
956080210 3:65549334-65549356 AGGGGGTTAGGAAGGGAGGAAGG - Intronic
956147836 3:66210112-66210134 AAAGGGAGAAGGAGGGAGGAAGG - Intronic
956480083 3:69664631-69664653 GTGGGAATAAGATGGGAGGACGG + Intergenic
957060040 3:75474478-75474500 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
957394265 3:79619332-79619354 TAAGGGAGAAGAAGGGGGAATGG - Intronic
957689217 3:83545832-83545854 TTTGGGATAAGAAGAGAGAAGGG - Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957938706 3:86977257-86977279 GAGAGGGTAAGAAGGGAGGGAGG + Intronic
958103294 3:89041708-89041730 TAGGGGTAGAGAAGGGAGTACGG + Intergenic
958181963 3:90072102-90072124 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
958477695 3:94605633-94605655 CAGAGGTTAAGAAGGGAGGAAGG - Intergenic
958519040 3:95160111-95160133 TAGAGGCTAATATGGGAGGATGG - Intergenic
958832784 3:99109933-99109955 GAGGGGATAAAAATGGAGCAGGG + Intergenic
959356325 3:105334044-105334066 AAGGGGAAAGGAAGGGAGGGAGG + Intergenic
959462071 3:106639520-106639542 TAGAGGCTAAGAAGGGTAGAGGG - Intergenic
959496257 3:107056115-107056137 TAGGGAAAAGGAAGGGAAGAAGG + Intergenic
959543850 3:107571112-107571134 TAAGGGAGAAGAAGGGGGAATGG + Intronic
960088627 3:113616501-113616523 GAGGGGATAGCATGGGAGGAGGG + Intronic
960129793 3:114043709-114043731 TAGGGGATAAGCACGGAGGTAGG + Intronic
960248347 3:115424727-115424749 AAGGGGAGAAGAAGGGAAGGAGG - Intergenic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
960671890 3:120162406-120162428 TAGGAGAAAAAAAGGGAAGATGG - Intergenic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961293357 3:125864970-125864992 TAGGGGAGAAGAAGGGGGAATGG - Intergenic
961345308 3:126260187-126260209 AGGGGGAAGAGAAGGGAGGAAGG - Intergenic
961346476 3:126266720-126266742 CGGGGGCTAAGAAGGGAGGGAGG + Intergenic
961830030 3:129618640-129618662 TTGAGGAGAGGAAGGGAGGAGGG - Intergenic
962139106 3:132769609-132769631 GAAAGGATAAGAAGGGAGGTGGG - Intergenic
962188963 3:133290144-133290166 TAGGGGATAGGAAATGTGGAGGG + Intronic
962597426 3:136960805-136960827 CAAGGTAGAAGAAGGGAGGAGGG + Intronic
962918780 3:139933327-139933349 TAGAGAAAATGAAGGGAGGAGGG + Intergenic
963115608 3:141726484-141726506 GAGGGGGAAAGAAGGAAGGAAGG + Intergenic
963212316 3:142706783-142706805 TGGGGAAGAAGAAGGGAGGGAGG + Intronic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963690047 3:148488037-148488059 AAGAGGATAAGATGGGGGGAAGG + Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
964146489 3:153470385-153470407 AAGGGGAGAGGAAGGAAGGAAGG - Intergenic
964258874 3:154811317-154811339 GAGGGGAGAAGAAGGAAGAATGG - Intergenic
964429455 3:156589472-156589494 TAGAAGTTAAGAAGGGAGGAAGG + Intergenic
965070186 3:163908830-163908852 TAAGGGAGAAGAAGGAGGGATGG - Intergenic
965119155 3:164529001-164529023 TAGGAGGGAAGAAGGGAGGGTGG - Intergenic
965171115 3:165265673-165265695 GAGGGGGGAAGAAGGAAGGAAGG - Intergenic
965267694 3:166566785-166566807 TAGGGCATTATAAGGGAGAAGGG + Intergenic
965565440 3:170111484-170111506 TGGGGGTTAGGAATGGAGGAAGG + Intronic
965679171 3:171232744-171232766 TGAGGGAGAAGAAGGGAAGAGGG - Intronic
965721659 3:171668624-171668646 TATGGGAAAAGAAGGAAAGAAGG - Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966398592 3:179525379-179525401 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
967256465 3:187597723-187597745 TGGAGGAAAAGAAGGAAGGAAGG - Intergenic
967478621 3:189949313-189949335 AAGGGGAAGAGAAGGGAAGAGGG - Intergenic
967703171 3:192618454-192618476 TAGGTGAAAAGAAGGAAGGAAGG + Intronic
967726927 3:192870722-192870744 AAGGAGAGAAGAAGGAAGGAAGG + Intronic
968413459 4:408312-408334 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
968447751 4:660857-660879 TGGGTGAAAAGCAGGGAGGAAGG + Intronic
969003954 4:4004662-4004684 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969459405 4:7320872-7320894 GAGGGGAGGGGAAGGGAGGAAGG - Intronic
969607837 4:8211302-8211324 AGGGGGAGAAGGAGGGAGGAGGG - Intronic
969748916 4:9095521-9095543 TAAGGGAGAAGAAAGGAGAATGG - Intergenic
969809976 4:9640162-9640184 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970502344 4:16690542-16690564 TTGGGGAAAGGAAGGAAGGAAGG + Intronic
970698907 4:18711486-18711508 AAGGGGCAAAGAAGGGAGAAAGG - Intergenic
970911113 4:21276664-21276686 TAGAAAAAAAGAAGGGAGGATGG - Intronic
971278211 4:25217790-25217812 GAGGGGCTGAGATGGGAGGATGG - Intronic
971355165 4:25888665-25888687 TAGGAGAGGAGAAGGGAGGGGGG - Intronic
972019404 4:34291138-34291160 AAGGGGGAAAGAAGGAAGGAAGG + Intergenic
972103200 4:35447707-35447729 TAGAGGGTAAGAAGGAAGGAAGG + Intergenic
972103244 4:35447884-35447906 AAGGAGGGAAGAAGGGAGGAAGG + Intergenic
972335284 4:38102462-38102484 GAAGTGAGAAGAAGGGAGGAAGG + Intronic
972543507 4:40058923-40058945 TAGGGGACGAGGTGGGAGGATGG - Intronic
973567608 4:52204026-52204048 AAGGAGGAAAGAAGGGAGGAAGG - Intergenic
973750979 4:54021069-54021091 TAAGGGAGAAGAAGGGGGAATGG - Intronic
973785276 4:54326814-54326836 TAGGGAAGGAGAAGGGAGAAAGG - Intergenic
973829236 4:54741936-54741958 TAGGAGAGAAGTAGGAAGGAAGG - Intergenic
974142278 4:57902452-57902474 GAGGGGAAAAAAAGGCAGGATGG + Intergenic
974531513 4:63114287-63114309 TAGGGAATAAGAAAGGGAGAAGG + Intergenic
975126578 4:70789026-70789048 TGGAGGATCAGATGGGAGGAGGG - Intronic
975148425 4:70994385-70994407 CAGGGAATAGGAAGGGTGGAGGG - Intronic
976466356 4:85373457-85373479 TAGGGCATAAGAAGGAAGTAGGG - Intergenic
976858913 4:89639527-89639549 AAGGAGGAAAGAAGGGAGGAAGG + Intergenic
977044966 4:92058086-92058108 CAGTGGCTAAGAAGGGAGTAGGG + Intergenic
977225482 4:94387894-94387916 TAAGGGAGAAGAAGGGAGAATGG + Intergenic
977265603 4:94849763-94849785 TGGGGCATAATAAGGTAGGAGGG + Intronic
977763589 4:100771140-100771162 TAGGGGAGGAGAGGGGAGGGAGG + Intronic
977805129 4:101288520-101288542 GAGGGGAGGAGAAGGGAGAAGGG + Intronic
978031329 4:103942404-103942426 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
979544976 4:121930081-121930103 CATGGGATAAGAGGGGAGAAAGG + Intronic
979853234 4:125599605-125599627 GAGGGGAGAAAAAGGGAGGACGG - Intergenic
980121189 4:128730224-128730246 AAGGGGAAGAGAAGGAAGGAGGG - Intergenic
980284808 4:130768620-130768642 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
980559763 4:134458216-134458238 GAGAGGGTAAGAAGGAAGGAAGG + Intergenic
980841049 4:138261783-138261805 GAGAGGATAAGAAGGAAGGGAGG + Intergenic
980864389 4:138537360-138537382 TAGAGGATGAGAAGGGTGGCAGG + Intergenic
980904529 4:138934395-138934417 GAGGGGATGAGAAGGGAAGATGG + Intergenic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
981044637 4:140253466-140253488 GTGGGGATAAGGAGGAAGGAGGG + Intergenic
981056293 4:140365595-140365617 TGGAGGAGAAAAAGGGAGGAAGG - Intronic
981124324 4:141088721-141088743 TAGAGGAAGAGAGGGGAGGAAGG + Intronic
981557213 4:146008359-146008381 AAAGGGAAGAGAAGGGAGGAAGG - Intergenic
981640265 4:146934399-146934421 TTGGGGATAAGAGAGGAGTAGGG + Intronic
982101246 4:151970351-151970373 TAGGGGATTGGAGGGGAGAAGGG - Intergenic
982611979 4:157586312-157586334 AAAGGGAGAAGAAAGGAGGAGGG - Intergenic
983339364 4:166438605-166438627 GAGGAAAGAAGAAGGGAGGAAGG - Intergenic
983552552 4:169032394-169032416 AAGGAGAAAGGAAGGGAGGAAGG - Intergenic
983908383 4:173208513-173208535 GAGGGGGTAAGAAGGGATAAAGG - Intronic
984313047 4:178088553-178088575 TAAGGGCAAAGAAGGGACGAAGG - Intergenic
984411574 4:179404463-179404485 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
984418702 4:179492503-179492525 AAGGGGAAAGGAAGGAAGGAAGG - Intergenic
984568410 4:181359576-181359598 TAGGTGGATAGAAGGGAGGAGGG + Intergenic
984613980 4:181874719-181874741 TAGGGCACCAGAAAGGAGGATGG - Intergenic
985083473 4:186290163-186290185 TATGAGATAAGAAAGGAAGAAGG + Intergenic
985102340 4:186470865-186470887 AAGGGGAAAAGGAGGCAGGAGGG + Intronic
985168817 4:187126736-187126758 AGGGGGGAAAGAAGGGAGGAAGG - Intergenic
985652201 5:1112359-1112381 AAGGGGACAAGAGGGGAGGCGGG - Intergenic
985829569 5:2218278-2218300 AAGGAGGTAGGAAGGGAGGAAGG + Intergenic
986311378 5:6553410-6553432 AAGGAGATAAGAAGGGAGGCAGG + Intergenic
987360759 5:17104407-17104429 GAGGGGGAAAGAAGGAAGGAAGG - Intronic
988251931 5:28770510-28770532 GAGGGGAGAAGAGGAGAGGAAGG - Intergenic
988428496 5:31091952-31091974 AATGTGATAAGAAAGGAGGAAGG - Intergenic
989088235 5:37699146-37699168 TAGGGGAGAAGAGGGGAAAAAGG + Intronic
989537634 5:42582379-42582401 TATGAGATCAGAAGGGAGGAAGG - Intronic
990688715 5:58337849-58337871 TAGGTGGGAAGATGGGAGGAAGG + Intergenic
991252811 5:64582547-64582569 TTTGGGAGAGGAAGGGAGGATGG - Intronic
991471430 5:66973057-66973079 TAGGGGCTAAGAGAGAAGGAAGG - Intronic
991483001 5:67103509-67103531 GAGGGGAGGAGGAGGGAGGAAGG + Intronic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
991958510 5:72019213-72019235 TAGAGGCCAAGAATGGAGGACGG + Intergenic
993203595 5:84849030-84849052 TAGGGGATTACTAGGGATGATGG - Intergenic
994324671 5:98435484-98435506 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
994329187 5:98486352-98486374 AGGGAGATAAGAAAGGAGGATGG - Intergenic
994372734 5:98985775-98985797 AAGGGAAAAAGAAAGGAGGAAGG + Intergenic
994513694 5:100742256-100742278 TGGGGGAAAAGGAGGGAGGGGGG + Intergenic
994648176 5:102495768-102495790 AAAGGGAGAAGAAGAGAGGAAGG + Intronic
994709505 5:103249445-103249467 CAGGGTTTAAGAAGGGAGTAGGG - Intergenic
994940736 5:106320749-106320771 AAGGGGGAAAGAAGGAAGGAAGG + Intergenic
996459081 5:123720415-123720437 GAGGAGTTAAGAAGGGAGGAGGG - Intergenic
997258318 5:132446011-132446033 CAGGGGATTTCAAGGGAGGATGG + Intronic
997376534 5:133401497-133401519 TAAAGGAAAAGAAGGAAGGAAGG - Intronic
997516158 5:134491381-134491403 TGGGGGAGAAAAAGGAAGGAAGG - Intergenic
997679916 5:135742981-135743003 GAGGGGAGAGGAAGGGAGGGGGG - Intergenic
997810351 5:136961959-136961981 TGGGTGATGAGAAGGGAGGCAGG + Intergenic
998227196 5:140336156-140336178 TAGAGGAGAAGGATGGAGGATGG - Intronic
998514427 5:142739862-142739884 TAGGGCATAGGAAGGGAGGTAGG - Intergenic
998855174 5:146387732-146387754 TTGAGGAGAAGAAGGAAGGAGGG - Intergenic
999162820 5:149518914-149518936 TAGGGGGTAAGAAAACAGGAAGG + Intronic
999381464 5:151124260-151124282 TGGGGGATGGGAAGGGAGCAGGG - Intronic
999431237 5:151527181-151527203 GAAGGGAAATGAAGGGAGGAAGG + Intronic
999807514 5:155096801-155096823 TAGAAGATAAGAAAAGAGGAAGG - Intergenic
1000105878 5:158058329-158058351 TAAGGGAGAAGAAGGAAGGGGGG - Intergenic
1000115404 5:158149004-158149026 TATGGGAAAGGAAGGAAGGAAGG - Intergenic
1000175231 5:158745717-158745739 TAGAGGATAAAGAGGGAGGGTGG + Intronic
1000204442 5:159045354-159045376 TAGGGGAGAAAAAAGGAGGGAGG - Intronic
1000438445 5:161241228-161241250 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001546371 5:172572954-172572976 TAGGGGGTCAGAATGGAGGCTGG + Intergenic
1001734043 5:173984227-173984249 TTGAGACTAAGAAGGGAGGATGG + Intronic
1001911260 5:175520424-175520446 TAGGGGTGAATAAGGCAGGATGG + Intronic
1002270226 5:178066962-178066984 TGGGAGAGAAGCAGGGAGGAAGG + Intergenic
1002819033 6:706638-706660 TGGGCTAGAAGAAGGGAGGAAGG - Intergenic
1003087828 6:3075330-3075352 TGGAAGAAAAGAAGGGAGGAAGG + Intronic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003679108 6:8234429-8234451 GTGGGGTTAAGAAGGGAGGCAGG + Intergenic
1004068498 6:12275009-12275031 TGGGGGAAAAGAAGGAAGGAAGG - Intergenic
1004478714 6:15998934-15998956 AAGGAGATAAGAAGGGACGGGGG + Intergenic
1004543955 6:16578921-16578943 TGGGCAATAAGATGGGAGGATGG - Intronic
1004583770 6:16979623-16979645 TAGGAGTTAACTAGGGAGGAGGG - Intergenic
1004622948 6:17347264-17347286 TGGGAGATGAGAAGTGAGGATGG - Intergenic
1004768725 6:18758505-18758527 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1004836860 6:19540162-19540184 TAAGGGATAAGAAGGAGGAATGG - Intergenic
1005419237 6:25631783-25631805 GATGGGGAAAGAAGGGAGGAAGG + Intergenic
1005435639 6:25808340-25808362 GAGGGGAGAAAATGGGAGGACGG + Intronic
1005530232 6:26697164-26697186 TAGGGGAGGAGATGGGAGGTAGG + Intergenic
1005535248 6:26749017-26749039 GAGTGGAAAAGAAGGAAGGATGG + Intergenic
1005540564 6:26804482-26804504 TAGGGGAGGAGATGGGAGGTAGG - Intergenic
1005681872 6:28216458-28216480 TTGGGGGTGAGAAGGGAGCAGGG - Intergenic
1006098565 6:31671372-31671394 TGGGGTACAAGAAGAGAGGAGGG + Intronic
1006811615 6:36823896-36823918 GAGGGGAGAGGAGGGGAGGATGG + Intronic
1007398087 6:41588568-41588590 TAGAGGATAGGATGGGAGGATGG + Intronic
1007945336 6:45821435-45821457 TTGGGAATAAGAAGGAAGGATGG + Intergenic
1008385109 6:50880333-50880355 AAGGGGACAGGAAGGGAGGAGGG - Intergenic
1008435177 6:51467500-51467522 TAGGGGAGAAGATGGGAAGGGGG - Intergenic
1008665836 6:53715483-53715505 TTGGGGATAAGAAGGGAATGAGG - Intergenic
1008838690 6:55870036-55870058 ACTGGGATGAGAAGGGAGGAGGG + Intronic
1009006287 6:57792651-57792673 GAGTGGAAAAGAAGGGAGGATGG + Intergenic
1009008269 6:57813308-57813330 GAGTGGAAAAGATGGGAGGATGG + Intergenic
1009011378 6:57846579-57846601 TAGGGGAGGAGATGGGAGGTAGG - Intergenic
1009359218 6:62792764-62792786 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1009882364 6:69584328-69584350 GACGGGAGAAAAAGGGAGGAAGG + Intergenic
1010117595 6:72333003-72333025 GAGGGGACAAGGAAGGAGGAGGG + Intronic
1010578895 6:77569322-77569344 GAAGGGAGGAGAAGGGAGGAGGG - Intergenic
1010704367 6:79090021-79090043 GAGGGGGGAAGAAGGGAGGAAGG - Intergenic
1010800429 6:80168524-80168546 TATGGGAAAGGAAGGAAGGAAGG + Intronic
1010977521 6:82332536-82332558 TAGAGAAGAAGAAGGGAGAAGGG - Intergenic
1011368049 6:86602791-86602813 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1011525815 6:88263767-88263789 CAGGGCAGAAGGAGGGAGGAGGG + Intergenic
1011546097 6:88483067-88483089 AGGGGGATGAGAAGAGAGGAGGG + Intergenic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1011695750 6:89911269-89911291 AAGAGGAAAAGAAGGGAGGAAGG - Intergenic
1012286308 6:97393045-97393067 TAGAGGCTTAGAAGGGAGGAGGG + Intergenic
1013218440 6:108053074-108053096 TAGGGAATAAGAAAGAAGTATGG - Intronic
1013628849 6:111965154-111965176 AAGGAGAGATGAAGGGAGGAAGG + Intergenic
1013854666 6:114557377-114557399 TAGGATAAATGAAGGGAGGAAGG - Intergenic
1014021734 6:116598814-116598836 TGGGGGCTAAGGTGGGAGGATGG - Intergenic
1014211067 6:118708771-118708793 TAGGGAAAAGGGAGGGAGGAAGG - Intronic
1014673846 6:124340520-124340542 TGGGGGAGAGGATGGGAGGAGGG - Intronic
1014762708 6:125375203-125375225 CAGAGGAAAAGAAGGAAGGAGGG - Intergenic
1015118518 6:129675891-129675913 TTGCGGACAAGAATGGAGGAGGG - Intronic
1015163425 6:130177739-130177761 TAGAGGAAAGGAAGGAAGGAAGG - Intronic
1015371109 6:132454268-132454290 CAAGGGTTAAGAAGGGAGTAGGG + Exonic
1015471538 6:133612003-133612025 TAGGAGATGAGAAGGGAGAGAGG - Intergenic
1015597654 6:134881117-134881139 GAGGAGAAAAGAGGGGAGGAAGG - Intergenic
1015633396 6:135253172-135253194 CAGGAGATAAGAGGGGAAGAAGG - Intergenic
1015764367 6:136700123-136700145 AAGGAAAGAAGAAGGGAGGAAGG + Intronic
1016124424 6:140382850-140382872 GAGGTGATATGAAGTGAGGAGGG - Intergenic
1016142864 6:140634456-140634478 TGGAAGATAAGAAGGAAGGAAGG - Intergenic
1016331143 6:142952901-142952923 AAGGGGAAAAGAAGAGAGGGAGG + Intergenic
1017030212 6:150214440-150214462 TAGGGGAAAAGAAGAGAAGGAGG - Intronic
1017269664 6:152491453-152491475 TAAGGGAGAAGAAGGGGGAATGG - Intronic
1017625864 6:156348143-156348165 TAGGAGAAATGAGGGGAGGAGGG - Intergenic
1017651058 6:156582977-156582999 TAGGGGATAAAAATGGAGGTGGG + Intergenic
1017652078 6:156593141-156593163 GAGGGGAGAAGAGGGGAGGAGGG + Intergenic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018234523 6:161710966-161710988 AAGGGGAAAAGAGGGTAGGAGGG - Intronic
1018284977 6:162227713-162227735 TAGGGCATAAGAATGGTAGAAGG - Intronic
1018303264 6:162426553-162426575 TTGGGGATGAGGTGGGAGGATGG - Intronic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019484890 7:1284916-1284938 CAGGGGACAAGCAGGGAGAAGGG + Intergenic
1019578576 7:1749233-1749255 TGGGGGACAAGGAGGGAGGGAGG + Intergenic
1020887719 7:13840066-13840088 GAGGAGAAAAGAAAGGAGGAAGG + Intergenic
1020893991 7:13916825-13916847 AAGAGGCTAAGATGGGAGGATGG + Intronic
1021122108 7:16807527-16807549 TAGAGGAAAAGAAGGGAGAAAGG - Intronic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021516635 7:21496080-21496102 TAGGGCATAAGCAAGGAGGAGGG + Intronic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1021637169 7:22704530-22704552 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022447262 7:30480510-30480532 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1023724906 7:43132799-43132821 AAGAAGAAAAGAAGGGAGGAAGG - Intronic
1023805848 7:43872443-43872465 AAGGGCAGAAGAAGGGAGGAGGG + Intronic
1023989098 7:45117541-45117563 TGGTGGATGAGAAGGAAGGATGG - Intergenic
1024263637 7:47590098-47590120 GGGGGGAGAAGAAGGGAAGATGG - Intergenic
1024517516 7:50271993-50272015 TAGGAGAGAAAAAGAGAGGAAGG - Intergenic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1025556771 7:62319156-62319178 AAGGGGAAAGGAAGGGAGGGAGG - Intergenic
1026463161 7:70632264-70632286 TAGAGGAACAGAAGGTAGGAAGG + Intronic
1026542790 7:71295403-71295425 AAGGGGAAGAGAAGGGAGAAAGG - Intronic
1026871030 7:73852018-73852040 AAGGGGGAAGGAAGGGAGGAAGG - Intergenic
1027144905 7:75687818-75687840 TAGGGGCTGGGAAGAGAGGAAGG - Intronic
1027182458 7:75950405-75950427 TGGGGAGTTAGAAGGGAGGAGGG + Intronic
1027347600 7:77277084-77277106 TAAAGAATAAGAAGGAAGGAAGG + Intronic
1027650191 7:80856987-80857009 GAGGGAGGAAGAAGGGAGGAAGG - Intronic
1027987736 7:85315909-85315931 GAGGGGATAAATGGGGAGGAAGG - Intergenic
1028173498 7:87627994-87628016 TAAGTACTAAGAAGGGAGGAGGG - Intronic
1028590055 7:92484258-92484280 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1029249162 7:99223720-99223742 AAGGGGAAAAAAAGGAAGGAAGG + Intergenic
1029633854 7:101770785-101770807 AAGGAGAGAAGAAGGAAGGAAGG - Intergenic
1029707214 7:102282351-102282373 TGGGGGAGAAGAGGGGTGGAAGG + Intronic
1029891359 7:103933515-103933537 GAGGGGAAGAGAAGGGAGGGAGG + Intronic
1030481849 7:110114363-110114385 TAGGGGCAAAGAAAGAAGGAGGG + Intergenic
1030945918 7:115720124-115720146 GAGAGGAAAAGAAGAGAGGAAGG + Intergenic
1031168454 7:118260651-118260673 GAGGGGAGGAAAAGGGAGGAAGG - Intergenic
1031355341 7:120781577-120781599 TAAGGGAGAAGAAGGGAGAATGG + Intergenic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031777195 7:125918866-125918888 TAAGGGAGAAGAAGGAAGAATGG - Intergenic
1032134800 7:129266300-129266322 TAGTGGATGAGAAGGAGGGAGGG + Intronic
1032507530 7:132446929-132446951 GTGGGGAGAGGAAGGGAGGATGG - Intronic
1032685765 7:134231907-134231929 GAAGGGATGGGAAGGGAGGAAGG - Intronic
1033225621 7:139559938-139559960 TAGGGGAAAAGGTGGGTGGAGGG + Intergenic
1033380930 7:140818133-140818155 TTGGGGACAAGATGGGACGATGG + Intronic
1033434762 7:141322834-141322856 TAGGGGAGAAGAAGGAGAGAGGG - Intronic
1033478700 7:141716492-141716514 TAGGAGAAAGGAGGGGAGGAGGG - Intronic
1033625432 7:143106080-143106102 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1033683897 7:143621584-143621606 TGGCGGATAGGAAGGGAAGAGGG + Intronic
1033700715 7:143836054-143836076 TGGCGGATAGGAAGGGAAGAGGG - Intergenic
1034084979 7:148314500-148314522 TAAGGGAGAAGAAGGGGGAATGG + Intronic
1034119878 7:148617495-148617517 AAAGGAAAAAGAAGGGAGGAGGG + Intergenic
1034331760 7:150288911-150288933 GAGGTGCTGAGAAGGGAGGAAGG + Intronic
1034391528 7:150791404-150791426 GTGGGGAGAAGAAAGGAGGAGGG + Exonic
1034607359 7:152329626-152329648 GAAGGGAAACGAAGGGAGGAAGG + Intronic
1034666278 7:152820959-152820981 GAGGTGCTGAGAAGGGAGGAAGG - Intronic
1034749603 7:153556332-153556354 TAGAGAATTTGAAGGGAGGAAGG - Intergenic
1034854759 7:154532872-154532894 TAGGGGAGAAGTGTGGAGGAAGG - Intronic
1035182211 7:157097656-157097678 GAGGGAATAAGAAAGGAGGAGGG + Intergenic
1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036192211 8:6680675-6680697 TGGGGGGAAAGAAGGAAGGAAGG - Intergenic
1036192260 8:6680821-6680843 TGGGGGGAAAGAAGGAAGGAAGG - Intergenic
1036207787 8:6818013-6818035 AAAGGGAGAAAAAGGGAGGAAGG - Intronic
1036472487 8:9063898-9063920 TAAGGGAGAAGAAGGGGGAATGG + Intronic
1036505040 8:9347462-9347484 AAGGGGAAGGGAAGGGAGGAGGG + Intergenic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036798021 8:11769845-11769867 GAGGGGACAGGAAGGGAGGGCGG + Exonic
1036975387 8:13405287-13405309 GAGGGGAGAAGGAGGGAGGGAGG - Intronic
1037753242 8:21696107-21696129 GAGGGGACAGGAAAGGAGGAGGG - Intronic
1038119321 8:24594267-24594289 TAGGGTATCAGCAGGGAGGATGG + Intergenic
1038773744 8:30509244-30509266 GAGGAGGGAAGAAGGGAGGAAGG - Intronic
1038784332 8:30597273-30597295 TAGGAGCAAAGAAGGGAAGAAGG + Intronic
1039044420 8:33436904-33436926 GAGGGGAGAAGGAGGGAGGGGGG - Intronic
1039090972 8:33829320-33829342 AAGGGGATAAGGTGGGAGGAGGG - Intergenic
1039320755 8:36427861-36427883 AAGGGGAAAAAAAGGGGGGAAGG + Intergenic
1039321608 8:36438092-36438114 TAGGAGAGAGGAAGGAAGGAAGG + Intergenic
1039487905 8:37926364-37926386 GAGGGGGGAAGAAGGAAGGAAGG - Intergenic
1039593238 8:38768121-38768143 TAGGGGAAGGGAAGGGAGGGAGG + Intronic
1040445969 8:47493995-47494017 AAGGAGAAAAGAAGGAAGGAGGG - Intronic
1040537178 8:48320625-48320647 AAGGGGAAAATAAAGGAGGAAGG + Intergenic
1041144962 8:54865346-54865368 AAGGAGGGAAGAAGGGAGGAAGG - Intergenic
1041557896 8:59179515-59179537 TAAGGGTTAGGAAGAGAGGAAGG - Intergenic
1041669167 8:60475650-60475672 GAGGGGATGAGAAGGTAAGAAGG - Intergenic
1042495739 8:69452979-69453001 TAGGGGAAAAGAAGGAATAAAGG + Intergenic
1042564573 8:70099074-70099096 GAGGGGAGAAGGAGGGAGGGGGG + Intergenic
1042572347 8:70179415-70179437 AGGAGGAAAAGAAGGGAGGAAGG + Intronic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043597602 8:81902987-81903009 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1043720702 8:83544658-83544680 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1043778747 8:84305665-84305687 TAGGGGATGAGACCGGAAGAGGG - Intronic
1043949247 8:86289826-86289848 TGGAGGATCAGAAGGGTGGATGG + Intronic
1044220245 8:89662245-89662267 TCAAGGATAAGAAGGGAAGAAGG - Intergenic
1044342164 8:91058522-91058544 AAGGGGAGAAGAAGGGAGCAAGG - Intergenic
1045022589 8:98057057-98057079 TAGGGGACAAGAGGGAATGAAGG + Intergenic
1045033750 8:98161691-98161713 GAGGAGAGAAGAAGAGAGGAGGG - Intergenic
1045068325 8:98473576-98473598 TAGGGGATCAGAAGCCAGTATGG - Intronic
1045073693 8:98539277-98539299 TTGGGGGAAAAAAGGGAGGAAGG + Intronic
1045251914 8:100489703-100489725 CAGGGGTTAAGAGGGAAGGAAGG + Intergenic
1045253074 8:100497421-100497443 GAGGGGTTTTGAAGGGAGGAGGG + Intergenic
1045644644 8:104287228-104287250 TAGGGGAGAAGAAGGAGGAATGG - Intergenic
1045817391 8:106292742-106292764 TAGAGGATAAGAAGACAGGGAGG + Intronic
1045906912 8:107356651-107356673 TAGGGGATAAGAAAGGACTCTGG + Intronic
1046046974 8:108976133-108976155 GAGGGGAGGGGAAGGGAGGAGGG - Intergenic
1046778528 8:118190195-118190217 CAGAGTATGAGAAGGGAGGATGG - Intronic
1047495215 8:125404253-125404275 TTGTTGATAAGAAGGAAGGAAGG - Intergenic
1047506992 8:125487913-125487935 TAGGTGAGAAAAAGGGAGGAAGG + Intergenic
1047521816 8:125600758-125600780 TTGGGGAGCAGAAGGGAGGAGGG + Intergenic
1047927621 8:129696933-129696955 TACGGGAAAGGAAGGAAGGAAGG + Intergenic
1048019389 8:130524603-130524625 TAGAGGCTGAGAAAGGAGGATGG - Intergenic
1048143626 8:131820440-131820462 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1048152501 8:131907842-131907864 GTGGGTAGAAGAAGGGAGGAAGG - Intronic
1048168583 8:132084678-132084700 TAAGGGATAAGAAGGAGGAATGG + Intronic
1048248437 8:132835299-132835321 TAGGGGATAGGATGTGAGGTAGG + Intronic
1048366412 8:133742589-133742611 AAGGAGAAAAGAAGGGAGGAAGG + Intergenic
1048550178 8:135426772-135426794 TTAGGAATAAGAAGGAAGGAGGG + Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048665296 8:136654649-136654671 GAGGGGAGAGGTAGGGAGGAAGG - Intergenic
1048837863 8:138538310-138538332 GAGTGGAGAAGAAGGAAGGAAGG + Intergenic
1048940358 8:139395387-139395409 TAGGGGATGAGAAGAGAGGGAGG - Intergenic
1049737686 8:144218646-144218668 GAGGGGAGAGGAGGGGAGGATGG - Intronic
1049737768 8:144218828-144218850 CAGGGGAGGGGAAGGGAGGAGGG - Intronic
1050031245 9:1388627-1388649 TACGGGATAAGGAGGAAGCAGGG - Intergenic
1050143572 9:2541929-2541951 CAGGGAATGAGAAGGAAGGAAGG - Intergenic
1050366956 9:4881683-4881705 AAGGAGGGAAGAAGGGAGGAGGG - Intronic
1050377707 9:4990121-4990143 GATTGGATAAGAAGGGAGAATGG + Intronic
1050438769 9:5637587-5637609 GGGGGGATAGGAAGGGAGGTGGG - Intronic
1050751099 9:8938279-8938301 GAGGAGATGAGAAGAGAGGAGGG + Intronic
1051164754 9:14249686-14249708 GAGGGGAGAAGAAGAGAGGAAGG + Intronic
1051167437 9:14279233-14279255 TAGGGGATATGATGGGAAGACGG - Intronic
1051261107 9:15265632-15265654 TACTGTATAAAAAGGGAGGAGGG + Intronic
1051538502 9:18187723-18187745 TATGTAATAAGAAGGAAGGATGG + Intergenic
1051866383 9:21687885-21687907 AAGAGGCTGAGAAGGGAGGATGG - Intergenic
1052433979 9:28402598-28402620 AAGAGGAAAAGAAGAGAGGAAGG - Intronic
1052796322 9:32926895-32926917 AAGGGCCTAAGAAGGTAGGAGGG + Intergenic
1053060115 9:35024088-35024110 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1053097543 9:35341620-35341642 TAGGGGAAAAGAAAGCAGGGAGG + Intronic
1053408352 9:37897895-37897917 TAGATGATAAATAGGGAGGAGGG - Intronic
1054453999 9:65420313-65420335 CAGGAGAGAAGAAGGGAGGGAGG + Intergenic
1055347870 9:75356232-75356254 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1055497092 9:76866740-76866762 AAGTGGGTAAGAAAGGAGGAAGG + Intronic
1055723135 9:79197979-79198001 AAGGGGAAAAGAAAGGAGGTAGG - Intergenic
1056046568 9:82724146-82724168 TATGAAATCAGAAGGGAGGAGGG + Intergenic
1056073999 9:83019913-83019935 AAGGGGCAAAGAAAGGAGGAAGG + Intronic
1056363564 9:85881944-85881966 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1056495989 9:87155714-87155736 TAGGGGGAAGGAATGGAGGAGGG + Intronic
1056546479 9:87617918-87617940 TAGGGGAGAAGAATGAAGCAAGG - Intronic
1056604639 9:88076642-88076664 CAGGGGAAATGAAGGGAGGGTGG - Intergenic
1056628764 9:88275571-88275593 TCCGGGTTGAGAAGGGAGGAGGG + Intergenic
1057399371 9:94709527-94709549 TAGGGGATCAGGAGGGAGCGTGG - Intergenic
1057435165 9:95033317-95033339 TAGGGGGTAAGAGAGGAGCATGG - Intronic
1057759368 9:97860239-97860261 TAGGGGCTAAGGAGTGGGGATGG + Intergenic
1058129968 9:101240664-101240686 TGTGGGCTAAGAAGGGAGGTTGG - Intronic
1058341665 9:103904788-103904810 GAGGGGAGAAGGAGGGAGGGAGG + Intergenic
1058388033 9:104461504-104461526 TAAGAGAGAAGAAGGAAGGACGG + Intergenic
1058504051 9:105651470-105651492 AAGGGGCTAAGGATGGAGGAGGG + Intergenic
1058740612 9:107938859-107938881 TAGGAGATGAGAAGGAGGGAAGG + Intergenic
1059453902 9:114387836-114387858 TAAGGGATTGGAACGGAGGAGGG - Intronic
1059620135 9:115995144-115995166 GAGGGAGGAAGAAGGGAGGAAGG + Intergenic
1059635933 9:116170709-116170731 TAGCAGAAAAGAAGGGTGGATGG - Intronic
1060318615 9:122535039-122535061 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1060718343 9:125955469-125955491 TAGAGGTTAAGAAGGGAAAAGGG + Intronic
1061237556 9:129351551-129351573 AAGGGGAGAAGAGGGTAGGAGGG + Intergenic
1061612804 9:131759546-131759568 CAAGGAAAAAGAAGGGAGGAAGG + Intergenic
1062104946 9:134750306-134750328 GGAGGGATAAGAAGGGAGGGAGG - Intronic
1062143959 9:134978790-134978812 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062143966 9:134978817-134978839 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062144003 9:134978929-134978951 AAGGAGAGAAGGAGGGAGGAAGG + Intergenic
1062273543 9:135720508-135720530 GAGGGGATAGGAAGAGATGATGG - Intronic
1062449146 9:136608277-136608299 GAGGGGAGAGGAAGGGAGGGAGG + Intergenic
1062733578 9:138122136-138122158 TAGAGTAAAAGAGGGGAGGAGGG - Exonic
1185689457 X:2141439-2141461 GAGGGAAGAAGATGGGAGGAGGG + Intergenic
1185700466 X:2227557-2227579 AAGGAGGGAAGAAGGGAGGAAGG + Intronic
1185766832 X:2732479-2732501 GAGGGGGAAAGAAAGGAGGAGGG - Intronic
1185834155 X:3329381-3329403 AAGGAGAGAAGAAGGAAGGAAGG + Intronic
1185843707 X:3417249-3417271 TAGAGGAAATGAAGGAAGGAAGG - Intergenic
1185965024 X:4590542-4590564 GAGGGTGGAAGAAGGGAGGAAGG + Intergenic
1185999178 X:4989169-4989191 TAGAGGATAGGAAGGGAAGGAGG - Intergenic
1185999215 X:4989314-4989336 TAGAAGATAGGAAGGGAAGAAGG - Intergenic
1186295474 X:8143878-8143900 AATGGGATAAGAAGAGAGGGAGG + Intergenic
1186367062 X:8906672-8906694 TAGAGGACAAGACTGGAGGAGGG - Intergenic
1186428381 X:9483569-9483591 CAGGCGAGAAGATGGGAGGAGGG - Intronic
1187264420 X:17718381-17718403 GAGGGAAGAAGAAGGAAGGAAGG + Intronic
1187283764 X:17883173-17883195 AAGGGTAGAAGAAGGGAGTAAGG + Intergenic
1187891170 X:23936150-23936172 TAGGGGAGGAGTAGGGTGGAGGG + Intronic
1188016494 X:25112744-25112766 TAGTGGCTAAGATGGGAGGATGG - Intergenic
1188419335 X:29976543-29976565 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1188430877 X:30104611-30104633 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1188439702 X:30203532-30203554 TTGGAGGAAAGAAGGGAGGAAGG + Intergenic
1188443959 X:30237659-30237681 TACATGATAAGAAGGGAGGGAGG + Intergenic
1189307869 X:40000706-40000728 TAGAGGATGAGAAGGCAGAAGGG + Intergenic
1189313999 X:40040866-40040888 GAGGGGAGAGGAAGGAAGGAAGG - Intergenic
1189388150 X:40554376-40554398 TGGGGGAGCAGAAGGGAGGGAGG + Intergenic
1189689168 X:43597822-43597844 TAGGGTACAAGCAGGGTGGAAGG + Intergenic
1189804837 X:44725050-44725072 TAGGGAATTAGAAGGGAGGATGG + Intergenic
1190420730 X:50281848-50281870 TGAAGGATATGAAGGGAGGATGG + Intronic
1190477382 X:50841487-50841509 TAGGGGTTATTAAGGGATGATGG - Intergenic
1190952312 X:55158383-55158405 TAGAGGTTTAGAAGAGAGGAAGG + Intronic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1191805958 X:65134106-65134128 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1191826570 X:65372465-65372487 CAGGAGAGAGGAAGGGAGGAAGG + Intronic
1191915336 X:66195040-66195062 AAAGGGATAAACAGGGAGGAAGG - Intronic
1191968026 X:66782378-66782400 AAGGGAATAAGAAGGAAGGAAGG + Intergenic
1192047344 X:67689928-67689950 CAGGGGAGAAGATGGCAGGAAGG - Intronic
1192156197 X:68748364-68748386 AAGGTGCTAAGAAGGGAGGCGGG + Intergenic
1192180116 X:68911055-68911077 GAGGGGAGAAGAGGGGAAGAAGG - Intergenic
1193140627 X:78022934-78022956 AAGGTGAGAAGAAGGGAGGGGGG - Intronic
1193456698 X:81740133-81740155 TGGGGGAAAGGAAGGAAGGAGGG - Intergenic
1193682198 X:84535753-84535775 TAGAGGGTAAGAAGGTAGGAGGG + Intergenic
1193868309 X:86764370-86764392 GATGGGAAAGGAAGGGAGGAAGG - Intronic
1194086888 X:89538937-89538959 TAGGGGACAAGCAGGGAAAAAGG + Intergenic
1194087562 X:89547692-89547714 TAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1194690283 X:96976024-96976046 GAGTGGAAAAGAAGGAAGGAAGG - Intronic
1195017100 X:100790889-100790911 TAAGGGATAAGAAGAGGGAATGG + Intergenic
1195818623 X:108917251-108917273 GAGGGGAGAGGAGGGGAGGAAGG + Intergenic
1196075263 X:111569051-111569073 TATGGGAGGAGAAGGGAGAAAGG - Intergenic
1196275216 X:113758818-113758840 TAGGGGATGGGAAAGGAGGCTGG - Intergenic
1196525630 X:116725417-116725439 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1196943664 X:120802514-120802536 AAGGAGAAAAGAAGAGAGGAAGG + Intergenic
1197215196 X:123860351-123860373 GAGGGGAAAAGAAGAGGGGAGGG - Intronic
1197470815 X:126864363-126864385 TAAGGGAGAAGAAGGGGGAATGG - Intergenic
1197816006 X:130499427-130499449 GAGAGGGTAGGAAGGGAGGAAGG - Intergenic
1198321584 X:135522370-135522392 CAGGAGAAAAGTAGGGAGGACGG + Intronic
1198552094 X:137755895-137755917 TAGGAGATAAGAAAGTAAGAGGG + Intergenic
1198598313 X:138260056-138260078 TAAGGGAGAAGAAGGAAGAATGG - Intergenic
1199303547 X:146240744-146240766 AAGGGGATAGGGAGGGAGGAGGG - Intergenic
1199558736 X:149139299-149139321 AAGTGGAAAAGAAGGAAGGAAGG - Intergenic
1199804040 X:151280123-151280145 TATGGGATAATAAGGTAGGTAGG - Intergenic
1199867561 X:151866581-151866603 AAGGGAAGAAGAAGGAAGGAAGG - Intergenic
1199874617 X:151920540-151920562 TAGGGGATAGGAATGGGGGTGGG - Intronic
1199895915 X:152127753-152127775 TTGGGGAAGAGAATGGAGGAGGG - Intergenic
1200439547 Y:3194806-3194828 TAGGGGACAAGCAGGGAAAAAGG + Intergenic
1200440207 Y:3203562-3203584 TAGGAGAAAAGAAAGAAGGAAGG + Intergenic
1201061797 Y:10052751-10052773 TAAGGGAGAAGAAGGGGGAATGG + Intergenic
1201256532 Y:12113049-12113071 AAGGGGAAACGAAGGGAGGGAGG - Intergenic
1201490207 Y:14532808-14532830 TAGAGAAAAAGAAGGAAGGAGGG - Intronic
1201517896 Y:14837449-14837471 TAGGGGATAAGGAGGAAGACAGG + Intronic