ID: 946130708

View in Genome Browser
Species Human (GRCh38)
Location 2:217604509-217604531
Sequence CATTGGGAGGAGAGGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 799
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 740}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946130694_946130708 21 Left 946130694 2:217604465-217604487 CCTCTAGCAGCTTCCACACCTCA 0: 1
1: 0
2: 4
3: 19
4: 260
Right 946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG 0: 1
1: 0
2: 4
3: 54
4: 740
946130696_946130708 3 Left 946130696 2:217604483-217604505 CCTCATCTGCCTCCTCTTTATGG 0: 1
1: 0
2: 0
3: 36
4: 388
Right 946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG 0: 1
1: 0
2: 4
3: 54
4: 740
946130701_946130708 -9 Left 946130701 2:217604495-217604517 CCTCTTTATGGATGCATTGGGAG 0: 1
1: 0
2: 0
3: 6
4: 102
Right 946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG 0: 1
1: 0
2: 4
3: 54
4: 740
946130693_946130708 22 Left 946130693 2:217604464-217604486 CCCTCTAGCAGCTTCCACACCTC 0: 1
1: 0
2: 1
3: 23
4: 240
Right 946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG 0: 1
1: 0
2: 4
3: 54
4: 740
946130695_946130708 8 Left 946130695 2:217604478-217604500 CCACACCTCATCTGCCTCCTCTT 0: 1
1: 0
2: 11
3: 104
4: 1079
Right 946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG 0: 1
1: 0
2: 4
3: 54
4: 740
946130691_946130708 29 Left 946130691 2:217604457-217604479 CCTCTACCCCTCTAGCAGCTTCC 0: 1
1: 0
2: 0
3: 16
4: 253
Right 946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG 0: 1
1: 0
2: 4
3: 54
4: 740
946130692_946130708 23 Left 946130692 2:217604463-217604485 CCCCTCTAGCAGCTTCCACACCT 0: 1
1: 0
2: 1
3: 17
4: 199
Right 946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG 0: 1
1: 0
2: 4
3: 54
4: 740
946130698_946130708 -6 Left 946130698 2:217604492-217604514 CCTCCTCTTTATGGATGCATTGG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG 0: 1
1: 0
2: 4
3: 54
4: 740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946130708 Original CRISPR CATTGGGAGGAGAGGGGGGC AGG Intronic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900618733 1:3577313-3577335 GCTTTGGAGGAGAGGGGAGCAGG - Intronic
900623132 1:3596499-3596521 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623151 1:3596543-3596565 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623170 1:3596587-3596609 CCTGGGGTGGAGACGGGGGCTGG - Intronic
900623188 1:3596631-3596653 CCTGGGGTGGAGACGGGGGCTGG - Intronic
901000815 1:6147990-6148012 CCTGGGGATGGGAGGGGGGCAGG - Intronic
901138940 1:7015467-7015489 CATTCAGAGGAGAGGCAGGCTGG - Intronic
901236201 1:7668985-7669007 CATTGGGGGGAGTGGGTGCCTGG - Intronic
901542858 1:9932089-9932111 CTTTGGGAGGCGTGGGGGGGGGG + Intronic
901650221 1:10738719-10738741 GAGGGGGAGGAGAGGGAGGCAGG + Intronic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902478788 1:16701138-16701160 CATGGGCTGGAGAGTGGGGCAGG - Intergenic
902480329 1:16708140-16708162 CCCCGGGAGGGGAGGGGGGCGGG - Intergenic
902615876 1:17623287-17623309 CAGTGGGATTAGAGGGTGGCAGG + Intronic
902632697 1:17714894-17714916 CCTTAGGAGGAGTGGGGGACGGG + Intergenic
902813975 1:18905495-18905517 GAGTGGGAGGAGAGGGGGTGGGG - Exonic
902823390 1:18956734-18956756 CAGAGGGAGGAGGGGTGGGCGGG - Intergenic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903128773 1:21264861-21264883 CATGGGGAAGAGTGTGGGGCAGG - Intronic
903656227 1:24950325-24950347 CATGGGGAGGAGAAAGGGGTTGG - Intronic
903799333 1:25954934-25954956 CAAAGGGAGGAGCTGGGGGCAGG - Intergenic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904389622 1:30173706-30173728 CATAGGGAGGAGAGAGGCCCAGG + Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
904816247 1:33202351-33202373 CTTTGGGAGGCGAGGGCGGGCGG + Intergenic
905143577 1:35869028-35869050 AATTTGGGGGAGAGGGGGTCTGG - Intergenic
905393537 1:37653031-37653053 CATTGGGAGGTGTGGGGGGTGGG - Intergenic
905708664 1:40082070-40082092 CATTTTGAGGAGGTGGGGGCTGG - Intronic
905846337 1:41236285-41236307 CTTTGGGATGGGAGGGGTGCAGG + Intronic
906180107 1:43810738-43810760 CCTTGGGAGCAGAGGGGCGAGGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906305687 1:44717421-44717443 CATAGGGAGAAGGGAGGGGCTGG - Intronic
906819698 1:48916389-48916411 CACAGGGAGGAGAGGGAGGCGGG + Intronic
906928756 1:50147771-50147793 CAGTGGGAGGATTGGGGGGTGGG + Intronic
907270599 1:53288709-53288731 CATGTGGAGGATAGTGGGGCTGG - Intronic
907569338 1:55468502-55468524 AACGGGGAGGAGAGGGGAGCAGG - Intergenic
908544514 1:65149366-65149388 GAGTGGGAGGAGAGGGGGAAAGG - Intronic
910449567 1:87331653-87331675 CAGTGGGCGGAGGCGGGGGCTGG + Intronic
910465285 1:87492630-87492652 CCGTGGGAGGAGAGACGGGCTGG + Intergenic
911054230 1:93697026-93697048 CTAAGGGAGGAGAGGAGGGCTGG - Intronic
912023646 1:105139010-105139032 GAGTGGGTGGACAGGGGGGCAGG - Intergenic
912386363 1:109273061-109273083 CAGTGGGAGGACAGTGGGCCTGG + Intronic
913528127 1:119712845-119712867 CCTTCGGAGGAAAGGGAGGCGGG + Intronic
914493638 1:148172194-148172216 CTGTGGGAGGAGAGATGGGCTGG - Intergenic
915130721 1:153693708-153693730 CATGGGGAGGGGAGGGGATCAGG - Exonic
915225144 1:154406132-154406154 CAGAGGGAGAAGAGGGGCGCTGG - Intronic
915275197 1:154783692-154783714 GACTGGAAGGAGAGGGGAGCTGG + Intronic
915343281 1:155187663-155187685 CACTGGAAGGAGAGGGGCCCCGG + Intronic
915585838 1:156843483-156843505 CAACGGGAGGTGAGGGGGTCAGG + Intronic
915954037 1:160208322-160208344 GCTTGGAAGGAGAGGGAGGCAGG + Intronic
915994343 1:160548557-160548579 CAATGGGAGGGAATGGGGGCGGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916666664 1:166973751-166973773 CACTGGGAGGCCAGGGGAGCGGG + Intronic
916685391 1:167140425-167140447 CATAGGTAGGAGAGAGGGTCAGG - Intergenic
918406210 1:184214036-184214058 CCTGAGGAGGGGAGGGGGGCAGG - Intergenic
918513448 1:185336573-185336595 GATTGGGAAGAGAGGGAGGCTGG + Intergenic
918532812 1:185541683-185541705 CATGGGGTGGGGAGAGGGGCAGG + Intergenic
918533765 1:185551657-185551679 CTTTGGGAGGTGAGGGAGGGTGG + Intergenic
918882264 1:190139605-190139627 CATTAGAAGGAAAGGTGGGCAGG + Intronic
920237499 1:204517916-204517938 CTTTGGGAGGCCAAGGGGGCAGG + Intronic
920676511 1:208042062-208042084 CAGTGGGTGGAGAGGGTGGCAGG - Intronic
921225527 1:213015571-213015593 CGGAGGGAGGAGAGAGGGGCGGG - Intronic
921827416 1:219688682-219688704 CATGGTGAGGAGAGGGAGGGTGG - Intronic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
922769966 1:228176404-228176426 CATTTGGGGGAGAGGGAGGTGGG + Exonic
922966246 1:229693279-229693301 CATAGGGAGGATATGGGAGCAGG + Intergenic
922986237 1:229868007-229868029 CCTGGGGAGGTGAGTGGGGCTGG + Intergenic
923051881 1:230395418-230395440 GAGTGGGAGGAGAGGAGGGGAGG - Intronic
923403899 1:233642018-233642040 CTTTTGGTGGAGAGGTGGGCAGG + Intronic
923455555 1:234162300-234162322 TATGGGGATGAGAGTGGGGCAGG - Intronic
923482378 1:234397318-234397340 GAGTGGGAGGAGAGGGAGGAGGG + Intronic
923954353 1:238997929-238997951 CCTTGGGGGGAGAGGTGGGAGGG - Intergenic
924741650 1:246797594-246797616 CATCTGGCGGGGAGGGGGGCGGG - Intergenic
1063178326 10:3571797-3571819 CACTGGGAGGAGAGAGGGGCAGG - Intergenic
1063369842 10:5514072-5514094 CAGAGGGAGGAGAGGGGGCAGGG - Intergenic
1063968776 10:11367159-11367181 AGTTGGGAGGAGAAGGGGGAGGG - Intergenic
1064074591 10:12258654-12258676 CATTGGGTGGGGTGGGGGGGGGG + Intergenic
1065177661 10:23095350-23095372 GAGTGGGAGGAAAGAGGGGCGGG + Intergenic
1065687672 10:28302667-28302689 CCTTGTGAGGAGGTGGGGGCGGG - Intronic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066168051 10:32808929-32808951 CTTTGGGAGGTGAAGGTGGCAGG + Intronic
1066203835 10:33167448-33167470 CTTTGGGAGGTGAGGCAGGCAGG - Intergenic
1067060724 10:43076838-43076860 CTTGGGGAGGAGCGGGGTGCGGG - Intergenic
1067107043 10:43373389-43373411 CATGGGGAGGAGTAGGGGGTGGG + Intronic
1067226212 10:44377832-44377854 CCCTGGGAGGAGAGGGATGCAGG + Exonic
1067842988 10:49696755-49696777 GATTGGGGGGTGTGGGGGGCAGG + Intronic
1067945292 10:50685112-50685134 CCTGGGGAGGAGAGGTTGGCCGG - Intergenic
1068849994 10:61726812-61726834 CTTTGGGAGGCGAGCGGGGGTGG + Intronic
1068866417 10:61900277-61900299 GAGTGGGAGGAGAGCGGGGAAGG + Intergenic
1068886615 10:62104443-62104465 CTTTGGGAGGTGATGGGGTCAGG - Intergenic
1069245659 10:66202028-66202050 CTTTGGGAGGCCAGGGTGGCTGG - Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069594192 10:69659983-69660005 AATTGAGAGGAGAGGAGGGGTGG + Intergenic
1070329852 10:75409210-75409232 CACTGGGGGGAGAGAGGGGCGGG - Intergenic
1070463226 10:76690951-76690973 CATGGGGAGGAGGAGGGGGAGGG - Intergenic
1070597784 10:77844858-77844880 CACTGGGCAGAGAGGGGGGCAGG + Intronic
1070880592 10:79850105-79850127 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071633714 10:87234207-87234229 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071647162 10:87366423-87366445 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1071984808 10:91039630-91039652 GAGTGGGAGGAGTGGGTGGCAGG + Intergenic
1072808979 10:98445259-98445281 CCTGGGGAGGACAGGGAGGCAGG - Intronic
1073498427 10:103915281-103915303 CTTTGGGAAGGGAGTGGGGCTGG - Intronic
1073874197 10:107902354-107902376 TATTGGGGGGGGGGGGGGGCGGG + Intergenic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1074699848 10:116083325-116083347 GACTGGGAGGAGAGGAGGCCTGG - Intronic
1075225010 10:120620934-120620956 GTTTGGGAGGAGATGGGTGCAGG - Intergenic
1075367985 10:121909801-121909823 CTTTGGGAGGCGAGGGTGGGAGG + Intronic
1076007085 10:126956441-126956463 GAGTGGGAGGAGAGGGGCTCAGG + Intronic
1076463820 10:130664789-130664811 GGCTGGGAGGAGAGGGGAGCTGG + Intergenic
1076704282 10:132292897-132292919 CATGGGGAAGGGAGGGGGGAGGG - Intronic
1076762375 10:132611906-132611928 GTGTGGGAGGTGAGGGGGGCAGG + Intronic
1076790523 10:132774791-132774813 TACAGGGAGGAGAGAGGGGCAGG + Intronic
1077316259 11:1920660-1920682 CCTTGGGAGGTGACGGGGCCAGG - Intronic
1077475435 11:2788140-2788162 CATGGGGTGGAGAGGGGCGCTGG - Intronic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078060551 11:8040098-8040120 CAATGGGAGGGCAGGGGGGCTGG - Intronic
1078146638 11:8726148-8726170 CAGTGGGAGAAGAGGGGTACAGG + Exonic
1078263721 11:9736963-9736985 CTTTGGGAGGACAGGGTGGGAGG + Intronic
1078308782 11:10218317-10218339 CATTGGGTGGGGGGGGGGGTGGG - Intronic
1078609286 11:12806207-12806229 GAGTGGGAAGAGAAGGGGGCAGG - Intronic
1078760649 11:14248720-14248742 CACTGGGCGGCGAGGGAGGCTGG - Intronic
1080447874 11:32353900-32353922 TTTTGGGAGGTGAGGGGGGGAGG - Intergenic
1080524243 11:33098155-33098177 CATTGGGAGAGGAAGGGGACAGG - Intronic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081737836 11:45416717-45416739 CATGGGGAAGAGAGGGAGGAAGG - Intergenic
1082824503 11:57567852-57567874 CTTTGTGCGGAGACGGGGGCGGG + Intronic
1083144150 11:60746043-60746065 CTTTGGGAGGCTGGGGGGGCGGG + Intergenic
1083241340 11:61391242-61391264 CTTTGGGAGGCGGGGGGGGGGGG + Intergenic
1083254934 11:61490109-61490131 CACTGGAAGGAGAGGAGGGGAGG - Intronic
1083378039 11:62242146-62242168 CCTGGGAAGGAGAGGTGGGCTGG + Intergenic
1083652529 11:64211577-64211599 CGTGGGGTGGGGAGGGGGGCTGG - Intronic
1083674743 11:64319057-64319079 GTTTGGGAGGAGAAGGGGGAAGG - Intronic
1083685570 11:64373137-64373159 CATTGGGTGGAGAGTAGGGGAGG + Intergenic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1084195867 11:67523408-67523430 CATCGGGAGCAGCTGGGGGCTGG - Intronic
1084694038 11:70743385-70743407 CATTGGGGGGCGAGGGGTACTGG - Intronic
1084944382 11:72630973-72630995 CCTTGGGAGGACGGGGAGGCTGG - Intronic
1085027132 11:73242814-73242836 CAGTGGCAGGAAACGGGGGCTGG + Intergenic
1085129661 11:74027349-74027371 CTTTGGGAGGACAAGGTGGCAGG - Intronic
1085447625 11:76611102-76611124 CATGGAGAGGAGAGGGCTGCAGG + Intergenic
1085464633 11:76715454-76715476 CATGGTGAGGAGAGAGGGGCGGG + Intergenic
1085740530 11:79074710-79074732 CACCAGGAGGAGATGGGGGCAGG + Intronic
1085744194 11:79100778-79100800 CATTGGGAGGAGAGAGGGAGGGG - Intronic
1085750815 11:79159608-79159630 CATTAGGAGGCCAGGAGGGCGGG - Intronic
1086068448 11:82771591-82771613 CTTTGGGAGGAGGGTGAGGCAGG - Intergenic
1087250133 11:95889512-95889534 TTTTGGGGGGGGAGGGGGGCGGG + Intronic
1087762018 11:102111342-102111364 CTCTGGGAGGAGTGGGGAGCTGG - Intronic
1088401404 11:109424634-109424656 CAAAGGGAGGGGAGGGGGCCCGG + Exonic
1088578758 11:111297530-111297552 CATTGGGGTGAGAAGGGGGAGGG - Intergenic
1088920260 11:114255468-114255490 CAGAGGGAGGAGGGGAGGGCGGG - Intergenic
1089093227 11:115896351-115896373 CATTGGGAAGAGAGAGGAGAGGG - Intergenic
1089118506 11:116114951-116114973 GATGGGGAGGGGAGGGGGGGAGG - Intergenic
1089493640 11:118898156-118898178 AATTGGGAGGAGTGGGGGAGGGG + Exonic
1089583502 11:119495906-119495928 CGTTGGGAGAAGAGTGGAGCAGG - Intergenic
1089649663 11:119904495-119904517 CTTTGGGAGGAGAGGAGAGGAGG + Intergenic
1089948962 11:122507883-122507905 CTTTGGGAGGCGATGGGGGGTGG + Intergenic
1089965666 11:122653166-122653188 CAAAGAGAGAAGAGGGGGGCTGG - Intergenic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090430144 11:126639109-126639131 CTTTGGGATGATTGGGGGGCTGG - Intronic
1090817948 11:130314943-130314965 GAAGGGGAGGAGAAGGGGGCGGG + Intergenic
1091399194 12:172325-172347 GATGGGGAGTGGAGGGGGGCGGG - Intronic
1091905798 12:4188266-4188288 CTTTGGGAGGACAGGGTGGGTGG + Intergenic
1091912495 12:4243391-4243413 CCATGGGAGGAGAGGGGCTCCGG - Intergenic
1092524607 12:9302099-9302121 CAAAGGGAGGAGAGGGGGCTGGG - Intergenic
1092542658 12:9429713-9429735 CAAAGGGAGGAGAGGGGGCTGGG + Intergenic
1092986530 12:13851084-13851106 GGTTGGGAGGAGAGTGGGGTGGG - Intronic
1093500767 12:19809492-19809514 TAGAGGGAGGAGAGGGGGACCGG + Intergenic
1093547032 12:20360507-20360529 AATTGGGAGGAGAGGGTGCTTGG - Intergenic
1094372131 12:29750189-29750211 AATTGGGAGGAGAAGGGGTGAGG - Intronic
1095946921 12:47758921-47758943 CCTGGGGAGGGGAAGGGGGCGGG - Intronic
1096105410 12:48994788-48994810 GAGTGGGAGCAGAGGCGGGCAGG + Intergenic
1096948436 12:55436915-55436937 CATGGGAAGGAGAGAGTGGCAGG - Intergenic
1097248360 12:57619163-57619185 CCTTGGGCGGAGAGAGAGGCTGG - Intronic
1097573978 12:61367995-61368017 CTTTGGGAGGCGAGGCTGGCAGG - Intergenic
1098300881 12:69053157-69053179 CAGTGGGAGGTGTGGAGGGCAGG + Intergenic
1099352255 12:81588386-81588408 GATTGGGAGTAGGGTGGGGCTGG - Intronic
1100301900 12:93315308-93315330 CATTGGGTGCTGAGGGAGGCGGG - Intergenic
1101097170 12:101354543-101354565 CACTGGGAGGCTTGGGGGGCAGG - Intronic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1102009221 12:109607704-109607726 CATTAGGAGGAGGGTGGGTCAGG - Intergenic
1102456973 12:113077134-113077156 CACTGGGGCGAGAGGTGGGCAGG - Intronic
1102651204 12:114443828-114443850 CACTGGGAGGGGAGGGTCGCTGG + Intergenic
1102860695 12:116333736-116333758 GATTGGGAGGTGAGGGGGATTGG + Intergenic
1103484875 12:121275916-121275938 CTTTGGGAGGACAGGGCGGGTGG + Intronic
1103512351 12:121484105-121484127 AGGTGGGAGGAGAGGGAGGCGGG - Intronic
1103678108 12:122672612-122672634 CTCTGGGAGGGGAGAGGGGCTGG - Intergenic
1103837552 12:123835234-123835256 CATTTGGAGTGGAGGGGAGCTGG + Intronic
1104898319 12:132175091-132175113 CTCTGGGAGGTGAGGAGGGCTGG + Intergenic
1104943085 12:132403951-132403973 CCTGGGGAGGCGAGGGGGCCTGG + Intergenic
1105213305 13:18270645-18270667 GATTGGGAGGTGAGCGGGGCAGG - Intergenic
1105264615 13:18804988-18805010 CATTGGGAGGTGGGGGTGGGAGG - Intergenic
1105986824 13:25575696-25575718 CATGGGGAGGGGAGGAGGGATGG + Intronic
1106082647 13:26513130-26513152 CTTTGGGAGGCCAAGGGGGCAGG - Intergenic
1106360754 13:29028486-29028508 GAGTGGAAGGAGAGGAGGGCAGG - Intronic
1107628786 13:42320511-42320533 CAGTGGGAGGAGGGGGGAGGGGG - Exonic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107882294 13:44843268-44843290 GAGTGGGAGGAGAAGGGGGGTGG + Intergenic
1108040848 13:46338347-46338369 AAGTGGGAAGAGAGAGGGGCAGG - Intergenic
1109773773 13:67012709-67012731 TAGTTGGAGGAGAGGAGGGCAGG - Intronic
1109864082 13:68239443-68239465 CTTTGGGAGGCCGGGGGGGCAGG + Intergenic
1110693364 13:78458020-78458042 CATTGGGAGGTGAAGGAGGGAGG - Intergenic
1112327210 13:98449876-98449898 CATAGGGAACAGTGGGGGGCAGG - Intronic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1112717208 13:102200857-102200879 CATTGGGAGGACAAGGCGGGCGG + Intronic
1113425024 13:110200546-110200568 CCGTGGGAAAAGAGGGGGGCAGG + Intronic
1113486087 13:110653173-110653195 CCTGGGGTGGGGAGGGGGGCTGG + Intronic
1113927084 13:113947593-113947615 CAGTGGGTGGAGCGGGGAGCTGG + Intergenic
1115763365 14:36597790-36597812 TTTTGGGGGGGGAGGGGGGCTGG + Intergenic
1116731242 14:48624970-48624992 CTTTGGGAGGCGAGGCGGGCAGG + Intergenic
1116846407 14:49868296-49868318 AACTGGGAGGGGAGGGAGGCGGG + Intergenic
1117661551 14:58011053-58011075 AATTGTGAAGAGAGGTGGGCTGG - Intronic
1118763056 14:68892343-68892365 TGTTGGGAGGAAAGGGAGGCTGG - Intronic
1119236813 14:73026815-73026837 CCTCGGGAGGAAGGGGGGGCGGG - Intronic
1119734576 14:76973784-76973806 CTTTGGGAGGCTGGGGGGGCGGG - Intergenic
1119768693 14:77206630-77206652 GATGGGGAGGAGAGGGTGGAGGG - Intronic
1119771169 14:77221297-77221319 GATTGGGAGGCGAGAGGGGGAGG - Intronic
1119805299 14:77478326-77478348 CTTTGGGAGGAAAGGAGGCCAGG + Intronic
1119853030 14:77879541-77879563 CAGAGGGAGGAGGGTGGGGCAGG + Intronic
1119855287 14:77895762-77895784 CAGTGGGTGGGGAGGGGGTCAGG - Intronic
1119877739 14:78074960-78074982 GATGGGGAGGAGAGGGGGCGGGG + Intergenic
1120433556 14:84450536-84450558 CATTGGGAGGCCAAGGGGGGTGG - Intergenic
1121120392 14:91372415-91372437 CACTGGGAGCAGAGGAGAGCGGG + Intronic
1121210667 14:92206154-92206176 GACTGGGAGGGGAGAGGGGCTGG - Intergenic
1121290430 14:92770064-92770086 CTTTGGGAGGCGAGGTGGGTGGG - Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1122206318 14:100149759-100149781 CAGTGGGAGCGGAGGAGGGCGGG - Intronic
1122234850 14:100325745-100325767 CACGGTGAGGAGAGTGGGGCCGG - Intronic
1122703345 14:103605063-103605085 AAGTGGGTGGAGAGGGGGGGTGG - Intronic
1123018860 14:105388258-105388280 CAGTGTGAGGAGACGGCGGCTGG - Intronic
1123704972 15:22944760-22944782 AACTGGGAGGAGAGTGGGCCAGG + Intronic
1124622476 15:31282069-31282091 CTTTGGGAGGTGAGGGGGGGCGG - Intergenic
1125667166 15:41440430-41440452 CTTTGGGAGGCCAAGGGGGCGGG - Intronic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1126768328 15:52031174-52031196 CATTGGGAGGACAAGGTGGGCGG - Intronic
1127635609 15:60866608-60866630 TCTAGGGAGGAGAGAGGGGCTGG + Intronic
1127828390 15:62726866-62726888 AATTGGGAGGGGAGGGGGCATGG + Intronic
1127964523 15:63913976-63913998 GGTTGGGAGGAGAGTAGGGCAGG - Intronic
1128256260 15:66199334-66199356 GACTGGGAGGAGAGGAGGGTGGG - Intronic
1128683134 15:69665908-69665930 CAGTGGGAGGAGAGAGGGGCTGG + Intergenic
1129889979 15:79065537-79065559 CATTGGCAGGAGGAAGGGGCAGG + Intronic
1130282788 15:82532380-82532402 CTGTGGCAGGAGAGGCGGGCAGG + Intergenic
1130292309 15:82613856-82613878 CATTGAGGGGGGAGCGGGGCGGG - Intronic
1130422719 15:83764387-83764409 CATTGGGTGGAGCGCGGGGCAGG - Intronic
1130531094 15:84748467-84748489 GATTGGGGGGGGGGGGGGGCAGG - Intergenic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1131417521 15:92273501-92273523 CATTGGGATTAGATGGCGGCAGG + Intergenic
1132549848 16:549869-549891 CGTTGGGAGGAGAGGCGAGGCGG + Intronic
1132671150 16:1102779-1102801 CTGTGGGAGGTGAGGGGGGCTGG - Intergenic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132759519 16:1501959-1501981 CTTGGGGAGGAGAGAGGGGCTGG + Intronic
1133237730 16:4395401-4395423 GGTTGGGAGGTGAGGGGAGCAGG - Intronic
1134691347 16:16192654-16192676 CATTGAGAGGATAGGGGGAGGGG + Intronic
1134743448 16:16569211-16569233 CTAAGGGAGGAGAGGAGGGCAGG - Intergenic
1134924107 16:18143250-18143272 CTAAGGGAGGAGAGGAGGGCAGG + Intergenic
1135434832 16:22419945-22419967 CATTGGGAGGTGAGGTGCTCGGG - Intronic
1135466047 16:22685791-22685813 CTTAGGGAGGAGAGGAGGGTAGG + Intergenic
1135588772 16:23690821-23690843 CACAGGGAGGTGAGGTGGGCTGG - Exonic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135935221 16:26774158-26774180 AATTGGGAGGGGAGAGGGGCAGG + Intergenic
1136016304 16:27403247-27403269 CATGTGGAGGAGAGGAGGGTGGG + Intronic
1136381343 16:29897273-29897295 CCTTGGGAGGAGGTAGGGGCTGG - Intronic
1136544517 16:30947980-30948002 TATTGTGCGGAGAGGCGGGCAGG - Exonic
1136932606 16:34432684-34432706 CAATGGGAAGAGAGGGCGGGAGG - Intergenic
1136971966 16:34979130-34979152 CAATGGGAAGAGAGGGCGGGAGG + Intergenic
1137245164 16:46696896-46696918 CTTTGGGAGGTGAAGGGGGCGGG - Intronic
1138857563 16:60712921-60712943 CTTTGGGAGGTGAGGGAGGGAGG + Intergenic
1139219695 16:65168609-65168631 CATTGGGAGGCCAAGGCGGCTGG - Intergenic
1139405165 16:66712224-66712246 CTTTGGGAGGTGAAGGAGGCAGG + Intergenic
1139508350 16:67411070-67411092 TGTTGGGAGCAGAGGTGGGCAGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139677060 16:68530801-68530823 CCCTGGGAGGAGAGGCGGGTGGG + Intronic
1139847214 16:69929536-69929558 ACTTGGGCTGAGAGGGGGGCCGG + Intronic
1140105650 16:71957552-71957574 CTTTGGGAGGAGAAGGTGGGAGG + Intronic
1140441437 16:74991020-74991042 CTTTGGGAGGCCAGCGGGGCGGG - Intronic
1140464208 16:75166470-75166492 CTTTGGGAGGCTAGGTGGGCGGG - Intronic
1141798457 16:86290799-86290821 CATTGGGAATAGAGGGGGAAAGG + Intergenic
1141988347 16:87594434-87594456 CCTTGGGTGGGGTGGGGGGCCGG + Intergenic
1142177422 16:88651507-88651529 CAGGGGGAGGAAATGGGGGCTGG - Intergenic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1142264548 16:89057712-89057734 CAAGGGGAGGAGAGGAGGACAGG - Intergenic
1142303850 16:89274745-89274767 CAAGGGGAGGGGAGGCGGGCAGG + Intronic
1142498614 17:320088-320110 CATTGAGGGGAGAGAGGGGGAGG + Intronic
1142695568 17:1630981-1631003 CCCTGGGATGAGATGGGGGCTGG - Intergenic
1143281685 17:5759117-5759139 CTTTGGGAGGCCAGGCGGGCGGG + Intergenic
1143405671 17:6675671-6675693 CACCAGGAGAAGAGGGGGGCTGG - Intergenic
1143447595 17:7018455-7018477 CATGGTTGGGAGAGGGGGGCCGG + Intergenic
1143473448 17:7190421-7190443 CATTGGGGGCAGGTGGGGGCGGG + Exonic
1143542996 17:7580625-7580647 GATTGGGAGGGGAGGGGCGCCGG - Intronic
1143658799 17:8312419-8312441 CATGGGGAGCAGAGGCGTGCAGG - Exonic
1143792681 17:9310605-9310627 TTTTGGGAGGAGAGTGGGACAGG + Intronic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1144699188 17:17325712-17325734 CAGTGGGTGGAGAGGCAGGCAGG - Intronic
1144946728 17:18973190-18973212 CATTGGGAGGAGGTGGGAGGTGG - Intronic
1145028442 17:19486739-19486761 CATTGTCAGGAGAGTGGGACTGG - Intergenic
1145901237 17:28491660-28491682 CACTGGGAGGTGAATGGGGCTGG + Intronic
1146699231 17:34940167-34940189 CAGTGGGAGGGGAGGGGCACTGG - Intronic
1147209879 17:38866751-38866773 CATTTTGTGGAGATGGGGGCAGG - Intergenic
1147248495 17:39138311-39138333 CAAGGGCAGGAGAGGGGGCCAGG + Intronic
1147366459 17:39962741-39962763 GATTGAGAGGAGAGGAAGGCAGG - Intergenic
1147650184 17:42057601-42057623 CATTGGGAGGAGAGGCAAGGGGG + Intronic
1147914861 17:43880135-43880157 CAATGGGGAGAGTGGGGGGCAGG - Intronic
1148195285 17:45708657-45708679 CCTTGGAAGGAGAGGGGGAGTGG + Intergenic
1148786524 17:50148716-50148738 CACTGGGTAGAGAGGGGGCCGGG - Intronic
1148864280 17:50620518-50620540 CAAGGGGAGGGGAGGAGGGCAGG - Intronic
1149460737 17:56828160-56828182 CTTTGGGAGGACAGGGTGGGTGG + Intronic
1149614656 17:57988032-57988054 CACGGGGGGGACAGGGGGGCCGG - Intronic
1150221373 17:63497487-63497509 GACTGGGAGGGGAGGGGGACAGG - Intronic
1151185238 17:72359397-72359419 CAATGGGAGGTGAGGGAGGCTGG - Intergenic
1151194922 17:72424627-72424649 CAGTGGGAGGAGGGGATGGCAGG - Intergenic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151434572 17:74086976-74086998 CATTGGGAAGAGGGGGATGCTGG - Intergenic
1151479286 17:74360937-74360959 CAGTAGCAGGAGAGAGGGGCGGG + Intronic
1151484265 17:74388740-74388762 TACTGGGAGGAGAGGGAGCCAGG + Intergenic
1151636463 17:75352188-75352210 CACTGGGAGGGCTGGGGGGCAGG + Intronic
1151785067 17:76271447-76271469 TGTGGGGAGGAGAGAGGGGCCGG + Intergenic
1151986792 17:77548793-77548815 CAGTGGGTGGGTAGGGGGGCTGG + Intergenic
1152128691 17:78462826-78462848 CCCAGGTAGGAGAGGGGGGCTGG - Exonic
1152157995 17:78647549-78647571 CATAGAGAGGAGAGAGAGGCAGG + Intergenic
1152168282 17:78725078-78725100 GACTGGGAGGAGAGGTGGGATGG - Intronic
1152176760 17:78793009-78793031 CCTGGGGGGGTGAGGGGGGCGGG - Intronic
1152214926 17:79026613-79026635 CAAGAGGAGGAGAGGGAGGCGGG - Intronic
1152360683 17:79831918-79831940 CATGGGGAGGGGAGGGGGAAGGG - Intergenic
1152378010 17:79928654-79928676 CCTTGGGAGGTGAGGGTGGGAGG - Intergenic
1152524428 17:80879420-80879442 GAGTGGGAGGAGAAAGGGGCAGG - Intronic
1152530002 17:80912697-80912719 CCGTGGTGGGAGAGGGGGGCGGG - Intronic
1152757389 17:82092659-82092681 CATGGGGTGGTGAGTGGGGCGGG + Intronic
1152799574 17:82324513-82324535 CACGGGGAGGGGAGGGGGCCTGG - Intronic
1154159060 18:11966813-11966835 CTTTGGGAGGTGAGGTGGGAGGG + Intergenic
1154163759 18:11998932-11998954 CATTGGGTGGGGGGGGGGGGGGG - Intronic
1154423775 18:14256572-14256594 CATTGGGAGGTGGGGGTGGGAGG + Intergenic
1156465549 18:37346175-37346197 CAGTTGGAGGAGGTGGGGGCAGG - Intronic
1156641876 18:39111368-39111390 AATTGGGAGGAGAAGGTGGTAGG + Intergenic
1157597722 18:48874095-48874117 AATTAGCAGGAGAGGGAGGCAGG + Intergenic
1158032398 18:52982170-52982192 CAGAGGGAGGATAGAGGGGCAGG + Intronic
1158220544 18:55146262-55146284 CCTGGGGAGGAGGTGGGGGCTGG - Intergenic
1158341320 18:56469718-56469740 CAATGGGTGCAGAGGAGGGCGGG - Intergenic
1158856178 18:61544887-61544909 CATTGGTATGGGAGAGGGGCAGG - Intronic
1158977796 18:62727921-62727943 GATGGGAAGGGGAGGGGGGCTGG + Intronic
1159358266 18:67365346-67365368 CATTGGGAGGCCAAGGGGGCTGG + Intergenic
1160025916 18:75215998-75216020 GGTTGGAAGGGGAGGGGGGCTGG + Intronic
1160134926 18:76263691-76263713 GCTGGGGAGGAGAGGGAGGCAGG - Intergenic
1160183424 18:76655686-76655708 CATGGGGAGGAGATGGGTCCTGG - Intergenic
1160201668 18:76801619-76801641 CTTTGGGGGGCGAGGGAGGCAGG - Intronic
1160498824 18:79392331-79392353 CAGAGGGAGGAGAGGGGACCGGG + Intergenic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161410110 19:4112386-4112408 CATGAGGAGGAGATGGGGGAGGG + Intronic
1161479226 19:4502375-4502397 CAGTGGCAGGAGAGCTGGGCGGG + Exonic
1161530140 19:4783823-4783845 CTTTGGGAGGAGAAGGAGGGAGG + Intergenic
1161706582 19:5825004-5825026 CGGTGGGAGGAGAGAGAGGCTGG + Intronic
1161744710 19:6048877-6048899 GTTTGGGAGGGGACGGGGGCGGG - Intronic
1161753487 19:6114624-6114646 CTTTGGGAGGCCAAGGGGGCCGG - Intronic
1162019714 19:7862937-7862959 GATTGGGGGGAAAGGAGGGCGGG - Intronic
1162036204 19:7941020-7941042 CATTGGCAGGAGGGAGGGGTGGG - Intronic
1162363154 19:10231374-10231396 AAAGGGGAGGAGAGGAGGGCGGG - Intergenic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162821921 19:13228322-13228344 CTTTGGGAGGTGAGGGGTGGAGG + Intronic
1162835656 19:13315911-13315933 GATTGGGCAGTGAGGGGGGCAGG - Intronic
1162842022 19:13363641-13363663 CACTGGGTGGAGAGGGTGGGTGG + Intronic
1163314013 19:16530679-16530701 CGGTGGGAGGAGAGAGAGGCCGG + Intronic
1164013324 19:21228956-21228978 CATTTGGAGAAGAGGGGCTCTGG - Intronic
1164144792 19:22505350-22505372 GGTGGGGAGGAGAAGGGGGCTGG - Intronic
1164674817 19:30094167-30094189 CAATGGCAGGAGGTGGGGGCAGG - Intergenic
1164821838 19:31256746-31256768 CACTGTGAGGACAGGCGGGCAGG - Intergenic
1164868152 19:31622148-31622170 CATTGGAAAGAGAGAGGGGATGG + Intergenic
1165320001 19:35079432-35079454 GGTGGGGAGGAGAGGAGGGCAGG - Intergenic
1165395859 19:35563309-35563331 CAGTGGGCGGGGAGGGGGCCAGG - Intronic
1165648886 19:37468872-37468894 AATTGGGAGGGGAGCGGGGTGGG - Intronic
1165694013 19:37886537-37886559 CATTGGAAGAAGAGGTGGACAGG - Exonic
1165759203 19:38310688-38310710 CATTGGGAGGCGCAGGTGGCTGG - Intronic
1166101809 19:40575932-40575954 CCTAGGGCAGAGAGGGGGGCAGG - Exonic
1167167301 19:47807297-47807319 CTTTGGGAGGCAAGGTGGGCTGG - Intronic
1167250353 19:48395830-48395852 CCTTGGGGGAAGAGGGGAGCTGG + Intronic
1167272131 19:48511613-48511635 GCTGGGGAGGAGGGGGGGGCGGG + Exonic
1167382865 19:49148816-49148838 GATGGGGAGGAGAGGGGGTAGGG + Intronic
1167528351 19:49999639-49999661 CATCGGGAAGAGGGGTGGGCTGG - Intronic
1168059778 19:53884335-53884357 GGCTGGGAGGGGAGGGGGGCTGG + Intronic
1168107057 19:54172083-54172105 CCTGGGGAGGAGCAGGGGGCTGG + Exonic
1168169513 19:54576311-54576333 GGCTGGGAGGAGACGGGGGCGGG + Intronic
1168258083 19:55178138-55178160 CATTGAGAGGAGCAGGGTGCGGG + Intronic
1168544550 19:57240114-57240136 CATTGGGAGGCCAAGGGGGGCGG - Intergenic
1202712807 1_KI270714v1_random:26969-26991 CATGGGCTGGAGAGTGGGGCAGG - Intergenic
1202714368 1_KI270714v1_random:34042-34064 CCCCGGGAGGGGAGGGGGGCGGG - Intergenic
924998555 2:385934-385956 CTGTGGGAGGAAAGGGGAGCAGG - Intergenic
925250504 2:2432559-2432581 CATGGGGTGGGGAGGGGGGAAGG + Intergenic
925405403 2:3602749-3602771 CAGTGCGGGGAGAGGTGGGCTGG - Intronic
925605290 2:5654158-5654180 TTTTGGGAGGAGAGTGGTGCTGG - Intergenic
925996075 2:9294431-9294453 CCTTGGTAGGAGAGAGGAGCCGG - Intronic
926331801 2:11831987-11832009 CATGGGGAGGAGAGAGGAGCAGG + Intergenic
926423324 2:12718795-12718817 CCCGGGGAGGAGAGGGCGGCGGG + Intronic
927550076 2:23990521-23990543 CTTTGGGAGGCCGGGGGGGCGGG + Intronic
927788132 2:25988309-25988331 CTTTGGGAGGCCAGGGTGGCTGG - Intergenic
927869937 2:26616942-26616964 GATTGGAAGGTGAGGGGAGCAGG + Intronic
927871711 2:26628290-26628312 GATTGGGAGGTGGGGGGAGCAGG + Intronic
927997122 2:27494443-27494465 CATTCACAGGAGAGGGAGGCCGG + Exonic
928024507 2:27728707-27728729 CATTGGAAGGAGTAGGGGGATGG - Intergenic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928200712 2:29246138-29246160 GGTGGGGAGGAGATGGGGGCAGG + Intronic
928353203 2:30582208-30582230 CATTGCCATGGGAGGGGGGCAGG - Intronic
929109233 2:38392423-38392445 CTTTGGGAGGCCGGGGGGGCGGG + Intergenic
929548939 2:42876853-42876875 TTTTTGGAGGGGAGGGGGGCAGG + Intergenic
930078568 2:47428089-47428111 CTTTGGGAGGCGAGGCTGGCAGG + Intronic
930100022 2:47596280-47596302 AACTGAGTGGAGAGGGGGGCTGG + Intergenic
930110910 2:47677891-47677913 TCTTGGGAGGAGATGGGGGTGGG - Intergenic
930136549 2:47907730-47907752 ACTTGGGAGGTGAGGGGGGCGGG - Intergenic
930226537 2:48799915-48799937 TTTTGGGAGGAGAGGGAGGCTGG + Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931006116 2:57850930-57850952 AATGGGGAGGAGTGGGGTGCAGG - Intergenic
931411912 2:62040951-62040973 CTTTGGGAGGCAAGGTGGGCAGG - Intronic
931675020 2:64686102-64686124 CATTGGAAAGGGAGGGGGGATGG - Intronic
931851687 2:66257956-66257978 GGATGGGAGGAGAGGGAGGCAGG - Intergenic
932068049 2:68588038-68588060 CTTTGGGAGGCCAAGGGGGCAGG - Intronic
932231567 2:70087827-70087849 CATTGGGAAGAAAGGGGAGTCGG + Exonic
933397258 2:81749433-81749455 CATTGGGAGGCCAGGGCGGGTGG + Intergenic
933739933 2:85525365-85525387 CACTGGGAGGGGAGAAGGGCAGG + Intergenic
933912702 2:86957310-86957332 CAGTGGGAGGAGAGGGGATGTGG + Intronic
933937635 2:87219186-87219208 CCTTGGGAAGAGTTGGGGGCAGG + Intergenic
934010293 2:87812580-87812602 CAGTGGGAGGAGAGGGGATGTGG - Intronic
934077333 2:88439310-88439332 CAGTGGGAGCAAAGAGGGGCTGG - Intergenic
934301018 2:91776099-91776121 GATTGGGAGGTGAGCGGGGCAGG + Intergenic
934979673 2:98829492-98829514 CATGGGGAGGAGGTGAGGGCTGG + Intronic
935773857 2:106453300-106453322 CAGTGGGAGGAGAGGGGATGCGG - Intronic
935906206 2:107842613-107842635 CAGTGGGAGGAGAGGGGATGCGG + Intronic
935992674 2:108735136-108735158 CAGTGGGAGGAGAGGGGATGCGG + Intronic
936282313 2:111152750-111152772 CATTGGGAGAAGAGGAGGGGAGG - Intronic
936355504 2:111746587-111746609 CCTTGGGAAGAGTTGGGGGCAGG - Intergenic
936886870 2:117321112-117321134 CATTTGGAGGAGAGGAGCTCTGG - Intergenic
937096775 2:119240724-119240746 GCTTGGGAGGAGAGGCAGGCAGG + Intronic
937193886 2:120132867-120132889 GGTAGGGAGGAGTGGGGGGCGGG + Intronic
937749587 2:125458867-125458889 CATTGGGAGGTGAAGGCGGGTGG + Intergenic
937810182 2:126190610-126190632 CATTGGGGAGAGATGGAGGCAGG - Intergenic
941500939 2:166275339-166275361 CTTTGGGAGGCGACGGAGGCTGG + Intronic
942787863 2:179720544-179720566 CAAGGGGAGGAGAGGGAGGGAGG + Intronic
944107716 2:196097281-196097303 TTTGGGGAGGAGAGGGAGGCTGG + Intergenic
944911600 2:204315799-204315821 CATTGGGAGGGGAGAAGGGGAGG - Intergenic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945278854 2:208016399-208016421 CTTTGGGGGGAGATGGTGGCAGG + Intronic
945333502 2:208565621-208565643 CTTTGGGAGGCGAGGGTGGGTGG + Intronic
945649353 2:212539007-212539029 AATCGGGAGGGGAGCGGGGCGGG + Intergenic
945754750 2:213832237-213832259 CTTTGGGAGGACAGGGGAGGTGG - Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946130708 2:217604509-217604531 CATTGGGAGGAGAGGGGGGCAGG + Intronic
946169828 2:217888288-217888310 CAGATGGAGGAGAGGAGGGCAGG - Intronic
946348205 2:219128542-219128564 CATGGGGTGAAGAGGAGGGCAGG + Intronic
946418047 2:219550402-219550424 CAGTGGCAGGAGATGGGGGTGGG + Exonic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
947744997 2:232502916-232502938 TTGGGGGAGGAGAGGGGGGCGGG + Intergenic
947792487 2:232876159-232876181 AATTAGGAGGGGCGGGGGGCGGG + Intronic
948120723 2:235528360-235528382 CAGTGGGAGGGGAGGGGGCGGGG - Intronic
948125248 2:235560347-235560369 CATGGGGAGGTGAGGAGGGAGGG - Intronic
948363447 2:237438544-237438566 CATTGGGAGAAAAGAGTGGCTGG + Intergenic
948606423 2:239138731-239138753 CATTGTGTGGAGTGTGGGGCAGG + Intronic
948884771 2:240877155-240877177 CCCTGAGAGGAGAGGGGGCCTGG + Intronic
1169355502 20:4901620-4901642 CAGTGGGAGGGGAGGGCAGCCGG - Intronic
1169557832 20:6768507-6768529 CAGGGGGAGGAGTGCGGGGCAGG - Exonic
1170735759 20:19012984-19013006 CAATGGGAGAAGAGGGGGCGGGG - Intergenic
1170944555 20:20879517-20879539 CTTTGGGAGGTGAGTGGAGCAGG + Intergenic
1171210282 20:23311183-23311205 GAGTGGGAGGGGAGGGGGACAGG - Intergenic
1171878258 20:30598154-30598176 CCTTAGGAGGGGAGGAGGGCAGG - Intergenic
1172132072 20:32662353-32662375 CTTTGGGAGGTCAAGGGGGCAGG + Intergenic
1172361031 20:34312573-34312595 AATGGGGAGGAGTGGGGGGTTGG + Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173219249 20:41117736-41117758 CATTGGGTGGAGAGGTGGGGAGG + Intronic
1173402355 20:42736747-42736769 CCTTGGCAGGGGAAGGGGGCAGG + Intronic
1173581968 20:44153527-44153549 CATGGGGAGGAGATGGAGGTGGG + Intronic
1174599552 20:51713173-51713195 ACTTGGGAGGGCAGGGGGGCAGG + Intronic
1175243484 20:57567045-57567067 CACTGGGAGTAGAGGAGAGCAGG - Exonic
1175674054 20:60931761-60931783 AATGGGGACGAGAAGGGGGCAGG - Intergenic
1175910617 20:62403617-62403639 GTTTGGGAGGAGGGGGCGGCGGG + Intronic
1176113840 20:63422543-63422565 CATGGGGAAGAGACGGGGGAGGG + Intronic
1176849693 21:13903436-13903458 CATTGGGAGGTGGGGGTGGGAGG - Intergenic
1178306375 21:31494155-31494177 CTTTGGGAGGCCAGGGTGGCTGG - Intronic
1178351702 21:31876217-31876239 CTTTGGGTGGAGAAGGAGGCAGG + Intronic
1178503762 21:33146773-33146795 CATTGGTAGGGGAGTGGGGAAGG - Intergenic
1178909997 21:36666721-36666743 TCTTGGTAGGAGAGGGAGGCGGG + Intergenic
1179025053 21:37673125-37673147 AATTGAGAGGAGACGGGGACAGG + Intronic
1179135809 21:38678897-38678919 AATGGGGAGGAGAGGGGAGGGGG + Intergenic
1179143447 21:38747516-38747538 CATGTGGAGGAGAGAGGTGCTGG + Intergenic
1179437017 21:41369178-41369200 CCATGGGAGGAGGGGGGTGCAGG + Intronic
1179643152 21:42760266-42760288 CTTTGGGAGGAGAGGTGGGCGGG + Intronic
1179957993 21:44751804-44751826 CATGGGGAGGACCGAGGGGCCGG - Intergenic
1180209800 21:46288049-46288071 CATTAGGAGGGGAAGGGGGGTGG - Intronic
1180614494 22:17119067-17119089 CATTAGGAGGAGAGGGGTGCTGG - Exonic
1180716588 22:17876629-17876651 CAAGGGGAGGAGTGGGGGACTGG + Intronic
1180816132 22:18791045-18791067 GATTGGGAGGTGAGCGGGGCAGG - Intergenic
1181179046 22:21054565-21054587 CATGGGGAGGAAAGCTGGGCAGG - Intronic
1181202319 22:21225377-21225399 GATTGGGAGGTGAGCGGGGCAGG - Exonic
1181477103 22:23175562-23175584 CTTTGGGAGGCTAGGCGGGCGGG - Intergenic
1181628195 22:24135499-24135521 CTTTGGGATGAGAGGCAGGCAGG - Intronic
1181667271 22:24406921-24406943 CGTTGGGAGCAGAGGGCTGCGGG + Intronic
1181699381 22:24611237-24611259 GATTGGGAGGTGAGCAGGGCAGG + Exonic
1182320157 22:29473598-29473620 CATTGGGAGGCCAGGGTGGGAGG - Intergenic
1182357921 22:29730575-29730597 AAGTGGGAGGACAGGAGGGCAGG - Exonic
1182567589 22:31211931-31211953 CATTAGGAGGAGAGCCGGGATGG - Intergenic
1182602966 22:31481403-31481425 CATTGGGAGGACAAGGTGGGAGG - Intronic
1182661600 22:31929127-31929149 CCTTGGGAGGGCAGGAGGGCAGG - Intergenic
1182705965 22:32280562-32280584 CATAGGGAAGAGAGGGAGGGAGG - Intergenic
1182759010 22:32706937-32706959 CTTGGGGAGGGGAGGTGGGCAGG - Intronic
1182881582 22:33738450-33738472 AGATGGGAGGAGAGGAGGGCAGG + Intronic
1184085311 22:42259036-42259058 AGTTGGGTGGAGAGGGAGGCAGG - Intronic
1184236760 22:43187158-43187180 CGCTGGGAGGAGGGCGGGGCGGG - Intergenic
1184251434 22:43262589-43262611 CATGGGGTGGAGAGAAGGGCAGG - Intronic
1185275854 22:49949970-49949992 CCTTGGCTGGAGAGGGGGGTGGG + Intergenic
1185338812 22:50282672-50282694 TGTGGGGAGCAGAGGGGGGCGGG + Intronic
1185402845 22:50627498-50627520 CATTGGGAGGAAAGGGATGGAGG + Intronic
1203224591 22_KI270731v1_random:70036-70058 GATTGGGAGGTGAGCGGGGCAGG + Intergenic
1203266235 22_KI270734v1_random:16756-16778 GATTGGGAGGTGAGCGGGGCAGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949341206 3:3032912-3032934 CATCGGTAGGAGAGGGTGGCAGG + Intronic
949872738 3:8603122-8603144 CATTTGGAGGAGAAGTGAGCAGG - Intergenic
949943671 3:9173691-9173713 AATGGGGAGGAGAGGTGGGCAGG - Intronic
950119395 3:10471559-10471581 GAGTGGGAGGAGAGGGAGGGAGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950313463 3:11979275-11979297 CTTTGGGAGGAGGGCGAGGCGGG + Intergenic
950453207 3:13077349-13077371 CATGGGGATGGGAGGAGGGCAGG - Intergenic
951022067 3:17791859-17791881 CTTTGGGAGGCCAGGGGAGCAGG - Intronic
951356227 3:21670655-21670677 CATTGGGGGGGGGGGGGGGGGGG - Intronic
951765036 3:26188176-26188198 GGTTGGGTGGAGAGGGGGTCAGG + Intergenic
952392603 3:32893186-32893208 CCTTGGGGGGAGAGGGGGCGGGG - Exonic
952482165 3:33772654-33772676 GATTGGGAGAAGAGGGAAGCAGG + Intergenic
953002667 3:38950067-38950089 CATTGGGCGGGGGGGGGGGGTGG - Intronic
953441806 3:42924810-42924832 AACTGGGAGGAGAGTGGGGTCGG + Intronic
953706024 3:45231088-45231110 CATGGGGGGGGCAGGGGGGCGGG - Intergenic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954390222 3:50264779-50264801 GAGTGGGAGGAGAGGGGGCTGGG - Intergenic
954437835 3:50505212-50505234 CAATGGGAGGGCAGGGGGGCAGG + Intergenic
954443766 3:50535761-50535783 CCTTGGGAGCAGGGGTGGGCTGG - Intergenic
955145839 3:56318418-56318440 CTTTGGGAGGACAAGGTGGCCGG - Intronic
955915717 3:63906037-63906059 ACTTGGGAGGAGAGGAGGACAGG + Intronic
956109416 3:65855610-65855632 GATGGGGAGGAGAGAGGGGAGGG + Intronic
956167197 3:66405772-66405794 CCTTGGGAGGAGATGGGCTCCGG - Intronic
956633537 3:71340134-71340156 CAGTGGGAAAATAGGGGGGCAGG - Intronic
956736728 3:72244201-72244223 TATGTGGAGGAGAGGGAGGCAGG - Intergenic
956848962 3:73210868-73210890 CATTAGGAGCAGAGAGAGGCAGG + Intergenic
957248161 3:77738655-77738677 CATTGGGAGGACAAGGTGGGAGG - Intergenic
957343477 3:78931022-78931044 CAATGGGAGGTGAGAGGAGCAGG - Intronic
957686419 3:83507971-83507993 CATTGGGTGGGGGGGGGGGGCGG + Intergenic
957730608 3:84128855-84128877 CAAAGGGAGGAGCGGGGGACAGG - Intergenic
958632559 3:96701619-96701641 CGCTGGGTGGGGAGGGGGGCGGG - Intergenic
959839707 3:110960140-110960162 CTTGGGGAGGGGAAGGGGGCTGG + Intergenic
959921191 3:111870225-111870247 CATTGGAAGGAGAGAGGATCTGG + Intronic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960602766 3:119474427-119474449 CATGGGGAGGAGAGGGAGACAGG - Intronic
961659976 3:128463449-128463471 CACTGAGAGGAGTGGGGGGAGGG + Exonic
961732653 3:128977916-128977938 TATTGGCAGCAGAGGCGGGCGGG - Intronic
961797768 3:129422040-129422062 CAATGGGAGGTGTTGGGGGCTGG - Intronic
962206917 3:133442396-133442418 CTTTGGGAGGACAGGGTGGGTGG - Intronic
962215041 3:133513821-133513843 CATTGGGAGGCCAAGGGGGGCGG + Intergenic
964107032 3:153050553-153050575 CTTTGGGAGGACAAGGCGGCCGG + Intergenic
965138128 3:164801048-164801070 CATTGGGAGGCCAGGGCGGGCGG - Intergenic
965300301 3:166999209-166999231 CTAAGGGAGGAGAGGGGGCCTGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966399526 3:179534445-179534467 AATTGGGAGGAGAGTGTGGAAGG + Intergenic
966497156 3:180593864-180593886 CATTGGAAGTACAGGGGGGTGGG - Intergenic
966601768 3:181782390-181782412 TGTTGGAAGGAGAGGGGGACAGG - Intergenic
966718422 3:183036914-183036936 CTTTGGGAGGCCAGGGCGGCTGG - Intronic
966754513 3:183355934-183355956 CAAGGGGAGGGGAGGGGGGAAGG - Intronic
967145474 3:186602538-186602560 CATTTGCAGGAGAGTGGGGGTGG - Intergenic
968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG + Intronic
968578150 4:1377439-1377461 CAGTGTGAGGAGGGAGGGGCTGG + Intronic
968607302 4:1541624-1541646 GTTGGGGAGGAGAGTGGGGCGGG - Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
969022460 4:4147481-4147503 CACTGGGGGGGGGGGGGGGCGGG - Intergenic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
969638775 4:8384585-8384607 CATTGGGTGCACAGGGCGGCTGG - Intronic
972284053 4:37631342-37631364 CATTGGGGGCAGAGTGGTGCAGG - Intronic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
973847911 4:54932032-54932054 CATCAGGAGGAGAGGGAGGAGGG - Intergenic
975292153 4:72689406-72689428 CAGTGGGAAAAGAAGGGGGCAGG + Intergenic
975411544 4:74057792-74057814 AAGTGGGAGGAGAGTGGGGAGGG + Intergenic
976178017 4:82373848-82373870 GAGTGGGAGGCGAAGGGGGCAGG - Exonic
976342870 4:83964525-83964547 CATTGGGAGCACTGGTGGGCAGG + Intergenic
977179503 4:93856913-93856935 CATTGGGAGGAGAAGGTAGGTGG + Intergenic
977711033 4:100125834-100125856 CATAGGGAAGAGAGGGGAGAAGG + Intergenic
977890043 4:102299126-102299148 GAGTGGGAGGAGAAGGGGACTGG - Intronic
978713057 4:111808913-111808935 CATTGTGGGGGGAGGGGGGAAGG + Intergenic
978837090 4:113163978-113164000 CATGGGGAGGACAAGGGGGAGGG - Intronic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
981113088 4:140958234-140958256 CATGGGTAGGAGGGGGGTGCTGG + Intronic
981282024 4:142969431-142969453 TATTGGAAGGAGAGGGGGATGGG - Intergenic
981437399 4:144741623-144741645 CTTTGGGAGGCCTGGGGGGCTGG - Exonic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982289004 4:153760976-153760998 CTTTGGGAGGACAGGGCGGGCGG + Intergenic
983919790 4:173333782-173333804 CCTCGGGAGGAGGGGGGCGCGGG - Intronic
985362786 4:189193148-189193170 CTTTGGGAGGAGAAGGAGGGTGG - Intergenic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985705877 5:1401092-1401114 CATTGGCAGGTGAGGAGGGCTGG - Intronic
985813706 5:2110999-2111021 CATGGGTGGGAGAGAGGGGCTGG + Intergenic
986169174 5:5301942-5301964 CAAGGGGATGAGAGGGGAGCTGG - Intronic
986387497 5:7248892-7248914 TACTGGAAGGTGAGGGGGGCTGG - Intergenic
986662887 5:10074860-10074882 GAATGGGAGGTGAGGGAGGCAGG + Intergenic
986671771 5:10148897-10148919 CATCAGGAGGAAAGGGGGGGAGG + Intergenic
986723712 5:10578582-10578604 CATGGGGTGGAGGGTGGGGCTGG + Intronic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
989523060 5:42423690-42423712 CTTGGGGAGGAGAGAGGGGGCGG - Intergenic
990687081 5:58316641-58316663 CATTGGCTGGAGTAGGGGGCAGG + Intergenic
990884882 5:60580033-60580055 CTTTGGGAGGAGAAGAGGGTAGG - Intergenic
991613997 5:68477096-68477118 CATAGGGAGGAGAGGGAGAAAGG - Intergenic
991947202 5:71910716-71910738 TCATGGGAGGAGAGAGGGGCTGG + Intergenic
992295343 5:75321826-75321848 CTATGGGTGGAGTGGGGGGCGGG + Intergenic
992508800 5:77413488-77413510 TATTTGGAGGAGGGGAGGGCTGG - Intronic
992588903 5:78272770-78272792 CATGGGGAGCAAAGGGGGACAGG + Intronic
993265479 5:85721609-85721631 TGTTGGGAGGTGGGGGGGGCGGG + Intergenic
993713738 5:91253606-91253628 CTTTGGGAGGACAGGGTGGGAGG + Intergenic
994411111 5:99408541-99408563 CATTTGGATGAGAGGAGTGCTGG + Intergenic
994482720 5:100356733-100356755 CATTTGGATGAGAGGAGTGCTGG - Intergenic
995831479 5:116360188-116360210 CATTTGGCTGAGATGGGGGCAGG + Intronic
996360617 5:122641438-122641460 TGTGGGGAGGGGAGGGGGGCGGG - Intergenic
996804677 5:127441245-127441267 CATTCGGTGGGGAGGAGGGCTGG + Intronic
996970907 5:129366989-129367011 CTTTGGGAGGCGAGGCGAGCGGG + Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
997952512 5:138253397-138253419 CATTGGAAGGGTATGGGGGCAGG + Intronic
998453640 5:142253705-142253727 CTTTGGGAGGCCAAGGGGGCCGG - Intergenic
999267401 5:150275909-150275931 CTCAGGGAGGGGAGGGGGGCTGG - Intronic
999304442 5:150510516-150510538 CCTTGGGACGGGAGGGTGGCAGG + Intronic
999895573 5:156029973-156029995 AATTGGGAGGTGAGGGAGGTAGG - Intronic
1000723245 5:164734868-164734890 CTTTGGGAGGCCAGGGTGGCTGG - Intergenic
1001284930 5:170415972-170415994 GCTGGGGAGGAGAGGGGAGCGGG + Intronic
1002591378 5:180293149-180293171 CTCTGAGAGGAGTGGGGGGCGGG + Intergenic
1002640036 5:180626346-180626368 AGTTGGGAGGAGGGAGGGGCTGG + Intronic
1003843434 6:10147024-10147046 GAGTGGGAGGAGATGGGGGATGG - Intronic
1003908470 6:10722993-10723015 CAGCGGGTGGAGAGTGGGGCGGG - Exonic
1004379390 6:15119184-15119206 CATTGAGAAGTGAGGTGGGCTGG - Intergenic
1004387744 6:15187154-15187176 CATTGGGAGGTGAGGTGAGTAGG + Intergenic
1004716690 6:18223337-18223359 GATTGGGGGGGGCGGGGGGCGGG - Exonic
1004990893 6:21137090-21137112 TATTGGGAGGAGAAGGGGGTTGG + Intronic
1005283780 6:24302772-24302794 CTGTGGGAGGAGTGGAGGGCTGG - Intronic
1005357358 6:24997329-24997351 CATTTGGAGGGGAGGTGGGGTGG + Intronic
1005677760 6:28173197-28173219 CATTGGGAGGACAGGGCAGGAGG + Intergenic
1005726770 6:28656928-28656950 CATTAGGAGCAGAGTGGGGACGG + Intergenic
1006116440 6:31778371-31778393 CATGGGGAGCAGCTGGGGGCTGG - Intronic
1006172819 6:32104878-32104900 CATTGGGAGGCTAGGGTGGGAGG - Intronic
1006611471 6:35296810-35296832 CCTTGGGAAGAGAGGGGCGGGGG + Intergenic
1006835829 6:36998382-36998404 CTAGGGGAGGAGAGGGGGCCTGG - Intergenic
1006931912 6:37693782-37693804 GATTGGGAGGCGAGGAGGGAGGG + Intronic
1007717887 6:43867816-43867838 CATTGGGAGAAAAGGAGGGAGGG - Intergenic
1008019343 6:46558510-46558532 CATTTGGAGGAGGAGGGGCCTGG - Intronic
1009690942 6:67031246-67031268 CATTGAGAGGTGAAGCGGGCTGG + Intergenic
1009826308 6:68869759-68869781 TATTTGCAGGGGAGGGGGGCGGG + Intronic
1010806441 6:80242730-80242752 CATGGGGAGGAGTGTGGTGCTGG + Intronic
1011421387 6:87176997-87177019 TGTGGGGAGGAGTGGGGGGCCGG - Intronic
1012626040 6:101403708-101403730 CTTTGAGAGGTGAGGTGGGCGGG + Intronic
1012995998 6:105975476-105975498 CAATGGGCTGAGAGGGAGGCAGG + Intergenic
1013346093 6:109262180-109262202 CTCTGGGAGCAGAGAGGGGCAGG - Intergenic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1014682273 6:124446584-124446606 CTTTGGGAGGACAAGGTGGCAGG - Intronic
1015374371 6:132492913-132492935 GCATGGGAGGAGAGTGGGGCAGG - Intronic
1016286648 6:142481170-142481192 TCTGGGGAGGAGAGGGAGGCTGG + Intergenic
1016300422 6:142624426-142624448 GATTGGGAGGGGCGGGGGGGCGG - Intergenic
1017065038 6:150520623-150520645 GATTGGGAGGAGAGGGTGCCAGG - Intergenic
1017809433 6:157974365-157974387 CATGGGGAGGAGCAGGTGGCTGG - Intergenic
1017869420 6:158474249-158474271 CAAAGGGTGGAGAGGGAGGCTGG + Intronic
1018314491 6:162543358-162543380 AACTGGGAGGAGAAGTGGGCGGG - Intronic
1018426486 6:163687693-163687715 CATGGGGAGGACAGGGCTGCTGG - Intergenic
1018839483 6:167508002-167508024 GATGGGGAGGAGAGGGGATCGGG - Intergenic
1019299536 7:296325-296347 AATTGGGGGTAGAGAGGGGCTGG - Intergenic
1019404546 7:876834-876856 CAATGGGAGGCGGCGGGGGCGGG - Intronic
1019557739 7:1641078-1641100 CATGGAGGGGAGAGGTGGGCTGG - Intergenic
1019738170 7:2660567-2660589 CAAGGGGAGGGGATGGGGGCGGG - Intronic
1020111982 7:5452467-5452489 GGAGGGGAGGAGAGGGGGGCAGG - Intronic
1021268761 7:18558952-18558974 CATTGGGAAGTGAGGGGAACAGG + Intronic
1021272516 7:18608286-18608308 GAGTGGGAGGGGAGGGGGACTGG + Intronic
1021625310 7:22587176-22587198 GATTGGGAGGAGAGGGGCCCAGG - Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021960117 7:25862516-25862538 AATTGGGCGGAGCCGGGGGCGGG - Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1023764726 7:43499974-43499996 CATTGGGCACAGAGGGGGCCCGG - Intronic
1023851282 7:44151816-44151838 CATGGGGAGGACTGGGGTGCAGG - Intronic
1023861829 7:44221319-44221341 GCTCGGGAGGAGAGTGGGGCCGG - Intronic
1023871378 7:44264715-44264737 CAGTGGGAGGGGAGAGGGGAGGG - Intronic
1023910497 7:44552208-44552230 CTTTGGGAGGCCAAGGGGGCAGG + Intergenic
1024228309 7:47345195-47345217 CATGGCTAGGAGAGGCGGGCTGG - Intronic
1024337975 7:48228468-48228490 CATTGGCAGGAGTGTGGGGTGGG + Intronic
1024914616 7:54485298-54485320 CCTTGGGAGGAGGTGGGGGTGGG - Intergenic
1025953296 7:66163052-66163074 CTTTGGGAGGCTAGGCGGGCAGG + Intergenic
1026018670 7:66692316-66692338 CATGGGTAAGAGAGGGAGGCAGG - Intronic
1026881732 7:73910382-73910404 CATGGGTAAGAGAGGGAGGCAGG + Intergenic
1026909280 7:74083337-74083359 CTTGGGGAGGGGAGGGAGGCGGG - Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1029080962 7:97973526-97973548 AATCAGGCGGAGAGGGGGGCGGG - Intergenic
1029550733 7:101235914-101235936 CACAGGCAGGAGAGGGGAGCCGG - Intronic
1029657602 7:101937219-101937241 CAGGGGGAGGAGCTGGGGGCTGG - Intronic
1030024927 7:105314086-105314108 CTTTGGGAGGCGAGGCTGGCCGG + Intronic
1030268275 7:107643165-107643187 GATTGGAAGGAGAGAGGGTCTGG - Intergenic
1030966137 7:115995195-115995217 CATGGGGTGGGGAGGGGGGAGGG + Intronic
1031011302 7:116526880-116526902 TATTGGGGGGAGATGGGGGAAGG - Intronic
1031047051 7:116902954-116902976 CTTTGGGAGGCCAAGGGGGCAGG - Intronic
1031142168 7:117955043-117955065 TATTTGGAGCTGAGGGGGGCTGG + Intergenic
1031361542 7:120854844-120854866 TATTGGGAGAAGAGGAGGGCTGG + Intronic
1031680522 7:124667900-124667922 CTTTGGGAGGGGAGAGGAGCAGG - Intergenic
1032797406 7:135288909-135288931 GACAGGGAGGAGAGGGAGGCAGG + Intergenic
1033740889 7:144274966-144274988 CATGGGGAGGAGGGTGGGACTGG - Intergenic
1033753017 7:144374647-144374669 CATGGGGAGGAGGGTGGGACTGG + Intronic
1033916138 7:146328694-146328716 GATTAGGAGGAGCTGGGGGCTGG - Intronic
1033928395 7:146492204-146492226 GGTTGAGAGAAGAGGGGGGCAGG + Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034146042 7:148872955-148872977 CTTTGGGAGGACAAGGTGGCAGG + Intronic
1034524423 7:151648106-151648128 CATTTGGCGGAGAGGAGGGGTGG + Intronic
1035026836 7:155831726-155831748 CAGTGGGAGGAGCGCGGGGTCGG + Intergenic
1036122838 8:6036696-6036718 CATTGTGAGAAGAGGAGAGCGGG - Intergenic
1036163720 8:6411810-6411832 CACTGGGAGGGGTTGGGGGCGGG + Intronic
1037773817 8:21819557-21819579 CTTTGGGAGGCCAGGGAGGCAGG - Intergenic
1038209058 8:25498461-25498483 CTTTGGGAGGCCTGGGGGGCGGG - Intronic
1038409831 8:27349521-27349543 CATTGGCAGGAATGCGGGGCAGG + Intronic
1038497411 8:28013360-28013382 CATGGGGAAGAGAGAGGGGGAGG + Intergenic
1039485624 8:37907559-37907581 CTTTTGGAGGGGAGGGGGACTGG - Intergenic
1039516994 8:38142471-38142493 CATTGGGATGGGAGGGGGGTAGG - Intronic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1040356713 8:46625481-46625503 TCCTGGGAGGAGAGTGGGGCTGG + Intergenic
1040440847 8:47440415-47440437 CTTTGGGAGGAGCTGGTGGCTGG - Exonic
1040981705 8:53251561-53251583 CCTCGGGCGGAGAGCGGGGCCGG - Exonic
1041170405 8:55136133-55136155 CTTTGGGAGGCGAAGGGGGGCGG - Intronic
1041320555 8:56607902-56607924 GAGTGGGAGGAGAGGAGGCCTGG + Intergenic
1041719981 8:60966852-60966874 CATTGGGTGGAGAGAGAGGAAGG + Intergenic
1043401250 8:79886574-79886596 CATTGAGAGGAGAGAGAGGTGGG + Intergenic
1043509935 8:80940253-80940275 CTTTGGGAGGCCAAGGGGGCTGG - Intergenic
1044473263 8:92597155-92597177 CACTGGAAGGAGAGGGAGGGAGG + Intergenic
1044649515 8:94479908-94479930 TAATGGGAGAAGAGAGGGGCAGG - Intergenic
1044664551 8:94622149-94622171 CTTTGGGAGGCTAGGGTGGCTGG - Intergenic
1044681961 8:94788667-94788689 CATTGGAAGGCCATGGGGGCTGG - Intronic
1045219579 8:100185389-100185411 AATTGGGAGGTGAGGTGGGTGGG - Intronic
1045383301 8:101647873-101647895 GATTGGGAGGAGGGGGAGGAGGG + Intronic
1045732925 8:105263136-105263158 CATTGTGAGGAGGGGGCGGTGGG + Intronic
1045839982 8:106568412-106568434 TATTGGGAGGAGAGGATGGAAGG - Intronic
1045857082 8:106776896-106776918 CTTTGGGAGGCGAGGTGGGTGGG - Intergenic
1047389902 8:124441789-124441811 CTTTGGGAGGCCAGGGAGGCTGG + Intergenic
1047499724 8:125431604-125431626 CATTGGCGGGGGAGGGGGGGTGG - Intronic
1048327871 8:133452783-133452805 CATTGGGAGGACAAGCGGGGAGG + Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1048648768 8:136451316-136451338 CATTGATACGAGAGGGGGGCAGG - Intergenic
1048681477 8:136846243-136846265 CCTTGGGAGTAGAGGGGAGAGGG + Intergenic
1048696272 8:137031659-137031681 AATTAGGAGGAGAAGGGGGAGGG - Intergenic
1048888909 8:138931081-138931103 CCTTGGGAGGGGCGGGGAGCAGG - Intergenic
1049170481 8:141157621-141157643 CATTGGGAGGAGTGGGAAGGAGG + Intronic
1049292344 8:141811060-141811082 CATAGGGAGGGCAGAGGGGCTGG + Intergenic
1049594661 8:143477798-143477820 CATTGGGAGGGTGAGGGGGCTGG + Intronic
1049604552 8:143523220-143523242 CAGTGGGAGGTGTGGGGGCCAGG - Intronic
1049718719 8:144105758-144105780 CATTGGCAGGTGAGGCAGGCTGG + Exonic
1049797815 8:144504583-144504605 CCCTGGGAGGGGAGGGGAGCAGG - Exonic
1049855864 8:144861510-144861532 CTTTGGTAGGAGAGGGGAGGAGG + Intergenic
1050531280 9:6591832-6591854 CTTTGGGAGGTCAGGGGGGCGGG - Intronic
1051159910 9:14195847-14195869 CATTGGGAGGAAAAAGGGGGTGG + Intronic
1051631304 9:19143574-19143596 CTTTGGGAGGAGTGGGGGGGCGG - Intronic
1052026441 9:23578104-23578126 CTTTTGGAGGAGAGGGGAGGTGG - Intergenic
1054457138 9:65438876-65438898 CATTGGGCAGAGAGTGGGGATGG - Intergenic
1055161632 9:73136144-73136166 CTTTGGGAGGACAAGGGGGAAGG + Intergenic
1055359236 9:75471609-75471631 CATTTGGAAGAGAGAAGGGCTGG + Intergenic
1055442934 9:76354272-76354294 CAATGGGAGCAGAGGGAGGGGGG + Intronic
1056097217 9:83267299-83267321 CATTGGGAGGGGAGGAGGGAGGG + Intronic
1056579716 9:87882097-87882119 CTTTGGGTGGAGAGCGGGACTGG - Intergenic
1056681258 9:88721134-88721156 CTGGGGGAGGAGAGTGGGGCTGG - Intergenic
1057353633 9:94318944-94318966 CCTGGGGAGGAGAGGTTGGCCGG + Exonic
1057440118 9:95077047-95077069 CCTGGGGAGGAGAGGGGGAGGGG + Intronic
1057654118 9:96938648-96938670 CCTGGGGAGGAGAGGTTGGCCGG - Exonic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1058691751 9:107526014-107526036 CATTGGGAGGATGAGGGGGAAGG - Intergenic
1059433644 9:114264224-114264246 AAGTGGGAGGAGGAGGGGGCCGG + Intronic
1059693648 9:116710170-116710192 GATTGGGAGGTGAGGGGTGTAGG - Intronic
1059786991 9:117596901-117596923 TAGTGGGAGGAGAGGGGAGGGGG - Intergenic
1061208899 9:129179395-129179417 CAGTGGGAGAAGAGAGGGACAGG + Intergenic
1061273922 9:129558732-129558754 GATGGGCAGGGGAGGGGGGCGGG - Intergenic
1061449208 9:130659611-130659633 CATTGGGAGGGGACAGGGGTGGG + Intergenic
1061773269 9:132944314-132944336 CCTGGGGAGGAGAGGCGAGCCGG - Intronic
1061930311 9:133828991-133829013 CTGTGGGAGCAGAGTGGGGCTGG - Intronic
1062081914 9:134628629-134628651 CACTGGGAGAAGAGGAGGGCTGG - Intergenic
1062660226 9:137627199-137627221 CTTTGGGAGGCAAGGGGGGTGGG - Intronic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185877811 X:3713885-3713907 GATGGGGAGGCGAGGGGGCCCGG + Intergenic
1186341799 X:8653477-8653499 AATTGGGAGGAGAGAGGTCCAGG - Intronic
1186349620 X:8729282-8729304 CATTTGCAGGAGTTGGGGGCGGG + Intronic
1186766194 X:12773011-12773033 CCTTGGGAGGGAAGGGGGTCTGG + Intergenic
1186785359 X:12951965-12951987 CATGGGGAGAAGAGGAGGCCTGG - Intergenic
1187435993 X:19269676-19269698 CTTTGGGAGGCGAGGGAGGGTGG - Intergenic
1187865410 X:23719024-23719046 CTTTGGGAGGCGAGGGCGGGTGG + Intronic
1188307171 X:28572397-28572419 CCTGGAGAGGAGAGGGGGCCAGG + Intergenic
1189225126 X:39406525-39406547 CACAGGGAGGAGAGGTGGTCAGG + Intergenic
1190408311 X:50109925-50109947 CATGGGGTGGGGAGGGGGGAGGG - Intergenic
1190911322 X:54774852-54774874 GAAGGGGAGGGGAGGGGGGCTGG + Intronic
1192177594 X:68895515-68895537 CAGTGGGAGGGGAGTGGGACAGG + Intergenic
1192639486 X:72848293-72848315 CCTGGGGCGGAGAGAGGGGCTGG - Exonic
1192642225 X:72872512-72872534 CCTGGGGCGGAGAGAGGGGCTGG + Exonic
1192749200 X:73970801-73970823 CTTTGGGAGGCGGGGGGGGGGGG - Intergenic
1194072532 X:89344675-89344697 TACTGGGAAGAGAGGGTGGCTGG - Intergenic
1195086496 X:101418512-101418534 CATTAGGAGGAGGGGGAGGGCGG + Intronic
1195697302 X:107676620-107676642 CAGTGGGATGAGGGGTGGGCAGG - Intergenic
1195750914 X:108161582-108161604 CATTAGGAGGCGGGCGGGGCGGG - Intronic
1196085033 X:111675412-111675434 CATTGGGAGGCCAAGGGGGGAGG + Intronic
1196331910 X:114480969-114480991 CTTTGGGAGGCCAAGGGGGCTGG - Intergenic
1197744709 X:129924213-129924235 CTTTGGGAGGCCAAGGGGGCAGG - Intronic
1198314629 X:135453169-135453191 CATGGGGCAGAGAGGGAGGCAGG - Intergenic
1198722494 X:139637868-139637890 CATTAGGATAAGAGGGAGGCAGG + Intronic
1199600840 X:149540308-149540330 CACTGGGAGGGGCTGGGGGCGGG - Intergenic
1199649470 X:149938842-149938864 AATGGGGAGGGGATGGGGGCGGG + Intergenic
1200726770 Y:6680422-6680444 TACTGGGAAGAGAGGGTGGCTGG - Intergenic
1200727922 Y:6696198-6696220 TACTGGGAAGAGAGGGTGGCTGG - Intergenic