ID: 946132047

View in Genome Browser
Species Human (GRCh38)
Location 2:217614024-217614046
Sequence CTTGACAGTGATGTGGTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946132043_946132047 -9 Left 946132043 2:217614010-217614032 CCACAAGCTGAGAACTTGACAGT 0: 1
1: 0
2: 0
3: 18
4: 154
Right 946132047 2:217614024-217614046 CTTGACAGTGATGTGGTATGGGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946132047 Original CRISPR CTTGACAGTGATGTGGTATG GGG Intronic
902168028 1:14588208-14588230 CTTGAAAGTGCTGTGGGAAGGGG - Intergenic
906725599 1:48041932-48041954 CTGGCCAGTGATGTGGTGGGTGG + Intergenic
910235666 1:85033638-85033660 CATGATAGTGAAGTGGTATTGGG + Intronic
912311694 1:108628308-108628330 CTTGAAACTGCTGTGGTGTGGGG + Intronic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
913287666 1:117241457-117241479 CTTGAGAGTGATGGGACATGGGG - Intergenic
913678640 1:121166672-121166694 CATGACACTAATGTGGTTTGAGG - Intergenic
914444779 1:147740653-147740675 CAAGACAGGGCTGTGGTATGTGG + Intergenic
914827108 1:151144479-151144501 CTTGTAAGGGATGTGGTAAGGGG - Intronic
915239462 1:154509813-154509835 CTTGACAGTGAAGTGGGCAGAGG + Intronic
916437547 1:164790971-164790993 CTTGACTGTGCTCTGGTGTGTGG + Intronic
916933206 1:169600921-169600943 CTTGACAGTGAGTGGGGATGGGG + Intronic
920735304 1:208527970-208527992 CTTACCAGGCATGTGGTATGGGG + Intergenic
922697342 1:227737315-227737337 CTTGACAGGGAGGTGGAAGGAGG + Intronic
923012404 1:230098863-230098885 GTTGACCATGATGTGTTATGAGG + Intronic
1062826857 10:576290-576312 CTCGAGTGTGATGTGGTCTGTGG - Intronic
1063902287 10:10746844-10746866 TTTAGCAGTGATGTGGTATTAGG - Intergenic
1065937057 10:30529882-30529904 CTTGACAGTGATCGGATGTGCGG + Intergenic
1066791676 10:39071824-39071846 TTTGAAATTGATGTGATATGTGG + Intergenic
1067300660 10:45005885-45005907 CTTCACTGTGTTGGGGTATGTGG + Intergenic
1067345076 10:45431908-45431930 CTTAACAGTGATTTGATATTGGG + Intronic
1067756315 10:49008448-49008470 CTGGACAATGTTGTGGTTTGGGG + Intergenic
1070363236 10:75711273-75711295 CTTAGCAGTGGTGTGGTTTGGGG + Intronic
1070806077 10:79271511-79271533 CTTCACAGTGTTCTGGGATGCGG + Intronic
1072324788 10:94287504-94287526 CTCAACAATCATGTGGTATGAGG + Intronic
1073368629 10:102966855-102966877 CTTGGGAGTGAGGTGGGATGAGG + Intronic
1076107575 10:127835446-127835468 CTGGACAATGCTGTGTTATGGGG + Intergenic
1077695667 11:4390370-4390392 CTTGACAATGATGTGGGAGGAGG - Exonic
1081415945 11:42816352-42816374 ATTGACATTGTTGTGATATGGGG + Intergenic
1084162479 11:67357253-67357275 CTTGTCAGTGGGGTGGTGTGGGG - Intronic
1084348017 11:68569955-68569977 CTTGACTGTGATGTGAATTGAGG + Intronic
1089698353 11:120229279-120229301 CTTCACAGTCATGTGAGATGGGG - Exonic
1090924389 11:131236729-131236751 TTTGACAGTAATGTGTTCTGGGG - Intergenic
1091125425 11:133091376-133091398 CTGTACAGTTCTGTGGTATGGGG - Intronic
1093143025 12:15532411-15532433 TTTGAAAGTCATGTGGGATGTGG + Intronic
1098047363 12:66414249-66414271 CTGCACAGTGATTTTGTATGTGG - Intronic
1101880646 12:108623354-108623376 CTTCACAGAGATGTGGTCTGGGG + Exonic
1105826894 13:24130729-24130751 CTTCACAGTCATCTGGTAAGTGG - Intronic
1106964479 13:35044977-35044999 CTTGACAGTGATGCTGTAGCTGG - Exonic
1112513997 13:100036079-100036101 TTTGACAGGGATGTGTTCTGAGG + Intergenic
1115546527 14:34469345-34469367 CTTGAGAGTGAGGTTGTATGGGG - Intergenic
1116861701 14:50000782-50000804 GTGGACAGGGATGTGGGATGGGG + Intronic
1117836042 14:59807187-59807209 GGTGACAGTGAGGTGGCATGTGG + Intronic
1120872289 14:89348384-89348406 CTTAACAGTGATGTGGCATTTGG - Intronic
1122309672 14:100786431-100786453 CATGCCAGGGATGTGGGATGGGG + Intergenic
1123865988 15:24519830-24519852 CTTGAGGGTGATCTGTTATGGGG + Intergenic
1124074624 15:26433187-26433209 CTTGACTGTGATGAGGACTGTGG - Intergenic
1125615678 15:41010148-41010170 CATGCCACTGATGTGGTGTGTGG - Intronic
1126098171 15:45103952-45103974 CTTCACCATGATGCGGTATGGGG - Exonic
1129981277 15:79873465-79873487 TTTTTCAGGGATGTGGTATGTGG - Intronic
1130378775 15:83354442-83354464 CTTTACAGTTAAGTGGTATTAGG + Intergenic
1133238333 16:4400033-4400055 CTTGGCAGTGATCTGGGAGGAGG + Intronic
1139884490 16:70198719-70198741 CTGGACAGAGATGGGGTCTGGGG - Intergenic
1140055805 16:71524658-71524680 CTTCCCAGTGCTGTGGAATGTGG + Intronic
1140368027 16:74396773-74396795 CTGGACAGAGATGGGGTCTGGGG + Intergenic
1140482553 16:75269615-75269637 CTTGACAGTTTTGAGGTGTGCGG + Intergenic
1141681239 16:85545167-85545189 CTTCACAGGGATGAGCTATGTGG + Intergenic
1147176542 17:38659372-38659394 CTTGCCAGGGATGTGGGAAGGGG - Intergenic
1152516025 17:80825378-80825400 CTAGACAGAGATGTGGGATGTGG - Intronic
1153209194 18:2741043-2741065 CTTCAAAATGATATGGTATGGGG - Intronic
1153220585 18:2857435-2857457 CTTGACAGGGATGTTGTGAGAGG + Intronic
1153803337 18:8690604-8690626 CTTAACAGTGTTATGGTGTGGGG + Intergenic
1155216302 18:23646110-23646132 CATGATAGTGAACTGGTATGGGG - Intronic
1155582549 18:27325615-27325637 TTTGACTGTGATGTGTTTTGGGG - Intergenic
1157285274 18:46373343-46373365 CTTGACAGTCATCTGGAAGGCGG + Intronic
1157627027 18:49059647-49059669 CTACACAGTGTGGTGGTATGAGG + Intronic
1159382301 18:67676038-67676060 TTTGCCAGTAATGTGGGATGTGG + Intergenic
1160555312 18:79720845-79720867 CTGGACAGTGAGGTGGCCTGGGG - Intronic
1162689678 19:12418811-12418833 CATGACAATCATGTGGAATGGGG - Intronic
1166300666 19:41910400-41910422 CATGACAGTGAGGAGGAATGGGG + Intronic
1166878913 19:45914895-45914917 CTTCACAGAGATGTGGAAGGAGG + Intergenic
1167493233 19:49803558-49803580 GATGACAGTGAAGTGGTGTGTGG + Intronic
1168711270 19:58501321-58501343 CGTGACAGTGATCCTGTATGTGG - Exonic
926470878 2:13256308-13256330 CTTGGCAGAGATGTGGTAGAAGG + Intergenic
926470946 2:13257259-13257281 CATTACTGTGATGTGGGATGTGG - Intergenic
926951136 2:18244881-18244903 CTTGACATTCATTTGGGATGTGG + Intronic
927760996 2:25753762-25753784 CTTTACAGTGAGGAGGTTTGAGG - Intronic
928304015 2:30150857-30150879 CTTTACAATGAAGAGGTATGAGG - Intronic
929246586 2:39709300-39709322 ATTGGCAGTGATCTGGAATGTGG + Intronic
930597164 2:53402945-53402967 GAAGAGAGTGATGTGGTATGAGG + Intergenic
936286626 2:111186330-111186352 GTTGACAGTGATGATGTAAGAGG + Intergenic
937306657 2:120875789-120875811 GATGACAGTGATGGGGGATGAGG + Intronic
943886289 2:193220833-193220855 CTTGAGAGTTAAATGGTATGTGG + Intergenic
946132047 2:217614024-217614046 CTTGACAGTGATGTGGTATGGGG + Intronic
1169089342 20:2848630-2848652 CTTGTGAGTGATGGGGTATAGGG + Intronic
1169296432 20:4403919-4403941 CTTGACATTGATGTTTTGTGTGG + Intergenic
1170663750 20:18367018-18367040 ATTGAGAGTGATCAGGTATGAGG + Intergenic
1177640091 21:23834565-23834587 CTTGACGGTGAGGTTTTATGGGG - Intergenic
1177818913 21:26009899-26009921 CTTTACAGAGAAGTGGTATAAGG - Intronic
1182231240 22:28838990-28839012 CTTCATAGTGATGTGGTGGGTGG - Intergenic
1182964544 22:34508866-34508888 CTTGGGAGGGATGTGGTAGGAGG + Intergenic
1184320385 22:43737260-43737282 TGTGACAGTGATGATGTATGGGG - Intronic
950175924 3:10874370-10874392 CTAGCCTGTGATGAGGTATGAGG + Intronic
950654963 3:14430881-14430903 CTTGTCACTGATCTGCTATGTGG + Intronic
951450774 3:22836022-22836044 CTTGGTAATGATGTGGTAGGAGG - Intergenic
954127856 3:48542593-48542615 CTTCAAGGTGATGTGGTTTGTGG - Intronic
955111198 3:55951708-55951730 CCTGGCAATGCTGTGGTATGGGG - Intronic
955226369 3:57063608-57063630 CTTAACAGAGATGTGGGAAGAGG + Intronic
960483177 3:118218463-118218485 CTTCTAGGTGATGTGGTATGTGG - Intergenic
960848410 3:122026376-122026398 TTTGACAGTTATGTAGAATGTGG + Intergenic
961703324 3:128764242-128764264 CAGGACAGAAATGTGGTATGTGG - Intronic
962969533 3:140385964-140385986 CTGGACAGTGATCTGCTCTGAGG + Intronic
969561360 4:7950363-7950385 CCTCACAGTGATGTGGAACGGGG - Intergenic
969561385 4:7950446-7950468 CCTCACAGTGATGTGGAATGGGG - Intergenic
969561410 4:7950529-7950551 CCTCACAGTGATGTGGAACGGGG - Intergenic
969876194 4:10137253-10137275 GTTCACAGTGAGGTGGGATGTGG - Intergenic
971344350 4:25798395-25798417 CATGAAAGTGATGTGGGGTGTGG - Intronic
976416790 4:84785380-84785402 CTTGACAGGGATGAGGTAACAGG - Intronic
978573439 4:110165016-110165038 CCTGAATGTAATGTGGTATGTGG + Intronic
984640295 4:182157512-182157534 CTTGACATTGATGTAGAGTGAGG - Intronic
988631901 5:32940419-32940441 CTTGACTATGATGTGGTGAGAGG - Intergenic
989071502 5:37516665-37516687 CTTGGCAGTAATGTAGTAAGTGG + Intronic
989375873 5:40759509-40759531 ATTTACAGTTATGTTGTATGTGG + Intronic
990251391 5:53919086-53919108 CTTGATAGGGAGGTGTTATGAGG - Intronic
990747717 5:58977960-58977982 CTTCACAGTGATGTTGTGTTTGG + Intronic
991589909 5:68239772-68239794 CTTGCCAGTGACGTGTGATGCGG + Intronic
994077944 5:95674322-95674344 CCTGAGAGTGGTGTGGAATGAGG - Intronic
995992273 5:118255148-118255170 CTTGCCATCCATGTGGTATGTGG - Intergenic
999056188 5:148579818-148579840 TTTGAGAGTGATTTGATATGTGG - Intronic
1000157868 5:158569540-158569562 GTTGACCCTGATGTGGAATGTGG + Intergenic
1000900788 5:166909463-166909485 CTTGACAGTGATATAGGATGAGG - Intergenic
1002360112 5:178663694-178663716 CCTGACAGTGATGTGGATTCAGG + Intergenic
1004493103 6:16136253-16136275 CATGACAGAGGTGTGGTGTGCGG - Intronic
1006341085 6:33447497-33447519 CTTCACAGTGAGGTGACATGGGG + Intronic
1006429727 6:33988234-33988256 CTGGACAGTGGGGTGGTAGGTGG + Intergenic
1007279090 6:40697139-40697161 CTTGAAAGTGATGTGATACCTGG - Intergenic
1008519056 6:52345438-52345460 ATTGTCAGTGCTGTGGTGTGAGG + Intergenic
1009906059 6:69870899-69870921 TTTGACAGAGATTTGATATGGGG + Intronic
1010808440 6:80267204-80267226 CTATACAGTGCTGTGCTATGAGG + Intronic
1011089745 6:83583859-83583881 ATTGACAGTGATGTGGGTTTAGG + Intronic
1011764507 6:90605743-90605765 ATTGACAGGGAAGGGGTATGAGG - Intergenic
1012075288 6:94675014-94675036 TTTGATAGTGCTGTGGTCTGAGG - Intergenic
1013539094 6:111089548-111089570 ATTGAAACTGCTGTGGTATGCGG + Intronic
1014959280 6:127662369-127662391 ATTTACAGTGATGTGGTATTAGG + Intergenic
1016914344 6:149230960-149230982 CATGAGAGAGATGTGCTATGGGG + Intronic
1017412845 6:154187239-154187261 CTGGACAGAGGTGGGGTATGGGG - Intronic
1019392152 7:794689-794711 CAGGACAGAGATGTGGGATGCGG + Intergenic
1023052216 7:36262933-36262955 CTTGACAGTCCTGGTGTATGGGG + Intronic
1024167809 7:46752024-46752046 TTTGAGAGTGAATTGGTATGTGG + Intronic
1029359369 7:100077290-100077312 CTTGACAGTGGTGAGGAATAAGG - Exonic
1029610084 7:101622184-101622206 CTTGACATTGATGCGGCCTGTGG + Exonic
1030078623 7:105758324-105758346 CTTCTCAGAGAGGTGGTATGAGG - Intronic
1032874414 7:136022263-136022285 CTGGACAGGGATGTGGGAAGTGG + Intergenic
1033510693 7:142057454-142057476 GGTGACAGTGAGGTGGTGTGAGG + Intronic
1035422539 7:158741606-158741628 CTTGACTGAGATGTGGCCTGGGG + Exonic
1038099397 8:24356087-24356109 CTTGACAGTGATTTGATCAGTGG - Exonic
1041408750 8:57530405-57530427 CTTAACAGTGTTGTAGTTTGAGG - Intergenic
1047207222 8:122812305-122812327 TTTCAGAGTGATGTGTTATGTGG + Intronic
1047306163 8:123654674-123654696 GATGATAGTGATGTGGTAGGAGG + Intergenic
1048202173 8:132383519-132383541 CTTGACACTGAGATGGTTTGGGG + Intronic
1060005426 9:119995161-119995183 GTTGAAAGTGATGTGGAGTGAGG - Intergenic
1060654981 9:125365286-125365308 CTTGACAGGTATGTGAGATGGGG + Intronic
1188934610 X:36158610-36158632 CTGGATTGTGATGAGGTATGAGG - Intergenic
1190787430 X:53665188-53665210 CTTGAGAGTCATGTTTTATGTGG - Intronic
1192444469 X:71200367-71200389 CTTGAGGATGATGAGGTATGAGG + Intergenic
1195055695 X:101142456-101142478 TTTGACAGTGATATGGCATATGG - Intronic
1195139697 X:101947012-101947034 CATCACAGTGATGTTGAATGAGG + Intergenic
1197778911 X:130140243-130140265 CTTGAAAGTGATGTCGTTTGTGG - Intronic
1198203192 X:134442308-134442330 CTTGAAACAGATGTGGGATGGGG - Intergenic
1198573381 X:137983119-137983141 CTTGACAGTGACTTGGGTTGGGG - Intergenic
1199137044 X:144265917-144265939 CATGCCAGTGATGTGATATGGGG - Intergenic