ID: 946132470

View in Genome Browser
Species Human (GRCh38)
Location 2:217617645-217617667
Sequence CTGGGTATTAAGACCAGACC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 123}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946132467_946132470 -7 Left 946132467 2:217617629-217617651 CCTCAGGAGCAGCTGCCTGGGTA 0: 1
1: 0
2: 4
3: 22
4: 298
Right 946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 123
946132464_946132470 -3 Left 946132464 2:217617625-217617647 CCTGCCTCAGGAGCAGCTGCCTG 0: 1
1: 0
2: 5
3: 53
4: 467
Right 946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 123
946132463_946132470 5 Left 946132463 2:217617617-217617639 CCAGGACTCCTGCCTCAGGAGCA 0: 1
1: 0
2: 3
3: 35
4: 380
Right 946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 123
946132460_946132470 8 Left 946132460 2:217617614-217617636 CCCCCAGGACTCCTGCCTCAGGA 0: 1
1: 0
2: 14
3: 61
4: 392
Right 946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 123
946132462_946132470 6 Left 946132462 2:217617616-217617638 CCCAGGACTCCTGCCTCAGGAGC 0: 1
1: 0
2: 0
3: 38
4: 374
Right 946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 123
946132461_946132470 7 Left 946132461 2:217617615-217617637 CCCCAGGACTCCTGCCTCAGGAG 0: 1
1: 0
2: 4
3: 38
4: 394
Right 946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 123
946132458_946132470 12 Left 946132458 2:217617610-217617632 CCTTCCCCCAGGACTCCTGCCTC 0: 1
1: 1
2: 9
3: 99
4: 884
Right 946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 123
946132456_946132470 28 Left 946132456 2:217617594-217617616 CCTTAGCATGGTCTTTCCTTCCC 0: 1
1: 0
2: 0
3: 16
4: 242
Right 946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG 0: 1
1: 0
2: 0
3: 5
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946132470 Original CRISPR CTGGGTATTAAGACCAGACC GGG Intronic
901342837 1:8510961-8510983 CAGGGTTTTGAGAACAGACCGGG - Intronic
901620839 1:10585592-10585614 CTCGGTAGTAATACCAGACAAGG + Intronic
903371059 1:22836544-22836566 CTGGCTGTTAAGACCTTACCTGG - Intronic
903514519 1:23901665-23901687 CCGGGTGTTCAAACCAGACCGGG + Intronic
905704674 1:40045894-40045916 CAGGGGTTTAAGACCAGCCCAGG - Intronic
909152259 1:72022206-72022228 TTGGATATCAAAACCAGACCAGG + Intronic
910984901 1:92995924-92995946 TTGTGGATTAAAACCAGACCAGG + Intergenic
912858901 1:113195573-113195595 CTGTTTATAAAGCCCAGACCTGG - Intergenic
915558496 1:156673397-156673419 CTGGGTATGAAGAGCAAAGCAGG + Intronic
917064985 1:171082774-171082796 CTAGGGATTATGACCAGATCTGG - Intergenic
919558420 1:199090965-199090987 CTGGATATTAAATCCAGGCCTGG + Intergenic
919988343 1:202691437-202691459 CAGGAGTTTAAGACCAGACCTGG + Intronic
920119716 1:203647218-203647240 CAGGGTTTTAAGACCAGTCTGGG + Intronic
922145337 1:222938523-222938545 CTGGGATTTGAGACCAGACTGGG + Intronic
922157353 1:223050940-223050962 CAGGGTTTTAAGACCAGCCTGGG - Intergenic
922557691 1:226545597-226545619 CTGGGTATTAATAGCAGACAAGG - Intergenic
1066337377 10:34492306-34492328 CTGTGAATTAAGACCTGAGCAGG - Intronic
1068387707 10:56352921-56352943 TTGGTTATTAAGATTAGACCCGG + Intergenic
1069155016 10:65017926-65017948 CTGGGTATTTACCCCAGACAAGG + Intergenic
1070120686 10:73573916-73573938 CTGGGCATTAGGAGGAGACCTGG - Intronic
1071417472 10:85454675-85454697 CTGGGAAATAAGACTAGACAAGG - Intergenic
1075155476 10:119973054-119973076 CAGGATATCAAGACCAGCCCAGG - Intergenic
1078782599 11:14453876-14453898 CTGGGGTTTAAGACCAGCCTGGG - Intronic
1082900257 11:58241491-58241513 CTGGGGATTAAGCCCAAACTAGG + Intergenic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1083646449 11:64174086-64174108 CTGAGATTTAAGACCAGAGCAGG + Intergenic
1083967141 11:66049806-66049828 CTGGGATTTAAGAGCAAACCAGG - Intergenic
1087483077 11:98726620-98726642 CAGGGGTTTAAGACCAGACTGGG + Intergenic
1089893430 11:121903981-121904003 GTGGGTATGAAAACCAGACTGGG + Intergenic
1094367849 12:29702934-29702956 CAGGAGATCAAGACCAGACCGGG + Intronic
1101415062 12:104501663-104501685 CTGACTATAAATACCAGACCAGG - Intronic
1102299475 12:111760527-111760549 CTGGGTATTTAGTACATACCAGG + Intronic
1104657145 12:130581765-130581787 ATGGGGAGTAAGAACAGACCAGG - Intronic
1107680269 13:42841139-42841161 CTGGAGATTAAGACCAGGTCAGG + Intergenic
1108520600 13:51243835-51243857 CTGTGAATAAAGACCAGATCTGG - Intronic
1112378757 13:98868553-98868575 CAGGGGTTTAAGACCAGCCCAGG + Intronic
1115699803 14:35941436-35941458 CAGGGTTTCAAGACCAGCCCGGG + Intergenic
1122250445 14:100435573-100435595 CTGGATGTTAAGGCCAGGCCAGG - Intronic
1122941682 14:104984347-104984369 CTGGGTTTGTAGACCAGGCCTGG - Intergenic
1122993600 14:105250456-105250478 CCGGGTGTTCAAACCAGACCGGG - Exonic
1125434479 15:39630481-39630503 GTGGGTATCCAGACCAGCCCAGG + Intronic
1127074615 15:55313205-55313227 CAGGGGATTAAGACCAGACTAGG + Intronic
1129130631 15:73490498-73490520 CAGGGGTTCAAGACCAGACCTGG + Intronic
1133039146 16:3050580-3050602 CTTATTCTTAAGACCAGACCTGG - Intronic
1133732330 16:8588613-8588635 CTGGGTACTAAGAACCAACCAGG + Intronic
1134203027 16:12214634-12214656 CAGTGAATTAAGCCCAGACCAGG - Intronic
1138078550 16:54066539-54066561 CTAGCTATTCAGACCAGGCCAGG + Intronic
1140952019 16:79827409-79827431 CTGAGTATTTAGACCAGATGAGG + Intergenic
1144699650 17:17328605-17328627 CTGGGGCTTAAGCCTAGACCGGG - Intronic
1147267622 17:39244386-39244408 CTGTATATTAAGAGCTGACCAGG - Intergenic
1148946730 17:51269076-51269098 CAGGAGTTTAAGACCAGACCGGG + Intronic
1151043046 17:70886373-70886395 CTGATTATGAAGACCTGACCTGG + Intergenic
1151459155 17:74244376-74244398 CTGGGTGTGAAGAACTGACCGGG + Intronic
1153267266 18:3283804-3283826 CTGGGAACTAAGACCAGATTTGG - Intergenic
1157428927 18:47607357-47607379 CCAGGAATTAAGACAAGACCTGG - Intergenic
1163175698 19:15563018-15563040 CTGGGGATTAAGAGGAGAACTGG - Intergenic
1165230912 19:34386094-34386116 CTGGCTCTTCAGACCATACCTGG - Intronic
1165775322 19:38401039-38401061 CAGGAGTTTAAGACCAGACCAGG - Intergenic
1167135322 19:47612204-47612226 CTGGATTTTAAGACCAGCCTAGG + Intronic
927802713 2:26116224-26116246 CAGGGTTTTAACACCAGCCCGGG - Intronic
930198777 2:48533042-48533064 CTAGGAGTTAAGACCAGACTGGG + Intronic
930319568 2:49837186-49837208 CTGGGTATTGAGCCCACAGCAGG - Intergenic
931237999 2:60428025-60428047 ATGGGTATTAAACCAAGACCAGG + Intergenic
932190336 2:69736092-69736114 CTGGGTCTTAAAAGGAGACCTGG - Intronic
934608366 2:95715423-95715445 CTGGGCTTTATGATCAGACCTGG - Intergenic
937813363 2:126223103-126223125 CTGGAGTTTAAGACCAGCCCAGG - Intergenic
938800890 2:134762364-134762386 ATGGGCATTAAAGCCAGACCTGG - Intergenic
939715025 2:145572892-145572914 TTTGGTATTGAGACAAGACCAGG + Intergenic
939957077 2:148536076-148536098 CTAGATATTGAGAGCAGACCAGG - Intergenic
941119549 2:161513218-161513240 CTGGGTTTTAAGCACAAACCTGG + Intronic
946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG + Intronic
1169607675 20:7340600-7340622 CTGGGTACAAAAACCAGACAAGG + Intergenic
1170217631 20:13908330-13908352 CAGGATTTTAAGACCAGCCCTGG - Intronic
1172888790 20:38249231-38249253 ATGGGTCCTAAGACCATACCTGG - Intronic
1173145642 20:40521931-40521953 CTGGGGATTGAGACCAGAGAAGG - Intergenic
1176155373 20:63617509-63617531 CTGGGGAGTCAGACCAGATCAGG + Intronic
1176891745 21:14327203-14327225 CTGGGTTTTAAGTACAAACCTGG + Intergenic
1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG + Intronic
1183542720 22:38438890-38438912 ATGGAAATTAAAACCAGACCAGG - Intronic
1184483110 22:44759602-44759624 CTGGGTATGCAGATGAGACCCGG - Intronic
952460831 3:33524439-33524461 CAGGAGTTTAAGACCAGACCAGG + Intronic
953059511 3:39415603-39415625 CTGGAGTTTAAGACCAGACTGGG + Intergenic
955397791 3:58569392-58569414 CTGGGCACTGAGCCCAGACCTGG - Intronic
957341533 3:78904442-78904464 CTGGCTATTAAGACTATCCCTGG + Intronic
957692281 3:83587701-83587723 CTGAGTATAAAGAACAAACCTGG - Intergenic
957734181 3:84185360-84185382 CTGAGAATTAAGACCACTCCAGG - Intergenic
960173158 3:114486886-114486908 GTGGGTATTGAGAACAGATCAGG - Intronic
960771456 3:121196889-121196911 CAGGGTATTGAGACCAGACTGGG - Intronic
961523280 3:127480565-127480587 CTGGGTATTTACATCAGCCCAGG + Intergenic
961813350 3:129534500-129534522 CTAGGCATCAAGGCCAGACCAGG + Exonic
967759551 3:193207961-193207983 CAGGGAATTCAGAGCAGACCTGG + Intergenic
967954239 3:194865310-194865332 CTGGGTATTACAAACAAACCAGG + Intergenic
970182495 4:13414621-13414643 CTTGGTACTAAAACCAGACAAGG + Intronic
971326564 4:25649075-25649097 CTGGAGCTTAAGACCAGACTGGG - Intergenic
972880082 4:43411675-43411697 CTGGACACTAAGACCAGACAAGG + Intergenic
974685585 4:65223568-65223590 CTGGGTAGCAAGACCAGAAGTGG - Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
986613488 5:9593214-9593236 CAGCGTCTTAAGCCCAGACCTGG - Intergenic
989456881 5:41654348-41654370 CTGGGTATCACAACCAAACCTGG + Intergenic
990678473 5:58215311-58215333 CTGGGGATTGAGACCACAGCTGG + Intergenic
995695366 5:114873123-114873145 CTGGTCATTAATAACAGACCTGG - Intergenic
997029574 5:130110090-130110112 ATGGGTATGAAGAGCAAACCTGG + Intronic
1000073645 5:157764436-157764458 CTGTGTCCTGAGACCAGACCCGG + Intergenic
1006178314 6:32137424-32137446 CTGGAGATTGAGACCAGCCCAGG - Intergenic
1006269718 6:32954585-32954607 CAGGGTCTTCAGACCATACCTGG - Intronic
1010223940 6:73471624-73471646 CTGGGGTTCAAGACCAGTCCTGG - Intronic
1010807408 6:80254485-80254507 CTGGGGTTCAAGACCAGCCCAGG + Intronic
1011025982 6:82869475-82869497 CTGGGTATTATGGCCTGTCCTGG - Intergenic
1013070059 6:106720982-106721004 CTCTGAATTGAGACCAGACCAGG - Intergenic
1013070307 6:106723333-106723355 CTCTGAATTGAGACCAGACCAGG + Intergenic
1016546765 6:145232697-145232719 CTGGGTGTTAAGCCCACCCCAGG - Intergenic
1018671333 6:166179955-166179977 ATGGGCATGTAGACCAGACCAGG + Intergenic
1019456682 7:1131306-1131328 AGGGGTATTTAGACCACACCTGG - Intronic
1022973733 7:35538744-35538766 CTGGGAGGCAAGACCAGACCAGG - Intergenic
1023738354 7:43254748-43254770 CTGGGCATTACGACCAGTGCTGG - Intronic
1024976138 7:55115663-55115685 CTGGGTCCTGAGAGCAGACCGGG - Intronic
1031273206 7:119681521-119681543 CAGGGTTTCAAGACCAGCCCTGG - Intergenic
1037305500 8:17499122-17499144 CTGGCTGTTATGGCCAGACCCGG + Intronic
1037950003 8:23013141-23013163 CTGGAGTTTAAGACCAGTCCAGG - Intronic
1038178446 8:25203118-25203140 CTGGGTGTTAAGACCAGAAATGG - Intronic
1040312430 8:46243727-46243749 CTGGGTATTAAAACCCGCCCGGG - Intergenic
1041528919 8:58840514-58840536 CAGGGTATTAAAAGCTGACCAGG - Intronic
1048706841 8:137163218-137163240 CTGGGTATTATGTTCAGCCCTGG + Intergenic
1056349224 9:85731638-85731660 CTGGGCAATATGACAAGACCCGG - Intronic
1057773757 9:97988514-97988536 CAGGGATTCAAGACCAGACCGGG + Intronic
1058162318 9:101582684-101582706 CTGTGGATTAAGAACAGACTGGG + Intronic
1062543906 9:137053431-137053453 CTGGGTATTCAGCCCAGATGGGG - Intronic
1185669839 X:1799038-1799060 CTGGATACTAACACCAGACTAGG + Intergenic
1187598726 X:20802896-20802918 TTGGATATTAAGACCAGCTCTGG + Intergenic