ID: 946132956

View in Genome Browser
Species Human (GRCh38)
Location 2:217621877-217621899
Sequence CTGTAAATGCAGTGGAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946132946_946132956 29 Left 946132946 2:217621825-217621847 CCCTGTGTTCTACTCTTTGAAAG 0: 1
1: 0
2: 2
3: 35
4: 306
Right 946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 201
946132945_946132956 30 Left 946132945 2:217621824-217621846 CCCCTGTGTTCTACTCTTTGAAA 0: 1
1: 0
2: 2
3: 40
4: 538
Right 946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 201
946132947_946132956 28 Left 946132947 2:217621826-217621848 CCTGTGTTCTACTCTTTGAAAGG 0: 1
1: 0
2: 2
3: 12
4: 189
Right 946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946132956 Original CRISPR CTGTAAATGCAGTGGAAGCT GGG Intronic
900377357 1:2361699-2361721 CTGGAAATGCAGTTGACCCTTGG + Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
903510831 1:23873873-23873895 CTGGAAATACAGAGGAGGCTGGG - Exonic
905183385 1:36179669-36179691 CTGTGAAAGCTGTGGAGGCTCGG + Exonic
905277578 1:36828731-36828753 CTGGAAATGGAGTGGATTCTTGG + Intronic
906701292 1:47859986-47860008 CTGGAGATGCAGTGGAACCAGGG + Intronic
906940561 1:50251785-50251807 CTGTAAATACAGTGGGAACCTGG + Intergenic
910118142 1:83755419-83755441 ATATAAATGCAGTGAAAGTTAGG + Intergenic
912553608 1:110500273-110500295 CTGTGAATGAAATGGATGCTTGG - Intergenic
915981236 1:160421088-160421110 CTGTGATTGCAGCGGCAGCTCGG + Exonic
916385069 1:164257887-164257909 ATGTAAAGGAAGTGGCAGCTTGG + Intergenic
916552557 1:165862655-165862677 CTCTAAAGTCAGTGGAGGCTGGG - Intronic
917537706 1:175886464-175886486 CTGTAAATGCTGTGTAATCTTGG + Intergenic
920510402 1:206547315-206547337 CTGTAAATACAGATGAAGCGTGG - Intronic
920847905 1:209608887-209608909 CTGTGTATACAGTGGGAGCTTGG + Intronic
923982766 1:239343984-239344006 CTCTAAATGCAGTTGGGGCTGGG + Intergenic
924474459 1:244371109-244371131 CTGTAAATGGAGTGGGATCTGGG - Intronic
1062987924 10:1786568-1786590 GTGCAGATGCAGAGGAAGCTGGG + Intergenic
1065745301 10:28835492-28835514 ATGTAAATGCTGTGGGTGCTAGG + Intergenic
1065768758 10:29056946-29056968 GAGTAACTGCAGTGTAAGCTTGG + Intergenic
1067467028 10:46508762-46508784 CTGTAAATGCTGATGAGGCTGGG + Intergenic
1067620158 10:47875843-47875865 CTGTAAATGCTGATGAGGCTGGG - Intergenic
1068794602 10:61064795-61064817 TAGTAAATGCAGTAGAAACTAGG - Intergenic
1069591453 10:69644748-69644770 CTGGAAATTAAGTGGCAGCTGGG - Intergenic
1069996115 10:72343125-72343147 CAGGAAATGCAGAGGAAGCAGGG + Intronic
1072847798 10:98851602-98851624 CTCAAAATGCAGAGGAATCTGGG - Intronic
1073635000 10:105188835-105188857 CAGTAAAAGGAGTTGAAGCTGGG + Intronic
1074691038 10:116004324-116004346 CTATAACTGCATTGCAAGCTTGG + Intergenic
1075046907 10:119153632-119153654 CTGTAAGTGCAGAGCAGGCTGGG + Intronic
1076237091 10:128871774-128871796 CTGGAAGTGGAGTGGAAGCCAGG + Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1080398502 11:31912258-31912280 TAGAAAATGCAGTGGATGCTGGG + Intronic
1080415135 11:32062805-32062827 CCCTGAATGCAGTGAAAGCTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085985814 11:81786531-81786553 CTGTCAATGTAGTGGAAGTGGGG + Intergenic
1088506880 11:110535589-110535611 CTGTAAAGCCAGTGGAACCATGG - Intergenic
1090088242 11:123670319-123670341 GTGTAACTGAAGTGGAAGCTAGG + Intergenic
1090815371 11:130289429-130289451 CTGGAAGTGCAGTGGGATCTCGG - Intronic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1091440321 12:507782-507804 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440327 12:507818-507840 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440344 12:507890-507912 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440352 12:507926-507948 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1091440360 12:507962-507984 CTGGAAATCCAGTAGTAGCTTGG + Intronic
1093469069 12:19481772-19481794 CAGAAAATGCACTGGAGGCTGGG - Intronic
1095570793 12:43683325-43683347 TTGAAGATGCAATGGAAGCTAGG - Intergenic
1096916728 12:55041032-55041054 CTGTTAATTCATTGGAAGCGAGG - Intergenic
1097464714 12:59908089-59908111 CTGAAAATGAAGTTCAAGCTGGG + Intergenic
1098941622 12:76543165-76543187 CTGAAAATTCAGTAGGAGCTAGG - Intronic
1105995660 13:25669594-25669616 ATGTATACGCTGTGGAAGCTAGG - Intronic
1109978263 13:69871103-69871125 ATGGAAAAGCGGTGGAAGCTTGG - Intronic
1112695718 13:101945706-101945728 CTGCTAATGCAGTGGGAGGTAGG - Intronic
1113659824 13:112098453-112098475 TTGAAAATTCAGTGGAAACTAGG + Intergenic
1114914969 14:27251879-27251901 CTGGAAATGCATTGATAGCTAGG - Intergenic
1115325755 14:32136032-32136054 CTTTTAATTCAGTGGGAGCTAGG + Intronic
1116128114 14:40815669-40815691 CTGTAAATGCGCTGAGAGCTAGG + Intergenic
1116356637 14:43938712-43938734 CTGTAGAGCCAGCGGAAGCTGGG + Intergenic
1116801363 14:49447369-49447391 CAGCAAATGCAGAGGATGCTTGG - Intergenic
1117481155 14:56146312-56146334 CTCTAAATGCAGTACAAACTGGG + Intronic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1119978687 14:79054962-79054984 ATGTAAATACAGTGGTAGCTTGG + Intronic
1120256010 14:82120577-82120599 CACTAAATGCAGTGGTAGCATGG + Intergenic
1123508085 15:20966041-20966063 CTTTAAGTGCAAGGGAAGCTAGG - Intergenic
1123565304 15:21539788-21539810 CTTTAAGTGCAAGGGAAGCTAGG - Intergenic
1123601567 15:21977076-21977098 CTTTAAGTGCAAGGGAAGCTAGG - Intergenic
1125786351 15:42321857-42321879 ATGTAAAAGCAGTGGATGCAGGG + Exonic
1125934405 15:43622442-43622464 CTGTAAATGCTGTGGTAATTTGG - Intergenic
1125947551 15:43722224-43722246 CTGTAAATGCTGTGGTAATTTGG - Intergenic
1126688527 15:51268682-51268704 ATGGGAATGCAGTGGAACCTCGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1129227890 15:74180402-74180424 CTGTGGATGGACTGGAAGCTGGG + Intronic
1129893884 15:79089923-79089945 CTGGAGATGCAGAGGAAGATGGG - Intronic
1202973675 15_KI270727v1_random:266879-266901 CTTTAAGTGCAAGGGAAGCTAGG - Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135274729 16:21102327-21102349 CAGTAAATGCTGTTGAAGTTAGG - Intronic
1135712267 16:24728151-24728173 TTGTAAAGCCAGTTGAAGCTGGG + Intergenic
1136561013 16:31039305-31039327 CTCTATCTGCAGTGGTAGCTTGG - Intronic
1137715545 16:50596087-50596109 CTGTACATGCATAGGAAGCCAGG - Intronic
1138217033 16:55213386-55213408 CTGGCAATGCAGTGTGAGCTTGG + Intergenic
1139747638 16:69087331-69087353 CTGAAAAAGCAGTTGAAGCTTGG - Intergenic
1140023820 16:71265256-71265278 CTGTAAATCCAGTGGAGGAAAGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147448564 17:40489827-40489849 CTGTACCTGCAGTGAAAGCAGGG + Intronic
1148554243 17:48568544-48568566 CGGAAAATGATGTGGAAGCTGGG - Intronic
1149975342 17:61260132-61260154 CTGTAAATAAAGTGGAAACAGGG - Intronic
1150104015 17:62448428-62448450 TTATAAATGCAGTGGTGGCTTGG - Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150601006 17:66651017-66651039 CTGTACCTGCAGTGGGAGTTTGG + Intronic
1150847145 17:68670726-68670748 CTTTGAAAGCAGTGGAAGCCTGG - Intergenic
1151915791 17:77117049-77117071 CAGTAAATGCAATGGAAGGCCGG + Intronic
1152124509 17:78438248-78438270 CTGTAAGACCCGTGGAAGCTGGG + Intronic
1152959196 18:68243-68265 CTGTAACTGCTGAGGAATCTAGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156610616 18:38719726-38719748 CTTTAAAACCAGTGTAAGCTGGG + Intergenic
1157744893 18:50126726-50126748 GTGAAAATGCATTGGAGGCTTGG - Intronic
1158535017 18:58300464-58300486 TTGCAAATGCAGTAGTAGCTGGG + Intronic
1159688283 18:71451627-71451649 CTGTAAATGCAGTTTATTCTGGG + Intergenic
1159988542 18:74874611-74874633 CTGGAAATGCAGAGCTAGCTGGG - Intronic
926376037 2:12228493-12228515 ATGTAAGTGCAAAGGAAGCTGGG + Intergenic
928176087 2:29035311-29035333 CTGTAGGTGGAGGGGAAGCTGGG + Intronic
928281812 2:29953160-29953182 GAGTAAATACAATGGAAGCTAGG + Intergenic
929904872 2:46036904-46036926 TTGTAAAACCAGTGGAAGCCTGG + Intronic
933292367 2:80452378-80452400 CTGTAAATGCATCAGAAGCAGGG - Intronic
933902331 2:86859061-86859083 CTGTACATCCAGTGGCAGCCAGG - Intronic
935778214 2:106490207-106490229 CTGTACATCCAGTGGCAGCCAGG + Intergenic
936646471 2:114377850-114377872 CTTTAAATGAAGAGGAGGCTGGG - Intergenic
937258520 2:120571083-120571105 CTCTCACTGCAGTGGATGCTGGG + Intergenic
937441197 2:121917648-121917670 TTCCAAATGCAGGGGAAGCTGGG + Intergenic
938163261 2:129005227-129005249 CTGTAGCTGCTGTGGAAGGTGGG + Intergenic
938614016 2:132979081-132979103 CTGGAAATTCAGTGGAAGCTTGG - Intronic
938737008 2:134194911-134194933 CTGATAATGCAGTTGAAGTTGGG + Intronic
943693413 2:190893878-190893900 CTAAAAATGCATTTGAAGCTGGG - Intronic
944619316 2:201497841-201497863 CTGTTAATGTACTGGAACCTTGG - Intronic
945811942 2:214559431-214559453 TTCTATCTGCAGTGGAAGCTCGG - Intronic
946132956 2:217621877-217621899 CTGTAAATGCAGTGGAAGCTGGG + Intronic
1172624577 20:36339939-36339961 CTGGACAGGCAGTGGAGGCTGGG + Intronic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1174068113 20:47880061-47880083 CAGTTCCTGCAGTGGAAGCTGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175047944 20:56125125-56125147 CTGTAAATAGAGTGGATGCTTGG + Intergenic
1175585590 20:60136891-60136913 CTGTCACTTCAGTGGAAGTTGGG + Intergenic
1177150864 21:17454349-17454371 CTGAAAATACAGTGGAATCAAGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1180226725 21:46397922-46397944 TTGTACGTGCAGTGGAAGCCTGG + Intronic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1183053831 22:35288688-35288710 TTTAAAATGCAGTGGAGGCTGGG + Intronic
949873516 3:8608745-8608767 CTTTAAATCCAGAGGAGGCTTGG - Intergenic
950184777 3:10938283-10938305 CTGAAAATGCGGGGCAAGCTTGG + Exonic
951441008 3:22723703-22723725 CTGTATTAGCAATGGAAGCTGGG + Intergenic
952523532 3:34185989-34186011 CTGAAATTGCAGTGTAATCTGGG - Intergenic
953859230 3:46528187-46528209 TTGTAAATGCAGTAGACTCTCGG - Intronic
954663913 3:52240400-52240422 CAGTAAATGGAGCTGAAGCTGGG - Intergenic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
957211367 3:77262797-77262819 CTGTAAATGCTGGGGAATGTGGG - Intronic
962327832 3:134450439-134450461 CTGTAAAAGCAGTGGAGCTTGGG - Intergenic
962382573 3:134909513-134909535 ATCCAAATGCAGTGGAAGATGGG - Intronic
968467653 4:760577-760599 CTAAAAATGCAGTGGAAGAATGG - Intronic
968682833 4:1933225-1933247 CTGTGAATGCATTGGCAGCAGGG + Intronic
968701258 4:2059228-2059250 CAGCCAATGCAGTGGACGCTAGG + Intergenic
970875067 4:20859689-20859711 CTTAAAATACAGTAGAAGCTTGG + Intronic
971036274 4:22696231-22696253 CTGTAGATGCATTGGAAGTCAGG + Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
973303221 4:48613658-48613680 ATGTAAATGCATTTGAGGCTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
976034387 4:80797263-80797285 CTTTGAATGAAGTGGAAGCTGGG - Intronic
976335454 4:83880104-83880126 CAGAAAATGCAGTGGGGGCTAGG - Intergenic
976785392 4:88813952-88813974 CTGTAAATTCCGTGAAAGTTGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979337922 4:119485077-119485099 CTGTAAATCCATCGGGAGCTGGG - Intergenic
979994962 4:127420684-127420706 CTGAAAATACAGTGCAAGCTTGG + Intergenic
981182651 4:141763963-141763985 CTGTAAATACACATGAAGCTGGG + Intergenic
981721985 4:147811086-147811108 CTGAAAATGAAGAGGAAGCCAGG - Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
984075366 4:175170945-175170967 CTGTATCTGCAGTGGAAGGAAGG - Intergenic
984411418 4:179403493-179403515 CAGCAAGTACAGTGGAAGCTGGG - Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
984807473 4:183764732-183764754 CTGGAAATGCAGTCCCAGCTTGG + Intergenic
985236842 4:187884398-187884420 CTTCAATTGCAGGGGAAGCTAGG + Intergenic
987512504 5:18857781-18857803 TTCTAAATGCAGAGGAGGCTTGG + Intergenic
988150260 5:27368270-27368292 CTGTAAATACGGAGGGAGCTTGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
990878688 5:60517075-60517097 CTGAAATTGGAGTGGGAGCTAGG - Intronic
992908236 5:81369609-81369631 CTGGAAAGTCAGTGGAGGCTAGG + Intronic
993352744 5:86869887-86869909 AGGTAAATGAAGTGGAAGCATGG - Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
997346370 5:133195368-133195390 CTGTACTTGGAGTGGAACCTGGG + Intergenic
999828257 5:155294790-155294812 CTTGAAATGCAGTGAAAGCAAGG - Intergenic
1001704368 5:173731091-173731113 ATGTTAGTGCAGTGGTAGCTAGG - Intergenic
1001885922 5:175290171-175290193 CTTTATCTGCAGTGGAAGCCTGG - Intergenic
1002850855 6:995375-995397 CTGGAACTGCAGTGAAGGCTTGG + Intergenic
1003511343 6:6783564-6783586 CTGGAAATGCAGAGGCAGATAGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006405170 6:33840955-33840977 CTGTTAATGCAGTGCAAGTTTGG + Intergenic
1008211451 6:48729604-48729626 CTGTAAAGGCAGTGGCAGAGAGG - Intergenic
1008524404 6:52393819-52393841 CTTTAAGTGCAGTGGCAGTTAGG + Intronic
1011021741 6:82821458-82821480 CTGTAAATGCAGTCGTCCCTTGG + Intergenic
1011840391 6:91490476-91490498 CTCTAAATTTAGTGGCAGCTGGG + Intergenic
1016250907 6:142041183-142041205 CTGTGTATGCAGTGGAAGAGTGG - Intergenic
1017995621 6:159529476-159529498 CAGAAAATGCAGGGAAAGCTGGG + Intergenic
1018136645 6:160784382-160784404 CTGAAAATGCTCAGGAAGCTGGG - Intergenic
1018168963 6:161128886-161128908 CTGTTAATTCAGGGGAGGCTGGG - Intergenic
1020519607 7:9169365-9169387 CTGGAAATGGGGTGGAAGCCAGG - Intergenic
1020893595 7:13911280-13911302 ATATAAATGGAGTGGCAGCTAGG + Exonic
1022762029 7:33365512-33365534 CTTTAATGGCAGTGGATGCTAGG + Intronic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1024264398 7:47595726-47595748 CTTTAAATGATGTGGAAGCGGGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1030323975 7:108200449-108200471 CTGAAAATGCAGTGTAACTTAGG + Intronic
1031046716 7:116897535-116897557 CTGAAAATTCAGTGGACGCCTGG + Intronic
1031070889 7:117160367-117160389 CTCTACATGTAGTGGGAGCTAGG + Intronic
1031341133 7:120603478-120603500 CTGTATATGCAGTGGGGTCTGGG + Intronic
1031376486 7:121032950-121032972 CTTTAGATACAGAGGAAGCTGGG - Intronic
1032033194 7:128501616-128501638 TTATAAATGCAGTGGTGGCTTGG - Intronic
1034883559 7:154780412-154780434 CTGTAAATGCAGGGAATGATTGG + Intronic
1035193029 7:157189159-157189181 CTGAATATGCCGAGGAAGCTGGG + Intronic
1036770681 8:11576450-11576472 CTGTTAATGCTGAGGAAGCCAGG - Intergenic
1038048819 8:23790168-23790190 CTGTGAATGCCGGGGAAGCCCGG + Intergenic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038863630 8:31414846-31414868 CTGTAAATACAGATGATGCTTGG + Intergenic
1040894029 8:52347261-52347283 CTGTAAAAGCAGGAAAAGCTTGG + Intronic
1041871423 8:62638805-62638827 CTGTAAGTGCAGCGGTAGATAGG + Intronic
1042130815 8:65585323-65585345 CTGTAGATCCAGTGGACCCTGGG + Intergenic
1044587021 8:93877516-93877538 CTGTCAATAGAGTGGAGGCTAGG + Intronic
1044630694 8:94275766-94275788 TCGTAAATGAATTGGAAGCTGGG - Intergenic
1046850385 8:118965551-118965573 CTGTAAATGCAAAGGAGGTTGGG + Intergenic
1049022468 8:139967035-139967057 CTTTAAATGCAGTGGAAGTGCGG + Intronic
1050169090 9:2796758-2796780 CTGGAACTGCATTTGAAGCTTGG - Intronic
1050703545 9:8368521-8368543 ATATAAATGCAGTGGAAGAGAGG - Intronic
1056072215 9:82999435-82999457 ATGTAAGTGCAGTGCAGGCTGGG + Intronic
1056409765 9:86313381-86313403 CTGTAACTGGATGGGAAGCTAGG + Intronic
1056688061 9:88783028-88783050 CTGTAAATCCAGTCGCAGCCTGG - Intergenic
1056976298 9:91257816-91257838 CTGTAGATGCAGTGCAATCCTGG - Intronic
1057466746 9:95321148-95321170 CTGTAAATGGAGTTGAAGCCAGG - Intergenic
1058952661 9:109917880-109917902 CTTTATCTTCAGTGGAAGCTAGG + Intronic
1059344824 9:113620974-113620996 CTGTAAATGCTGTGTGAGCTTGG - Intergenic
1060535557 9:124384316-124384338 CTGTAAATGCGGTGGTAACGTGG - Intronic
1185740599 X:2529020-2529042 CTGTAAATGCATTTAAAACTTGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187812155 X:23191101-23191123 CTTTATGTGCAATGGAAGCTTGG - Intergenic
1192995132 X:76505437-76505459 CTGTAGCTGCCGTGGAAGATGGG + Intergenic
1194434350 X:93851469-93851491 TTGGAAAGGCAGTGGAAGTTTGG - Intergenic
1196501968 X:116394727-116394749 CTGAAAATGCAATAGCAGCTGGG - Intergenic
1197749333 X:129953886-129953908 CTGTAAATGCACTCTTAGCTAGG + Intergenic
1200023147 X:153228780-153228802 CTGTACATGCAGTTGAACCTGGG - Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic