ID: 946133498

View in Genome Browser
Species Human (GRCh38)
Location 2:217626275-217626297
Sequence TCGTTATCAATGTACGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946133496_946133498 8 Left 946133496 2:217626244-217626266 CCTGGAAGTCTGAATTCAAATAC 0: 1
1: 0
2: 3
3: 25
4: 279
Right 946133498 2:217626275-217626297 TCGTTATCAATGTACGACCATGG 0: 1
1: 0
2: 0
3: 0
4: 28
946133495_946133498 16 Left 946133495 2:217626236-217626258 CCTAAGAGCCTGGAAGTCTGAAT 0: 1
1: 0
2: 1
3: 16
4: 198
Right 946133498 2:217626275-217626297 TCGTTATCAATGTACGACCATGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946133498 Original CRISPR TCGTTATCAATGTACGACCA TGG Intronic
917389400 1:174518047-174518069 GCGATTTTAATGTACGACCATGG - Intronic
918626684 1:186663793-186663815 TTGTAACCAATGTACCACCATGG + Intergenic
922474555 1:225898324-225898346 TCGTTAACAATCTGCGACCTCGG - Intronic
1063756953 10:9022166-9022188 TATTTAGAAATGTACGACCAAGG + Intergenic
1075025556 10:118980678-118980700 TGGTTATAACTGTACGACCCTGG - Intergenic
1079911867 11:26319854-26319876 TTTTTATCAATGTACAATCAAGG + Intronic
1084843717 11:71882120-71882142 TCTTTATCTATGGACAACCAAGG + Intronic
1087136392 11:94724989-94725011 GCATAGTCAATGTACGACCAGGG + Intronic
1107824542 13:44316413-44316435 TTGTTTTCAATGTGGGACCAAGG + Intergenic
1119196869 14:72723515-72723537 GCGTTCTCCATGTAAGACCATGG + Intronic
1125925113 15:43556770-43556792 ACGTTCTCAATGTAGGACCCTGG - Intronic
1127505514 15:59594359-59594381 TAGCTTTCAATGTACTACCATGG + Intergenic
1153545451 18:6200277-6200299 TGCTTATCAGTGTACGAGCATGG - Intronic
925745062 2:7036879-7036901 TCATAATCAATGTCCGACCCAGG - Intronic
929788276 2:45007136-45007158 ACGTTTTCACTGTACCACCACGG - Intronic
932390869 2:71389715-71389737 TCTTTATAAATGTTCGACAAGGG + Intronic
933203247 2:79475746-79475768 TCATTATGTATGTAAGACCAAGG + Intronic
946133498 2:217626275-217626297 TCGTTATCAATGTACGACCATGG + Intronic
1180233919 21:46445064-46445086 TCGCTATCAATGTAAGAGAAAGG - Intronic
958674455 3:97250307-97250329 TCTTTAGCAATGTATGATCACGG - Intronic
964954501 3:162335438-162335460 TCTTTTTCTATGTACTACCATGG - Intergenic
969784814 4:9448211-9448233 TCTTTATCTATGGACAACCAAGG + Intronic
978056092 4:104269134-104269156 TTGTTATCAATGTATGAAAATGG + Intergenic
990132546 5:52604937-52604959 GCCTTATCCATGTACAACCACGG - Intergenic
995924893 5:117359383-117359405 TCATTATTAATGTAAGTCCAGGG + Intergenic
1030180044 7:106697265-106697287 TGGTAATAAATGTACAACCATGG - Intergenic
1036828988 8:12005967-12005989 TCTTTATCTATGGACAACCAAGG - Intergenic
1038550885 8:28467610-28467632 TCCTTGTCAATGTACAAACATGG - Intronic
1044480697 8:92684114-92684136 TCGTTCTCTATGTACCACTATGG + Intergenic