ID: 946133889

View in Genome Browser
Species Human (GRCh38)
Location 2:217629514-217629536
Sequence AGCCCAGCTCCTGCTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946133889_946133896 14 Left 946133889 2:217629514-217629536 CCCCACAGAGCAGGAGCTGGGCT 0: 1
1: 0
2: 4
3: 59
4: 380
Right 946133896 2:217629551-217629573 AGCATGCCTGCTGTGGTGTGAGG 0: 1
1: 0
2: 2
3: 32
4: 272
946133889_946133894 7 Left 946133889 2:217629514-217629536 CCCCACAGAGCAGGAGCTGGGCT 0: 1
1: 0
2: 4
3: 59
4: 380
Right 946133894 2:217629544-217629566 GGCCTCTAGCATGCCTGCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946133889 Original CRISPR AGCCCAGCTCCTGCTCTGTG GGG (reversed) Intronic
900147670 1:1165514-1165536 AGGCCAGCTCTGGCCCTGTGGGG + Intergenic
900252880 1:1680576-1680598 AGCCCTGCCCCGGCTCTGTGTGG + Intronic
900380980 1:2383769-2383791 AACCCAGGTGCTGCTGTGTGAGG - Intronic
900395754 1:2452616-2452638 GGCCCATCTGCTGCTCTCTGGGG - Intronic
900563556 1:3320779-3320801 AGCCCAGCTGCTGCTGTGGCAGG + Intronic
900914182 1:5623140-5623162 GGACCAGCTCCTGCACTGTGGGG - Intergenic
901226229 1:7614252-7614274 AGGCCAGCTCAGGCTCTGGGAGG - Intronic
901702657 1:11053885-11053907 AGCCCAGCCCCTGCCCAGGGTGG + Intergenic
902881969 1:19377926-19377948 TGCTCTGCTCCTGCTCTGTAAGG + Intronic
903192727 1:21665977-21665999 GGCCCAGCTCCAGCTCTGGGAGG - Intronic
903302650 1:22390333-22390355 ATCCTAGCCCCTGCTCTGTGAGG + Intergenic
903549840 1:24150289-24150311 CGCCCAGCATCTGCTCTGAGGGG - Intergenic
904075705 1:27840584-27840606 TGTCCAGCTCCTGCTTTGGGAGG + Intronic
904965633 1:34370269-34370291 AGCTGGGCTCCTGCTCTGAGGGG + Intergenic
905405152 1:37727430-37727452 AGCCCAGCTCCTGCTCAGAGAGG + Intronic
905475664 1:38225925-38225947 AGCCCAGCTCCACCTCTGACTGG - Intergenic
905687523 1:39919319-39919341 ATCCCATCTCATCCTCTGTGTGG - Intergenic
907190375 1:52642962-52642984 AGCCCAGGTCCAACTTTGTGTGG - Exonic
907250395 1:53134265-53134287 TGCCCTGCTCCTGCTGTGGGTGG - Intronic
908184731 1:61641869-61641891 AGCCCTGGGCCTGCTCTCTGCGG - Intergenic
908822957 1:68106493-68106515 TTCCCAGCTGTTGCTCTGTGGGG - Intronic
909764397 1:79337415-79337437 AGCACACTTCCTGCTCTTTGAGG + Intergenic
912310936 1:108620833-108620855 AGACCAGCCCCTGCTCTGAAGGG + Intronic
912555570 1:110513753-110513775 AGCTCTTCTCCTGCTCTGGGTGG + Intergenic
912784709 1:112589872-112589894 TGCCCAGCTCTGGCTGTGTGTGG + Intronic
913128298 1:115813739-115813761 TGCTGAGCACCTGCTCTGTGCGG - Intergenic
915514862 1:156406771-156406793 CTCCCAGCTCCTGCCCTGGGGGG - Intronic
915886226 1:159723962-159723984 AGTCCAGCACCTTTTCTGTGTGG + Intergenic
916465561 1:165071268-165071290 GGCCCATTTCCTGCTCTTTGGGG - Intergenic
917534136 1:175862622-175862644 ACCCTGCCTCCTGCTCTGTGAGG + Intergenic
917627103 1:176857478-176857500 GGCGCAGCTCCTGCTTTGAGGGG + Intronic
918050015 1:180965587-180965609 AGCCCACCTCTGTCTCTGTGTGG + Intergenic
918059649 1:181049959-181049981 AGCCCACCTCTGTCTCTGTGTGG + Intronic
920543646 1:206798020-206798042 AGCCCAGCACCTTCTGTGTTTGG + Intergenic
920825458 1:209420893-209420915 GGCCCTGGTGCTGCTCTGTGTGG - Intergenic
920840104 1:209546898-209546920 AACCCAGCCACTGCACTGTGGGG - Intergenic
921638751 1:217526746-217526768 TGCTCACCTCCTGCTGTGTGTGG - Intronic
922661355 1:227433149-227433171 AGCCCAGCTCATTCTGTGGGAGG - Intergenic
922959947 1:229637823-229637845 GGCCCAGCTTCTGCTCTTTGAGG - Exonic
923686306 1:236155903-236155925 AGCTGAGCTCCTGCCTTGTGGGG + Intronic
924375015 1:243397907-243397929 AGCCCTGCTAATACTCTGTGTGG + Intronic
1062889481 10:1047543-1047565 AGCCCAGCTGCTCCACTGTCTGG + Intronic
1063017914 10:2096617-2096639 GGTCCAGCTCCTGCCCTTTGGGG - Intergenic
1063482187 10:6385532-6385554 TTCGCAGCTCCTGCTTTGTGAGG - Intergenic
1063586782 10:7359235-7359257 GGCCCCGTTCCTGCTCTGGGTGG - Intronic
1065371087 10:24987183-24987205 AGCCCAGCTCCAGCTCTCACTGG + Intronic
1066298424 10:34075991-34076013 ATGCCAGCTCCTGCTCTTGGAGG + Intergenic
1066484565 10:35830801-35830823 ACCCCAGCTCCTGGTCTTTTAGG + Intergenic
1067477146 10:46574586-46574608 AGCCCAGGTCCTTCTTTGTGAGG - Intergenic
1067617593 10:47767195-47767217 AGCCCAGGTCCTTCTTTGTGAGG + Intergenic
1069852734 10:71420904-71420926 AGCCAGCCTGCTGCTCTGTGAGG - Intronic
1070828860 10:79406620-79406642 CTCACAGCTCCTGCTATGTGTGG + Intronic
1070832182 10:79424857-79424879 ATCCAAGCTCCTCCTCTCTGAGG + Intronic
1074285897 10:112098065-112098087 AGCACAGCTTTTGCTCTGTAAGG - Intergenic
1075746131 10:124728994-124729016 AGCTCAGCTCCTGCCCAGCGGGG + Intronic
1076532421 10:131153874-131153896 AGCCCAGCTCCTGAGCCCTGGGG + Intronic
1076788252 10:132762156-132762178 AGCCCAGCGCTTGCGCAGTGAGG + Intronic
1076836832 10:133025417-133025439 AGCCCTCCTCATCCTCTGTGTGG - Intergenic
1076914974 10:133418873-133418895 TGCCCAGAGCCTGCACTGTGAGG + Intronic
1077311094 11:1889429-1889451 CGGGCACCTCCTGCTCTGTGGGG + Exonic
1077634334 11:3831801-3831823 ACCCACTCTCCTGCTCTGTGTGG - Intronic
1078146041 11:8722434-8722456 GGCCCAGCCTGTGCTCTGTGGGG - Intronic
1078222375 11:9362637-9362659 GGCCCAGGTCCTCTTCTGTGTGG - Intergenic
1078596916 11:12695621-12695643 AGCACAGCCCATGATCTGTGAGG + Intronic
1079882487 11:25944502-25944524 AGCCCTGCTCCTTCTCAGTTGGG - Intergenic
1080581263 11:33645910-33645932 AGCCCAGCACCTGCCCTATTCGG + Exonic
1080767201 11:35307897-35307919 AGCCTAGGGCCTGCTGTGTGAGG + Intronic
1081614029 11:44579822-44579844 AGCCCAGCTCCTGCAAGGGGTGG - Intronic
1082075626 11:47973921-47973943 AGCCCACCTCCTGAGCTGTTAGG - Intergenic
1082110059 11:48264397-48264419 AGGCCAGCTCCAGCACTGGGTGG - Exonic
1083191447 11:61055420-61055442 AGCCCAGCTCTGGGCCTGTGGGG - Intergenic
1084148862 11:67278831-67278853 GGCCCTGCGCCTGCTCTGTGAGG - Intronic
1084656386 11:70522154-70522176 AGCCCCGCTCCAGCTTTCTGAGG + Intronic
1084971676 11:72775505-72775527 TGCACAGCTGCTGCTCTGTATGG + Intronic
1085051233 11:73381345-73381367 AGCCCAGTGCATGCACTGTGAGG + Intronic
1086948434 11:92867112-92867134 AGCCCAGCTTCAGCTCCGTCAGG - Exonic
1088745434 11:112800655-112800677 TTCCCATCTCCTGCCCTGTGTGG + Intergenic
1089608872 11:119658334-119658356 AGGCCAAGTCCTGCTCTATGGGG - Intronic
1089690799 11:120185584-120185606 AGCCCAGCTGCTGTGGTGTGGGG - Intergenic
1089706056 11:120278649-120278671 AGCGCAGCTCATTCCCTGTGGGG - Intronic
1090250957 11:125251404-125251426 TTCTCAGCTCCAGCTCTGTGGGG + Intronic
1090304031 11:125674726-125674748 AGGCAAGCTCCTACTTTGTGAGG + Intronic
1091347834 11:134867158-134867180 AGCCGGGCTCCCGCCCTGTGAGG + Intergenic
1091542018 12:1470557-1470579 AGCCCTGCTGCTGCTCTGATGGG + Intronic
1091910167 12:4224085-4224107 AGCCCAGCATCTGCTTTGTAGGG + Intergenic
1094845727 12:34360609-34360631 AGCCCAGCGCCTGAGCAGTGGGG + Intergenic
1096592031 12:52666628-52666650 AAGACAGCTCCTGCACTGTGGGG + Intergenic
1096712009 12:53464497-53464519 ATGCCAGCTCCTGGTCAGTGTGG - Intronic
1097170977 12:57112447-57112469 AGCCCAGCCCCTGCTATGGGAGG - Intronic
1097412181 12:59268529-59268551 AGCAGAGCTCAAGCTCTGTGGGG - Intergenic
1097721356 12:63025062-63025084 ATCCCAGCTCCCTCTCTTTGAGG - Intergenic
1099005038 12:77225629-77225651 AGCCCCGCACCACCTCTGTGAGG - Intergenic
1100326374 12:93543509-93543531 AGCCCCTCTCCTGCTCTCAGAGG - Intergenic
1101837084 12:108303243-108303265 AGCCCAGCCCCTGCTGGGGGTGG + Intronic
1102141948 12:110622518-110622540 AGCTCAGCTCCTGTTTTCTGGGG - Intronic
1102554652 12:113719044-113719066 GGCCCAGCTCCTGTCCTGGGAGG + Intergenic
1103480409 12:121246840-121246862 AGCCCAGTGCCTGCTCTCAGGGG - Intronic
1103565479 12:121813082-121813104 AGCCCAGGACCTGCCCAGTGCGG - Intronic
1105605634 13:21924348-21924370 AGCCCAGCTTCTGCTCAGTCTGG - Intergenic
1106396049 13:29382036-29382058 AACACACCTCCAGCTCTGTGAGG - Intronic
1106447337 13:29848690-29848712 AGCCCAGCCCCAGCACTGTAAGG + Intronic
1108388496 13:49924289-49924311 AGACAAGGTCTTGCTCTGTGTGG + Intronic
1108395074 13:49983954-49983976 AGCCCAGCTCCTGCTCTAGATGG - Intergenic
1111995141 13:95158256-95158278 TGCCCAGATCCTCATCTGTGTGG - Intronic
1113164810 13:107428213-107428235 AGCCCTGCAACAGCTCTGTGAGG + Intronic
1113400604 13:109989254-109989276 ATCCCAGCTCCAGCTCCCTGGGG + Intergenic
1113401631 13:109999723-109999745 AGCCCAGCCTCAGCTCTGTGAGG - Intergenic
1113783202 13:112988355-112988377 AGGCCAGCACCTGCCCGGTGTGG + Intronic
1113783255 13:112988561-112988583 AGCCCATCCCCTGCTCAGGGAGG - Intronic
1113783313 13:112988782-112988804 AGCCCATCCCCTGCTCAGGGAGG - Intronic
1113940668 13:114017136-114017158 AGCCCAGCTCGTGGTCTGGCTGG + Intronic
1114127814 14:19750744-19750766 AGCCTAGTTCCTAGTCTGTGAGG - Intronic
1114460939 14:22885940-22885962 AGCCCTGTTCCTCCTCTTTGAGG + Intronic
1114648560 14:24269149-24269171 GCACCAGCTCCAGCTCTGTGGGG + Exonic
1116643550 14:47497054-47497076 TGCTCACCTCCTGCTGTGTGGGG + Intronic
1117773379 14:59157206-59157228 AGCCAATCTCCTGATCTCTGGGG + Intergenic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1118735005 14:68694917-68694939 AGCCCAGCGCCTCCTGTGTGGGG - Intronic
1119067927 14:71549371-71549393 GGGACAGCTCCTTCTCTGTGAGG - Intronic
1119432213 14:74575799-74575821 AGCCCTGCTCATGCTTTTTGAGG - Intronic
1120723824 14:87916340-87916362 AGACCCTCTCCTGCCCTGTGCGG - Intronic
1121279938 14:92690923-92690945 AACCCCTCTCCTGCTCTCTGGGG - Intergenic
1121448212 14:93991741-93991763 ATCCCAGCTCCTCCTCAGAGTGG - Intergenic
1121694353 14:95900623-95900645 AGCCCACCTCCTGCCCTGGCTGG - Intergenic
1121704751 14:95983181-95983203 AGCCCAGCTCCAACACTGAGTGG - Intergenic
1122520144 14:102337800-102337822 CCCCCATCTCATGCTCTGTGGGG + Intronic
1122780962 14:104143353-104143375 AGCCCTCCTACCGCTCTGTGTGG + Intronic
1122852445 14:104544016-104544038 AGCCCAGTCCCAGCTCTGGGAGG + Intronic
1122986881 14:105216562-105216584 TGCCCAGGTGCTACTCTGTGAGG - Intronic
1123019627 14:105391580-105391602 AGCCCACCTGCTGCTCTGCCCGG - Intronic
1123059630 14:105588689-105588711 ACCCCAGTTCCTGCTCTGGGTGG + Intergenic
1123083957 14:105708938-105708960 ACCGCAGCCCCTGCTCTGGGTGG + Intergenic
1123208695 14:106738262-106738284 AGCTCAGCTCCTGCCCTGCAGGG + Intergenic
1123571263 15:21612194-21612216 AGCCTAGTTCCTAGTCTGTGAGG - Intergenic
1123607377 15:22047546-22047568 AGCCTAGTTCCTAGTCTGTGAGG - Intergenic
1124075861 15:26443636-26443658 CGTCCAACTCCTGCTCTGTAGGG - Intergenic
1124624498 15:31300260-31300282 GGCCTGGCTCCTGCTATGTGGGG + Intergenic
1125349657 15:38753691-38753713 AGCCCAGAACCTCCTGTGTGGGG + Intergenic
1125610104 15:40963993-40964015 AGCCAAGCTCCTTTCCTGTGGGG - Intergenic
1126368144 15:47917430-47917452 TGCCCAGCTCCTGCTCTTCTAGG - Intergenic
1127835909 15:62791028-62791050 AGCCAAGCTGCTGCTCTTTTGGG - Intronic
1128049512 15:64651606-64651628 TGCTCAGCTCCTGTTCAGTGTGG + Intronic
1128065853 15:64764020-64764042 AGCACAGCTCATTCTCTGTTTGG - Intronic
1128584182 15:68833415-68833437 AGCTCAGAACCTGCACTGTGAGG - Intronic
1128738432 15:70066704-70066726 TGCCCTGCCCCTGCTCTGTAAGG - Intronic
1129002931 15:72348977-72348999 AGCTCAGCTGCTGCTCTCAGGGG - Intronic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1130093568 15:80840245-80840267 ATCTCTGCTCCTACTCTGTGTGG - Intronic
1130302151 15:82688554-82688576 AGCCCAGCTTCCACTCTCTGAGG + Intronic
1130332442 15:82932892-82932914 AGCCCAGCTTTGGCTCTGTGTGG - Intronic
1130460420 15:84155572-84155594 GTCCCAGCTCCAGCTCTGGGAGG - Intergenic
1130893048 15:88149685-88149707 AGCCCAGCTCCTGCTCAGAAGGG + Intronic
1130965089 15:88691235-88691257 AGCCCAGCTCCTGCTCTTAAAGG + Intergenic
1131798545 15:96046048-96046070 TGCCCAGCTCGTGCTAGGTGTGG + Intergenic
1132336372 15:101050932-101050954 TGCCCAGCACCTGCTGTGTGGGG - Intronic
1202979614 15_KI270727v1_random:339320-339342 AGCCTAGTTCCTAGTCTGTGAGG - Intergenic
1132540383 16:505707-505729 GGCCAAGCCCCTGCTGTGTGAGG - Intronic
1132774826 16:1587559-1587581 GGGCCATCTCGTGCTCTGTGTGG - Intronic
1134051507 16:11140936-11140958 AGCTAAGCTCCTGCTGTGTGAGG - Intronic
1135143575 16:19942118-19942140 AGGCCACCTACTGCTCTCTGTGG + Intergenic
1136535397 16:30896464-30896486 AGCTCAGCTCCTCGTCCGTGGGG - Intergenic
1137406363 16:48192597-48192619 CGCCCTGCTCCTCATCTGTGTGG - Exonic
1137856405 16:51798677-51798699 AGATCAGCTCTTTCTCTGTGTGG - Intergenic
1138328170 16:56192141-56192163 AGCCCAGGCTCTGCTCTCTGGGG + Exonic
1139586992 16:67910340-67910362 TTCCCAGCATCTGCTCTGTGGGG + Intronic
1139927218 16:70496236-70496258 AACCCAGCTCGTGAGCTGTGGGG + Intronic
1140814281 16:78606478-78606500 TGCCCTGCTCCTGCTATGTCCGG + Intronic
1141443506 16:84043965-84043987 AGCCGAGTTCCTGCTTGGTGCGG - Intergenic
1141774046 16:86110519-86110541 AGCCCAGTTCCAGCTCCATGAGG - Intergenic
1142088373 16:88196787-88196809 TCTCCGGCTCCTGCTCTGTGTGG - Intergenic
1142345288 16:89550107-89550129 GGCCCTGCTCCTGCCCCGTGTGG - Intronic
1143056643 17:4167684-4167706 CCGCCAGCTCCTGCTCTGGGTGG + Exonic
1143066039 17:4248211-4248233 AGCTCACCTCCTGCTGGGTGTGG - Intronic
1143213976 17:5210321-5210343 CACCCACCTCCTGCACTGTGAGG - Exonic
1143305206 17:5941192-5941214 AGCTCTGATCCTGCTCAGTGAGG + Intronic
1143733532 17:8894717-8894739 TCCCCAGCCCCTGCTCTGTGAGG - Intronic
1144463684 17:15479381-15479403 AGCCCAGCTTCACCTCTGTCAGG + Intronic
1144667504 17:17112008-17112030 TACCCAACACCTGCTCTGTGGGG - Intronic
1144820141 17:18067062-18067084 AGCCCAGCTGCTGTCATGTGAGG + Exonic
1144944670 17:18963799-18963821 AGCCCAGCTCCATCATTGTGGGG + Intronic
1145934320 17:28706022-28706044 GGCCAAGCTGCTGCACTGTGAGG - Intronic
1145984249 17:29034089-29034111 AGCCCAGTGCCTGCTCATTGTGG + Intronic
1146563214 17:33889573-33889595 AGCTAAGCTCCTTCTCTTTGTGG - Intronic
1146923188 17:36727435-36727457 AGCCCCACTCTTGCCCTGTGTGG + Intergenic
1148471509 17:47896452-47896474 AGCCCCGCTCCTCCTCCGGGCGG - Intronic
1148842197 17:50506196-50506218 AGCCCCTCTCCTGCTCTCCGAGG - Intergenic
1149785540 17:59431598-59431620 AGACCAGGTCTTGCTCTGTCAGG - Intergenic
1150010153 17:61495611-61495633 TGTCCAGCTACTGCTCTGTATGG + Intergenic
1150105939 17:62462529-62462551 ACCCCAGCCCCTGCTCTTAGGGG - Intronic
1151431425 17:74066179-74066201 AGGGAAGCTCCTGCGCTGTGGGG + Intergenic
1151441246 17:74130582-74130604 CGTCCAGCTCCTGCTCTGCACGG - Intergenic
1151749786 17:76029977-76029999 ACCACAACTCCTGCTGTGTGTGG + Intergenic
1152162555 17:78677914-78677936 GGACCAGCTCCACCTCTGTGGGG + Intronic
1152536635 17:80953862-80953884 AGCCCTGCTCCTCCGCTGGGAGG - Intronic
1152594065 17:81229649-81229671 AGCCCAGCAGCTGCTCTCGGTGG - Intronic
1152892391 17:82890027-82890049 GAGCCAGCTCCTGCTCTGTGTGG - Intronic
1203167249 17_GL000205v2_random:108884-108906 AGACCAGCTCCTGCCCTGATGGG + Intergenic
1154092258 18:11376579-11376601 AGCCCAGGTTCTGCCATGTGAGG - Intergenic
1154389236 18:13922380-13922402 TGCCCAGCAGCTGCTCTGAGGGG + Intergenic
1156449646 18:37259645-37259667 TGCCCTGCCCCTGCTCTGGGGGG + Intronic
1157606981 18:48932006-48932028 GCCCCATCTCCTGCTCAGTGGGG - Intronic
1158558137 18:58491908-58491930 AGCCCAGCTGCTCCTCTGAATGG - Intronic
1159974458 18:74692864-74692886 TGCCCTTCTCCTGCTGTGTGAGG + Intronic
1160084588 18:75764049-75764071 ACCCAAGCTCCTAATCTGTGAGG - Intergenic
1160532190 18:79571995-79572017 AGCCCAGCTCCTGGTGTCTCGGG - Intergenic
1160554874 18:79718442-79718464 ACCCCTGCATCTGCTCTGTGTGG - Intronic
1160686312 19:438569-438591 CCCCCAGCTCCTGCTCAGCGGGG + Intronic
1160711113 19:551308-551330 AGCCGTGCTCCTGCTCCGGGGGG + Intergenic
1160841404 19:1148434-1148456 AGCCCAGCTGCTGCCCTCTGTGG + Intronic
1161014665 19:1977838-1977860 AGCCCAGGTCCTGTTCCCTGGGG - Intronic
1161058710 19:2203505-2203527 AGCCCCACTCCTGCTCAGTATGG - Intronic
1161083110 19:2321283-2321305 ACCCCAGCTCCTGCTGTCTTGGG + Intronic
1161336155 19:3714738-3714760 AGCCCAGCCCCTGCTATCTCTGG + Intronic
1161669681 19:5599193-5599215 AGACCAGCTCCGGAGCTGTGTGG - Intronic
1161811705 19:6475303-6475325 AGCCCAGGCCCTGCTCTTCGGGG - Exonic
1162025007 19:7888732-7888754 ACCCCAGCTCCTGGTGTGTCGGG - Intronic
1162478413 19:10914404-10914426 ACCCCACCTCCTGGACTGTGAGG - Intronic
1162520352 19:11175898-11175920 GTACCAGCTCCCGCTCTGTGAGG + Exonic
1162726105 19:12690430-12690452 AGCCCCGCTCCAGCTCTGCCTGG + Intronic
1162812062 19:13170186-13170208 AGCCCATCCTCTGCTCTGGGTGG + Intergenic
1163042168 19:14610565-14610587 AGCCCAGTCCCAGCTCTTTGTGG - Intronic
1163174828 19:15556976-15556998 ACCCCAGCTCCCTCTCTCTGGGG + Intergenic
1163647570 19:18498593-18498615 AGCCCAGCTGCTGGTCATTGGGG - Intronic
1163663707 19:18593446-18593468 ACCCCAGCTCCTGCTGAGGGTGG + Exonic
1163818644 19:19483416-19483438 AGCCCAGAGCCTGCTTTGTGGGG - Intronic
1164593098 19:29516917-29516939 AGCACAGCTCCTGCCCTGGAAGG + Intergenic
1165482288 19:36071710-36071732 AGCCCAGGTACTGCCCTGTGGGG + Exonic
1166504990 19:43365431-43365453 AGCCCAGAACCTGTGCTGTGGGG - Intergenic
1166505549 19:43369483-43369505 AGCCCAGAACCTGTGCTGTGGGG + Intergenic
1166729348 19:45049952-45049974 ACCCCAGCTCCTTCACTCTGTGG - Intronic
1167096502 19:47377460-47377482 AGCCCAGCCCCTGCCCTCTCGGG + Intronic
1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG + Intergenic
1167614230 19:50523079-50523101 ACCCCAGCTCCAGCCCTGAGAGG - Intronic
925235712 2:2275613-2275635 ACACCAGCTCCTGCTCTGAGAGG + Intronic
925424942 2:3741557-3741579 CCCCCATCTCATGCTCTGTGAGG + Intronic
926559332 2:14398767-14398789 AGGCCAACCCCTGCTCTGTTTGG + Intergenic
926694645 2:15762802-15762824 ATACGAGCTCCTGCTCTGTCTGG + Intergenic
927497970 2:23563374-23563396 TGCACAGCCCCTGCTCGGTGAGG - Intronic
927827012 2:26316152-26316174 AGCACAGCTGCTCCTCTGGGTGG - Intronic
928262245 2:29778442-29778464 ACTCCACCTCCTGCTCTGTTGGG - Intronic
928337100 2:30407548-30407570 AGCCCAGCTGCTTCTCTGGAAGG + Intergenic
928339009 2:30425313-30425335 AGCCCAGGTCCTACCCTGTCTGG - Intergenic
928352690 2:30574985-30575007 AGCTCAGGTCCTAGTCTGTGTGG + Intronic
929827804 2:45323109-45323131 AGGCCAGCTCCCTCTCTGGGAGG - Intergenic
929922276 2:46181108-46181130 AGTCCAGTGCCTGCTCTGTGCGG + Intronic
930032765 2:47068629-47068651 CCCCCAGCACCTGCTCAGTGGGG + Intronic
931668561 2:64627094-64627116 AGTCCAGCCCATGCTCTGAGTGG - Intergenic
932288776 2:70557721-70557743 AGCCCAGTTACTGCTCCCTGGGG - Intergenic
932627264 2:73307819-73307841 AGCCCAGCTCCTGCTCAGCGCGG - Intergenic
932885996 2:75549709-75549731 AGCTGAGCTGCTGCTTTGTGTGG + Intronic
933937432 2:87217812-87217834 AGCCAAGCCCCTGCACGGTGTGG + Intergenic
934204059 2:89910663-89910685 GCCCCAGCTCCTGCTCTGCCTGG + Intergenic
935588801 2:104826083-104826105 TGCCCAGCTACAGCTCTGGGTGG - Intergenic
936164100 2:110105229-110105251 GGCCCAGCCCCTACTCTGGGAGG - Intronic
937043939 2:118841299-118841321 AGAGCAGCTCCTGCTCTGGAAGG + Intergenic
938324322 2:130388042-130388064 GGCCCAGCATCTGCTCAGTGTGG - Intergenic
938607634 2:132912210-132912232 AGCCAAGCTCTCGCTCTCTGTGG + Intronic
938914327 2:135920016-135920038 AGCTCTGCTCCTTCTCTGTGTGG - Intronic
939279029 2:140038685-140038707 AGCCCAGATCTAGCACTGTGTGG - Intergenic
940001419 2:148969946-148969968 AGCCCAGCTCCTGCCCAGAGAGG - Intronic
941534107 2:166702427-166702449 AGGCCAGCTCCTTTTCTGGGAGG - Intergenic
944763799 2:202843811-202843833 AGCCAAGCTCTTGCTGTGTGTGG - Intronic
945933597 2:215881017-215881039 AGCCCTGCTTCTGTTATGTGGGG - Intergenic
946133889 2:217629514-217629536 AGCCCAGCTCCTGCTCTGTGGGG - Intronic
946788459 2:223273699-223273721 GCCCCAGCTGCTGCCCTGTGGGG - Intergenic
947629777 2:231644644-231644666 AGCCCTGCACATGCTCTGCGAGG + Intergenic
947817061 2:233044629-233044651 GGCTCAGAGCCTGCTCTGTGGGG + Intergenic
948294363 2:236849660-236849682 ATGGCAGATCCTGCTCTGTGAGG + Intergenic
948370786 2:237487818-237487840 AGACCAGCTCCTGGGCTGGGAGG - Intronic
948436444 2:237956816-237956838 ACACCAGCTGCTGCTCTGGGCGG - Intergenic
948565428 2:238883320-238883342 AGCCCATCTGCAGCCCTGTGGGG - Intronic
948894338 2:240921333-240921355 ACCCCAGCTCCTGCCCTCAGGGG - Intronic
1168765777 20:381042-381064 AGCCCAGCTCCAGCCCTGCCCGG - Exonic
1168969157 20:1918990-1919012 GTCCCAACTCCTGGTCTGTGAGG - Intronic
1170770572 20:19328891-19328913 AGCCCAGCCCAGGCTCTGCGAGG + Intronic
1172484839 20:35291911-35291933 AGCCCAGGTCCAGGTCTGGGGGG + Exonic
1172505793 20:35461492-35461514 GGCCCAGCTCCTGGTGGGTGAGG + Intronic
1173185401 20:40836489-40836511 CCCTCAACTCCTGCTCTGTGAGG - Intergenic
1173986852 20:47268006-47268028 AGCGCAGATCCTGCTCTTTCAGG - Intronic
1174146682 20:48456879-48456901 AGCCCAGAACCTGTTGTGTGAGG + Intergenic
1174151742 20:48490613-48490635 AGCCCAGAACCTGTTGTGTGGGG + Intergenic
1174162029 20:48557981-48558003 AGCACAGCTCCAGATCTCTGCGG - Intergenic
1174867065 20:54147781-54147803 ATCCCAGCTCCTCTGCTGTGTGG - Intergenic
1175896441 20:62337894-62337916 AGCCCTGGACCAGCTCTGTGGGG - Exonic
1175912245 20:62410515-62410537 AGCCCAGCACCTGCTCCCTGAGG - Exonic
1176168715 20:63687630-63687652 AGCTCAGCACCTTCCCTGTGGGG - Exonic
1176211785 20:63927416-63927438 ATCCCAGCTACTCCTGTGTGAGG + Intronic
1176334312 21:5581657-5581679 AGCCCAGCTCCTGCCCTGATGGG - Intergenic
1176393445 21:6239295-6239317 AGCCCAGCTCCTGCCCTGATGGG + Intergenic
1176404509 21:6350215-6350237 AGACCAGCTCCTGCCCTGATGGG - Intergenic
1176432648 21:6638889-6638911 AGACCAGCTCCTGCCCTGATGGG + Intergenic
1176467974 21:7076879-7076901 AGCCCAGCTCCTGCCCTGATGGG - Intronic
1176491535 21:7458657-7458679 AGCCCAGCTCCTGCCCTGATGGG - Intergenic
1176509107 21:7679726-7679748 AGCCCAGCTCCTGCCCTGATGGG + Intergenic
1177629977 21:23714362-23714384 AGCCCATCACCTGTCCTGTGAGG - Intergenic
1178705287 21:34867999-34868021 CTCCCAGCTGCAGCTCTGTGTGG - Intronic
1179044843 21:37834807-37834829 AGTCAAGGACCTGCTCTGTGAGG - Intronic
1179709486 21:43204866-43204888 AGCCCTGCACTTGCTCTGTGGGG - Intergenic
1182361405 22:29748547-29748569 AGCAAAGCACCTGCTCTGAGTGG - Exonic
1182366433 22:29782460-29782482 AGCCTAGCCCCTGCTCTGAATGG + Intergenic
1183218027 22:36493789-36493811 ACCTCACCTCCTGTTCTGTGGGG + Exonic
1183468527 22:37992930-37992952 AGGCAAGCTCCTGCTGTCTGTGG + Intronic
1184172905 22:42769881-42769903 AGGCCTGCTCCTGGGCTGTGGGG - Intergenic
1184331108 22:43828451-43828473 AGGCCAGTTCCTGCTCTTGGCGG - Intronic
1185375039 22:50478741-50478763 AGCCCAGCGCCAGCTCTGGAGGG - Intergenic
949800404 3:7897770-7897792 AGCCCAGATCCTGGCCTGTTAGG + Intergenic
950185619 3:10943644-10943666 ATCCAAGCTCCTGTCCTGTGGGG - Intergenic
953248867 3:41224633-41224655 ACCACAGCTCCTTCTCTGAGTGG + Exonic
953546566 3:43867763-43867785 AGCCCTGCTACTGAGCTGTGTGG - Intergenic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954662950 3:52235902-52235924 AGCCCAGATACAGCCCTGTGGGG + Intronic
954674419 3:52307889-52307911 GGCCCTGCTCCGTCTCTGTGTGG + Intergenic
955232005 3:57107780-57107802 AGCCCTTCACCTTCTCTGTGTGG + Intronic
956712206 3:72048630-72048652 AGCCCAGCCTCTGCTGTGTGAGG + Intergenic
956969202 3:74502590-74502612 ACCCCAGCTCCTGATCTCTGAGG + Intronic
959585498 3:108021795-108021817 AGCCCATCCCCTCCTGTGTGAGG + Intergenic
960984941 3:123271806-123271828 AGCAGAGCTTCTCCTCTGTGGGG - Exonic
961490549 3:127254180-127254202 AGAGCAGCTCCTGGTATGTGGGG + Intergenic
961514248 3:127422969-127422991 AGCCCTGCTGCTTCTCTGTGAGG + Intergenic
961522039 3:127472602-127472624 AGCCCAGCTCTTCCTCAGTGGGG - Intergenic
962350380 3:134651727-134651749 AGCCTGGCTCCTGCCCTGTGGGG + Intronic
962448648 3:135492764-135492786 CGGCCAGCTCCTGGGCTGTGGGG - Intergenic
963994333 3:151690099-151690121 AGCCCAGTTCATTTTCTGTGTGG + Intergenic
966681471 3:182645911-182645933 AGCCCAGCTCCTGCCCTTTGGGG + Intergenic
967610436 3:191499681-191499703 AGCCCAGCTTCTGCTGTATGAGG + Intergenic
968076387 3:195817876-195817898 GGCCCAGCACCTGCTGTATGTGG + Intergenic
968126525 3:196164178-196164200 AGCCCTGCACCTGCTCTGTGGGG + Intergenic
968574258 4:1357713-1357735 AGCCTGGCTCCTGCCGTGTGTGG + Intronic
968576808 4:1370439-1370461 TCCCCATCACCTGCTCTGTGTGG + Intronic
968867049 4:3219855-3219877 AGCACAGCACCTGCTGTTTGTGG + Intronic
968867916 4:3225571-3225593 AGCCCAGCTCCTGCCCAGACAGG - Intronic
968961054 4:3743930-3743952 AGCCCGGCTCCTGCCCTCTAGGG + Intergenic
969272292 4:6111083-6111105 AACTCAGCCTCTGCTCTGTGTGG + Intronic
971237634 4:24856924-24856946 AGCCCAGCGCTTGCTCGGTCTGG + Intronic
972390331 4:38607430-38607452 AGCCCAGGTCCAGGGCTGTGTGG - Intergenic
973650633 4:52994056-52994078 AGCCCCACTCCTGGCCTGTGGGG - Intronic
977707580 4:100088534-100088556 AGCCCCGCTCCAGCTGTGTGTGG + Intergenic
977871495 4:102095916-102095938 AGCCCAGCTGCTGCCCAGTTTGG + Intergenic
981362563 4:143864210-143864232 AGCTCAGCTCAGGATCTGTGAGG - Intergenic
981382388 4:144088252-144088274 AGCTCAGCTCAGGATCTGTGAGG - Intergenic
985485236 5:145089-145111 AGTCCAGCTCTTGCTCTCTGGGG + Intronic
985615139 5:915660-915682 TCCTCAGCTCCTGCTCTGGGAGG - Intronic
985760959 5:1748434-1748456 AGCCCTGCTTCTTCTATGTGGGG + Intergenic
986065653 5:4231289-4231311 AGGGAAGCGCCTGCTCTGTGTGG + Intergenic
986794947 5:11201000-11201022 TGCCCAAGTGCTGCTCTGTGAGG + Intronic
988202346 5:28083866-28083888 AGCCCTGCTGCTGTTATGTGGGG - Intergenic
989346319 5:40433865-40433887 AGAACAGCTCTTGCTGTGTGGGG + Intergenic
990513962 5:56515038-56515060 ACCCCTGCTTCTGCTCTGTCCGG - Intronic
990654518 5:57940235-57940257 AGCCCAGCTACTGGATTGTGAGG - Intergenic
991222897 5:64236717-64236739 AGGCCCCCTGCTGCTCTGTGCGG + Intronic
992459888 5:76951221-76951243 ATCCCAGCTCTTGCTGTGTGTGG + Intergenic
993049787 5:82912946-82912968 GCCCTACCTCCTGCTCTGTGAGG - Intergenic
994681981 5:102899657-102899679 ATCCCAGCTCCTGCACTTTTTGG + Intronic
995048375 5:107673541-107673563 AGCCCGACGCCTGCTCTGCGGGG + Intergenic
995279991 5:110323345-110323367 AACCCAGCCCCTGTGCTGTGAGG - Intronic
995625392 5:114070561-114070583 GAACCAGCTCCCGCTCTGTGAGG - Intergenic
998092844 5:139381113-139381135 CCACCAGCTCCTGCACTGTGAGG + Intronic
998470770 5:142382209-142382231 AGCCCTTCTCCTGCCCTCTGAGG + Intergenic
1000275618 5:159732369-159732391 AGCCCACATCCTGTCCTGTGGGG + Intergenic
1000367853 5:160507535-160507557 AGGCAAGTTCCTTCTCTGTGAGG - Intergenic
1001584654 5:172825464-172825486 TGCCCAGCTTCTGCCCTGAGTGG - Intergenic
1002640652 5:180629120-180629142 TGCCCAGCTCCTGCACCGGGCGG - Intronic
1002758636 6:184477-184499 AGCCCAGCTCCTGTCTTGTCTGG + Intergenic
1002931900 6:1640665-1640687 AGCCCTGGGCCTGCGCTGTGGGG - Intronic
1005883383 6:30076151-30076173 AGCACAGATCCTGGTTTGTGTGG + Intergenic
1006630602 6:35427401-35427423 AGCCCAGCACCTGCTCCCAGTGG + Exonic
1007365540 6:41389317-41389339 AGCCCAGCTGCTGGTGTCTGGGG - Intergenic
1007396217 6:41579209-41579231 TGCCCAGCTCCTCCCCTTTGAGG - Intronic
1007655899 6:43450834-43450856 AGACCAGCCCCTGCGCTGTGGGG + Exonic
1008965562 6:57310850-57310872 TGCCCAGCTGCTGCCCTGTCTGG - Intergenic
1011068753 6:83359113-83359135 TGCCCAGCCCCTGCCCTGTCTGG - Intronic
1012259115 6:97067303-97067325 AGCACTGCTCCTGCCATGTGGGG - Intronic
1013592426 6:111630655-111630677 AGCCCAGCCCCCACTCTGTCAGG + Intergenic
1014155926 6:118109749-118109771 AGCCCAGCTCCTGGTGTGTCTGG - Intronic
1015347896 6:132180753-132180775 AGCCCAGCAGCTTCTCTGGGTGG + Intergenic
1015488554 6:133799821-133799843 AGACCAGCTCCTGGTCCCTGTGG + Intergenic
1015989534 6:138922679-138922701 GGCCCAGCTCCTTCTATGAGGGG + Intronic
1017914298 6:158819431-158819453 CGCCCAGCTCCCGACCTGTGAGG + Intergenic
1018212587 6:161496644-161496666 GGCCCAGCCCTTGATCTGTGGGG + Intronic
1018433833 6:163744001-163744023 AGCTCTGATCCTCCTCTGTGGGG + Intergenic
1018946274 6:168348436-168348458 AGCTCCGACCCTGCTCTGTGTGG - Intergenic
1019613513 7:1948510-1948532 AGGCCAGCTCCGGAGCTGTGCGG - Intronic
1019919066 7:4151249-4151271 TGCACAGCTCCAGCTCTCTGTGG + Intronic
1021553232 7:21894180-21894202 TGCCCAGCCCCTGGTTTGTGTGG + Intronic
1022024264 7:26431110-26431132 AACCCACCTCCTGCTGTGTGAGG + Intergenic
1022885599 7:34640126-34640148 TGCCCAGCTTCTGTTCTTTGTGG + Intergenic
1022962703 7:35444850-35444872 AGCCCAGCTACTGCTTTTTTGGG - Intergenic
1024307127 7:47938383-47938405 TACCCAGGTCCTGCTCTGGGAGG - Intronic
1024544567 7:50506241-50506263 ACCCCAGCATCTCCTCTGTGGGG - Intronic
1027189867 7:75990284-75990306 AGCCTGACTCCTGCTCTATGGGG + Intronic
1027198553 7:76048063-76048085 TGCCCAGCGCCTGCTCTCTGGGG - Exonic
1029732269 7:102446421-102446443 GGCCCAGCCCCTGCTCTGCCTGG + Intronic
1030520440 7:110591066-110591088 AGCCTTGCTCCTGCTTTCTGGGG - Intergenic
1032035099 7:128515734-128515756 ACCCCAGCCCCTGCTCTTAGGGG - Intergenic
1032312743 7:130803469-130803491 CTCCCAGCTCCTGCTGTCTGAGG - Intergenic
1032418343 7:131756178-131756200 TGCCCAGCTTCTGCCCTGTCTGG - Intergenic
1034266945 7:149785649-149785671 TGCCCAGAACCTGCCCTGTGGGG + Intergenic
1034331629 7:150288124-150288146 TGCCCTGGCCCTGCTCTGTGGGG - Intronic
1034838324 7:154372758-154372780 AGTGCAGGTTCTGCTCTGTGAGG + Intronic
1036018386 8:4813298-4813320 ATCACAGCCCCGGCTCTGTGGGG - Intronic
1036125059 8:6054983-6055005 CTCCCAATTCCTGCTCTGTGGGG - Intergenic
1036454600 8:8895472-8895494 AGCCCATTTCCTCCTCTGTGGGG - Intergenic
1036997813 8:13679240-13679262 AGCTCAGCTCCTGATCCTTGAGG + Intergenic
1037027638 8:14058897-14058919 AGCCCAGGTCATGCAGTGTGTGG + Intergenic
1037661388 8:20929861-20929883 CGCCCACGTCCTGCTCTGCGTGG + Intergenic
1038671957 8:29589883-29589905 AGCCCTGCTCCTCATCTCTGGGG - Intergenic
1041009832 8:53530851-53530873 GGCCCAGCGCAGGCTCTGTGAGG + Intergenic
1041459684 8:58098054-58098076 AGCAGAGCTCAAGCTCTGTGCGG + Intronic
1041636135 8:60147062-60147084 AGCCAAGTTCCTTCTCTATGTGG - Intergenic
1044749601 8:95403276-95403298 AGCCCTGCTCATGCTGCGTGAGG + Intergenic
1047767314 8:128000416-128000438 AGGCCAGCACCTGCTCTGAATGG + Intergenic
1049662013 8:143823731-143823753 GGCCCAGCTCCACCTCTGAGAGG + Intronic
1049808792 8:144553913-144553935 AGCCCACATCGAGCTCTGTGTGG - Intronic
1049829648 8:144692269-144692291 TGCCCCGCCCCAGCTCTGTGGGG + Intergenic
1051802747 9:20954905-20954927 AAACCAGACCCTGCTCTGTGGGG + Intronic
1053220282 9:36306847-36306869 AGTTCATTTCCTGCTCTGTGTGG + Intergenic
1053422338 9:37987537-37987559 GTCCCAGCTCCAGCTCTGTCCGG + Intronic
1053462689 9:38282812-38282834 AGCCCCACTTCTGCTCTGTGTGG - Intergenic
1056119428 9:83472571-83472593 AGCCCAGCTCCTCCTCACTAGGG + Intronic
1056503350 9:87232544-87232566 ATCTCAGCTCCTTCCCTGTGGGG - Intergenic
1056530009 9:87478759-87478781 AGGTTGGCTCCTGCTCTGTGTGG - Intergenic
1059182071 9:112225729-112225751 AGCCCAGCTCCTGCGTGATGTGG + Intronic
1060527174 9:124327225-124327247 AGCCCAGGTCCTGCTCCCTCAGG - Intronic
1060801514 9:126548479-126548501 AGTCCGGCTTCTGCGCTGTGTGG - Intergenic
1060870089 9:127033039-127033061 TGTCCAGCACCTGCTCTGTGGGG + Intronic
1060990869 9:127848120-127848142 AGGCCGGCTCCTGCTAAGTGGGG + Intronic
1061371177 9:130198366-130198388 AGCCCCGCTCTGGCACTGTGAGG + Intronic
1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG + Intronic
1062308317 9:135921883-135921905 AGCTCACCTCCTGCTCTGGGTGG + Intergenic
1062721114 9:138044675-138044697 TGCCCAGCCCCTGCTCTGGCCGG - Intronic
1203427324 Un_GL000195v1:53260-53282 AGCCCAGCTCCTGCCCTGATGGG + Intergenic
1203438888 Un_GL000195v1:169823-169845 AGACCAGCTCCTGCCCTGATGGG - Intergenic
1185608845 X:1382318-1382340 AGCCCACGTCCTGATCTGCGGGG - Intronic
1191840646 X:65511412-65511434 ACTCCAGTGCCTGCTCTGTGGGG - Intergenic
1195570309 X:106392846-106392868 AGCCCATCTCCAGGTCTGTCAGG - Intergenic
1196015935 X:110939914-110939936 ACACCAGCTCCTGCCATGTGTGG + Intergenic
1196931025 X:120682149-120682171 AGCCCAGCTCCTGACATGTAGGG - Intergenic
1198206327 X:134468497-134468519 GTCCCAGCTACTGCTTTGTGAGG + Intronic
1199875153 X:151922719-151922741 AGCCAAGCCCATGCTCTCTGGGG - Intronic
1200018268 X:153181442-153181464 GGCCCAGCCCATGCTCTCTGGGG - Intronic
1200142704 X:153909856-153909878 AGCTCAGCTCCTGGGCTGTGCGG + Exonic
1200208244 X:154333009-154333031 AGCCCAGGTCCTGCCCTGAGCGG - Intergenic
1202378832 Y:24259608-24259630 GTCCCAGCTCCAGCTCTGGGAGG + Intergenic
1202491950 Y:25410513-25410535 GTCCCAGCTCCAGCTCTGGGAGG - Intergenic