ID: 946134463

View in Genome Browser
Species Human (GRCh38)
Location 2:217634301-217634323
Sequence TTGGCTCCTGACCCTTTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946134458_946134463 13 Left 946134458 2:217634265-217634287 CCAAAATCTACTTTCTCATATCC 0: 1
1: 0
2: 2
3: 36
4: 407
Right 946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 141
946134456_946134463 27 Left 946134456 2:217634251-217634273 CCCTACAACTACTACCAAAATCT 0: 1
1: 0
2: 1
3: 17
4: 282
Right 946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 141
946134460_946134463 -8 Left 946134460 2:217634286-217634308 CCTTCAAACACTTCCTTGGCTCC 0: 1
1: 0
2: 1
3: 34
4: 258
Right 946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 141
946134457_946134463 26 Left 946134457 2:217634252-217634274 CCTACAACTACTACCAAAATCTA 0: 1
1: 0
2: 1
3: 16
4: 219
Right 946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946134463 Original CRISPR TTGGCTCCTGACCCTTTGGC CGG Intronic
908265960 1:62379539-62379561 TTGGCTCTTGACCCCCAGGCTGG - Intergenic
910866400 1:91792123-91792145 TTGGCTCCAGGCTTTTTGGCAGG - Intronic
912607584 1:111008186-111008208 TTTGTTCCTGAGCCTCTGGCTGG - Intergenic
914963117 1:152224407-152224429 CAGTGTCCTGACCCTTTGGCAGG - Intergenic
915056819 1:153140631-153140653 ATGGCTCTGGACGCTTTGGCAGG + Intergenic
917591125 1:176478149-176478171 ATGGCTCCTGACCCATAGTCTGG - Intronic
918246004 1:182659915-182659937 TTGCCTCATGAGCTTTTGGCAGG - Intronic
919694262 1:200557780-200557802 TTGGCTTCTGTCCCTCTGGGTGG - Intronic
919950296 1:202356849-202356871 TTTGCTCTTGACCCCTAGGCTGG + Intronic
923685579 1:236151139-236151161 CTGGGTCCTGACATTTTGGCCGG + Intronic
924190665 1:241548940-241548962 GTGGCTCCTGGCACTTTGGGAGG + Intronic
1064341486 10:14489662-14489684 TTGCTCCCTGACCCTTTGGCTGG + Intergenic
1065145869 10:22767503-22767525 TTGGCTCCAGTCCCATTGCCTGG + Intergenic
1065776004 10:29120961-29120983 AGGGCTTCTGTCCCTTTGGCTGG - Intergenic
1067691399 10:48504430-48504452 TTGGCTCCCTGTCCTTTGGCTGG - Intronic
1067806384 10:49395906-49395928 TCGGCTCCTGACCCACTCGCCGG - Intronic
1069709563 10:70479748-70479770 TTGGTTCCTGGGCCTCTGGCTGG - Intronic
1070773768 10:79098111-79098133 TTTTCTCCTGACCCTTAGGTAGG - Intronic
1070976725 10:80611254-80611276 TTGGCTCCTAAAGCTTTTGCAGG + Intronic
1071569697 10:86690241-86690263 CTGGCTCCTGACCCACTGGGAGG - Intronic
1074518636 10:114196874-114196896 TTGGCTCTTGACGCCTGGGCTGG + Intronic
1074988596 10:118681071-118681093 TTGGCTCTTGATCTTTTGGTGGG - Exonic
1075737787 10:124674664-124674686 CTGGCTCTTGCCCCTTTGACTGG - Intronic
1076995460 11:295467-295489 CTGGCTCCAGTCCCTCTGGCTGG - Exonic
1078581007 11:12539584-12539606 TTGGTTCCTGAGACTGTGGCTGG + Intergenic
1080119131 11:28656202-28656224 ATGGCTCCTAACACTTTGGGAGG + Intergenic
1080865688 11:36192822-36192844 TTGGCCCCTGAGGCTTTGGCTGG - Intronic
1083179154 11:60973096-60973118 TTTACTCCTGAGCCTGTGGCTGG - Intronic
1084288207 11:68145557-68145579 TTAGCACGTGACCCCTTGGCTGG - Intergenic
1085128512 11:74018290-74018312 TTGGGGCCTGACCCTTTGCCAGG - Intronic
1089399389 11:118155789-118155811 TTGGCTCCTGTCCCTTCTGCTGG + Intergenic
1091734605 12:2909643-2909665 TTGGCTCTGAAGCCTTTGGCAGG + Intronic
1096585164 12:52615174-52615196 TTGGCTCCAGGCCCTTCTGCGGG + Intronic
1103432594 12:120901692-120901714 TTAGCCCCTCAACCTTTGGCAGG - Intronic
1110149380 13:72231065-72231087 TTGCCTCCTGACCCTATAACAGG + Intergenic
1112330444 13:98473525-98473547 TTGGCTGTTGACCCTTTTCCTGG - Intronic
1113464097 13:110501896-110501918 ATGGCTCCTGCCTCTTTGACCGG - Intronic
1114789177 14:25636925-25636947 TTGTATCCTGACCCTATGACAGG + Intergenic
1115102238 14:29716402-29716424 TTGCCAGCTGACCCTTAGGCAGG + Intronic
1119001396 14:70885119-70885141 TGGGCTCTTGGCCCTTTGCCTGG - Intergenic
1121586382 14:95065712-95065734 TTTGCTCCAGACCCTTTAGGAGG + Intergenic
1132627716 16:899714-899736 TGGGCTGCGGACCCTCTGGCAGG + Intronic
1132694828 16:1197301-1197323 GTGGCTCTTGGCCCTTTGCCCGG + Intronic
1133997562 16:10759852-10759874 TTGGCTCTTGACACTGAGGCTGG - Intronic
1136933878 16:34440897-34440919 TTGTCTCCTGACATATTGGCTGG + Intergenic
1136970694 16:34970917-34970939 TTGTCTCCTGACATATTGGCTGG - Intergenic
1137246424 16:46709597-46709619 TTGGATCTTGAAGCTTTGGCAGG + Exonic
1137334963 16:47539190-47539212 CTGACTCCTGGCCCTTTGGTTGG + Intronic
1138265696 16:55657908-55657930 TTTGCTCCTGCCACTTTTGCTGG + Intronic
1139776243 16:69318770-69318792 TTGGCTCATGCCCCTTGGCCGGG + Intronic
1141729083 16:85809832-85809854 CTGGTCCCTGACCCTTTGCCTGG + Intergenic
1141904123 16:87011927-87011949 TTGTCTCCTGGCTCTTTGGATGG - Intergenic
1142559610 17:802421-802443 TTCGCTCCTGGCTCTCTGGCTGG - Intronic
1151402472 17:73864835-73864857 TTTTCTCCTGAGCCTTTAGCTGG - Intergenic
1151604212 17:75125973-75125995 TGGGCACCTGTCCCTCTGGCTGG + Intronic
1152239638 17:79154727-79154749 CTGGCCCCTGCCCCGTTGGCTGG + Intronic
1154108423 18:11545502-11545524 CAGGCTCCTGTCCATTTGGCAGG + Intergenic
1158521166 18:58172216-58172238 TTGGTTCCTGACCCTGTCGGCGG - Intronic
1159529214 18:69634643-69634665 TTGGCTGCTGACTCTTTGCTTGG + Intronic
1160012556 18:75116916-75116938 TTGGCTTCTGCCTCTGTGGCTGG - Intergenic
1162623173 19:11860973-11860995 TTGGCTCCCAACCCTTAGGTAGG + Intronic
1162935272 19:13978798-13978820 CTGGATCCTGACCCTCTGGTCGG + Intronic
1163145021 19:15374065-15374087 TTGGCTCCTCCCCCTGTGACAGG - Exonic
1163713935 19:18863279-18863301 TTGGGGCCTGTCCCTGTGGCTGG + Intronic
1164617678 19:29676612-29676634 TTTGATACTGACCCCTTGGCCGG - Intergenic
1165093214 19:33397213-33397235 TTGGCCCCTGATCCTAGGGCTGG - Intronic
1165813192 19:38624761-38624783 TAGGCACCTGACCATTTGGGTGG + Intronic
925858971 2:8156788-8156810 TTGGGTCCTGACCCCATGGTGGG - Intergenic
927359401 2:22215233-22215255 GTGGCTCCTAACACTTTGGGAGG + Intergenic
927381167 2:22480635-22480657 TTAAGTCCTGACCCTTTGGTTGG - Intergenic
927553142 2:24016207-24016229 GCGGCTGCTGACCCTGTGGCTGG + Exonic
927709507 2:25315892-25315914 TTAGCTTCTGACCCTTTCGAAGG - Intronic
931461373 2:62453166-62453188 TGGGCTCCTGACTCTTTCCCTGG + Intergenic
932475578 2:72003743-72003765 TTGGCAGCTGACCCTTGGGGTGG + Intergenic
934758323 2:96839686-96839708 CTGGCTCCTGACCCGAGGGCGGG - Intronic
937621696 2:123995580-123995602 TGGAGTCCTAACCCTTTGGCTGG - Intergenic
938378597 2:130824186-130824208 TTGAATCCTGACACTTTGGAGGG + Intergenic
941621319 2:167782394-167782416 TTGACTCCTGGCCCCTTTGCTGG - Intergenic
946134463 2:217634301-217634323 TTGGCTCCTGACCCTTTGGCCGG + Intronic
946179569 2:217941509-217941531 TTGGTTCCTTACACATTGGCAGG + Intronic
948933052 2:241144545-241144567 TGGGCACCAGACCCTTTGGCTGG - Intronic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1169615570 20:7440222-7440244 TTTGTCCCTGACACTTTGGCTGG - Intergenic
1172459553 20:35106762-35106784 TTTGCTCATGACCCTTTAGTGGG - Intergenic
1173807897 20:45938120-45938142 TTGGCTCCTGAGGCTGTTGCTGG + Intronic
1175958443 20:62623093-62623115 TTGGCTCCAGGGCCTATGGCAGG + Intergenic
1178676479 21:34635546-34635568 CTGCCTCCTTACCCTTTGGGTGG - Intergenic
1180123258 21:45768134-45768156 TTGCCTTCTCACCCTTTGGTGGG + Intronic
1181328190 22:22067560-22067582 TTGGCTCATTACCCTTTGCAAGG + Intergenic
1181785446 22:25223543-25223565 TTGTCTCCTGACCCTATCTCTGG + Intronic
1183858927 22:40654997-40655019 CTTGCTGCTGACCATTTGGCAGG - Intergenic
1184066761 22:42125773-42125795 TTGACTCCTGTCCCTAGGGCAGG + Intergenic
1184069229 22:42137925-42137947 TTGACTCCTGTCCCTAGGGCAGG + Intergenic
1184206225 22:43005437-43005459 TTGGCACCTGGCCCTTTTGTTGG - Intronic
1184426066 22:44410025-44410047 TGGGCTTCTGACCCTGTGGAGGG - Intergenic
1184567445 22:45300513-45300535 TTGGCTCCTGAGCTCTGGGCTGG + Intergenic
954868492 3:53749489-53749511 TTGGCTTCTGTCCCTTGGTCAGG + Intronic
954918786 3:54171649-54171671 TCTGCTCCTCACCCTCTGGCTGG - Intronic
955014438 3:55056048-55056070 TTGGATACTGACCCTTTTTCTGG - Intronic
955348662 3:58178820-58178842 TTAGCTTCTGACCCTGTGCCAGG - Intergenic
959158799 3:102698416-102698438 TCTGCTCTTAACCCTTTGGCTGG - Intergenic
959388477 3:105743064-105743086 TTTGCTGCTGACCCTTTGGCTGG + Intronic
967265003 3:187682778-187682800 TTGTCTCCTGGCACTTTGGGAGG + Intergenic
968130586 3:196190635-196190657 TTGGGCCCTGAGCCTTTTGCAGG - Intergenic
968183071 3:196611562-196611584 TTGGCTCCTAGCCCCTTGTCAGG + Intergenic
968549241 4:1213889-1213911 GGGGCTACAGACCCTTTGGCTGG - Intronic
968986107 4:3875303-3875325 CTGGCTCCTGTCCCTTTGACAGG + Intergenic
970603914 4:17661723-17661745 TGGCCTCCTAACCCTTGGGCTGG - Intronic
976273250 4:83250908-83250930 TTGTCTCCTGACTCTTTTCCTGG + Intergenic
976293455 4:83446334-83446356 TTGGCTCTTGACCCCCAGGCTGG + Intronic
980201130 4:129657484-129657506 TTTGCCCCTGACCCTCTGACAGG - Intergenic
983682558 4:170370760-170370782 TTGTCTCCTGATTCTTTTGCCGG + Intergenic
984406752 4:179342456-179342478 TTCTCTCCTGACCTTATGGCTGG + Intergenic
985669638 5:1200818-1200840 CTGGGTCCTGAACCTATGGCCGG + Intergenic
987395535 5:17419736-17419758 TTGGCTTCTCACCCACTGGCTGG - Intergenic
990327683 5:54694346-54694368 TTGGCTCCTGCCCAGCTGGCAGG - Intergenic
992266187 5:75020418-75020440 TAGGCTGCTGACCCTGTGGCTGG + Intergenic
992765332 5:79993437-79993459 TTGGCTCCTGTGCCTTTTCCTGG + Intronic
994677736 5:102846334-102846356 TTGGCTCCTGCCCTTTTCTCTGG + Intronic
1002692587 5:181060448-181060470 CTGGCTCCCTACCCTTTTGCCGG - Exonic
1003543638 6:7039946-7039968 TTGGTTCCTGAGCCATTAGCAGG - Intergenic
1004871653 6:19911035-19911057 TTGCCATCTGACCTTTTGGCTGG - Intergenic
1006251080 6:32786014-32786036 TTCTCTCCTGGCCCCTTGGCAGG - Intergenic
1007399356 6:41595022-41595044 TTGGCTCCTGCCCCCTGGGCAGG - Intronic
1009947106 6:70352785-70352807 TTTGCTTCTCACCCTGTGGCAGG - Intergenic
1016099085 6:140075234-140075256 TTTCCTCCTGACCTTTTGTCTGG + Intergenic
1022179714 7:27907362-27907384 TGTGCTCCTGACCCTTTCCCAGG + Intronic
1023223247 7:37943014-37943036 TGGCCTTCTGAGCCTTTGGCAGG + Intronic
1024336881 7:48217736-48217758 TTGGTTCCTGGCCCTTTGAAGGG + Intronic
1024426588 7:49232869-49232891 TTTGCTCCTGGCCATCTGGCTGG + Intergenic
1029027369 7:97431135-97431157 TTGGCTCCTGTTCCTCTGTCTGG + Intergenic
1036116295 8:5963794-5963816 ATGGCTCCTGGCCCTTCTGCAGG - Intergenic
1038694838 8:29797353-29797375 TTTGCTTCTGAACCTCTGGCAGG - Intergenic
1041950033 8:63490323-63490345 TTGGCTCCTCCCCCGTTGGTAGG + Intergenic
1043050455 8:75378899-75378921 TTGCCTCCTGTCCCCTTGCCAGG - Intergenic
1043954596 8:86345437-86345459 TTCACTCCTGTCCCTGTGGCTGG + Intronic
1049559026 8:143298375-143298397 TAAGCTCCTGACCCCTGGGCCGG + Intergenic
1050214597 9:3308507-3308529 TTGACTCTTGAACCTTTGCCAGG - Intronic
1051746660 9:20301175-20301197 TTGGCTTCTCAGCCTTTGGCAGG + Intergenic
1055356890 9:75446992-75447014 TTGGGCCCTGACACTTTGGGAGG + Intergenic
1058415874 9:104788171-104788193 TTGGCTCCTCACCAGTTGTCAGG - Intronic
1059373696 9:113864589-113864611 TTGTCTCATCACCCTTTGACAGG + Intergenic
1060854532 9:126904562-126904584 TGGGCTCCTGAATCTTTGGGAGG - Intergenic
1061071687 9:128314685-128314707 GTGGCTCCTGCCACTTTGGGAGG - Intronic
1062116859 9:134814284-134814306 TTTGCTCCTGGCCCCTTCGCGGG + Intronic
1062641945 9:137523277-137523299 GTGGCTCCTGACCCTCTCGGTGG - Intronic
1203779624 EBV:94044-94066 TTGGTTCCTGAACATCTGGCTGG + Intergenic
1185483965 X:468342-468364 TTCGCTCTTGTCCCTTAGGCTGG + Intergenic
1193246593 X:79237214-79237236 TAGGCTTCTGGCCCTGTGGCTGG + Intergenic
1201077305 Y:10197514-10197536 GTGGCACCTGACCCTCCGGCCGG - Intergenic
1201797727 Y:17918019-17918041 TTGGGTCCTGATCCTCTAGCTGG - Intergenic
1201803826 Y:17987938-17987960 TTGGGTCCTGATCCTCTAGCTGG + Intergenic