ID: 946137289

View in Genome Browser
Species Human (GRCh38)
Location 2:217657671-217657693
Sequence AAGTGTGGGCAGGATGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946137289_946137294 23 Left 946137289 2:217657671-217657693 CCTTTAACATCCTGCCCACACTT 0: 1
1: 0
2: 1
3: 14
4: 230
Right 946137294 2:217657717-217657739 TCTTTTTGTTTGAACCATCTTGG 0: 1
1: 0
2: 6
3: 40
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946137289 Original CRISPR AAGTGTGGGCAGGATGTTAA AGG (reversed) Intronic
900854693 1:5171491-5171513 CAGAGTGTGCAGGATGTTAGAGG + Intergenic
902330619 1:15729522-15729544 GAGGGTGGGCAGGACGTCAACGG - Intronic
905637300 1:39563187-39563209 AAGTGTGTGTAGGAGGTGAAGGG - Intronic
906918778 1:50040927-50040949 AAGGCTGGGCCAGATGTTAAAGG + Intergenic
910293995 1:85626545-85626567 AGGTGTGGGCAGCATGTTGCCGG - Intergenic
912598383 1:110902438-110902460 AAGTGTTAGCATGCTGTTAAGGG - Intergenic
914786173 1:150833567-150833589 AATTATGGGTAGGATATTAAAGG - Intronic
917119781 1:171635308-171635330 ATGTGATTGCAGGATGTTAAAGG - Intergenic
917121402 1:171647762-171647784 AAAAGTGGGCAGGATGTGAGGGG - Intronic
917511931 1:175675928-175675950 GATTGTGGGGAGGATGTGAAAGG + Intronic
918337360 1:183531329-183531351 AAATGTGGGCTGTTTGTTAATGG + Intronic
920007534 1:202844441-202844463 AAGTCTGGGCAGGTTCTTAAAGG - Intergenic
920297676 1:204969022-204969044 AAGGGTGGGCATGGTGTTCAGGG - Intronic
920515458 1:206581799-206581821 AAGTGATGGCAGGTTGTTCAGGG + Intronic
920663563 1:207941426-207941448 AAGTTTGGGCAGGAGGGTATAGG - Intergenic
922030153 1:221789893-221789915 AAATGTGGGGAGGAGGGTAAGGG + Intergenic
924596082 1:245445862-245445884 AAGGGAGGGAAGGATGCTAATGG - Intronic
1062768010 10:80174-80196 ACCTGTGGGCAGGATGCTGAGGG + Intergenic
1064507296 10:16047058-16047080 AGGTGTGGGCAAGATGTTTTAGG - Intergenic
1064745239 10:18472195-18472217 AAAAGTGGGCCGGATATTAAAGG - Intronic
1065642239 10:27795106-27795128 AAGAGCGGGAAGTATGTTAATGG - Intergenic
1066754436 10:38696518-38696540 AAGTGTGGGCTGGATGTCAGGGG - Intergenic
1066993077 10:42535259-42535281 AATTCTGTGAAGGATGTTAATGG + Intergenic
1071986516 10:91056674-91056696 AAGTGTGACCAGGGTGATAATGG - Intergenic
1072670243 10:97424123-97424145 AAGTGTGGGAAGGATTTGAGAGG - Intronic
1074738554 10:116461771-116461793 AATTGTTGACAGGATGGTAAGGG + Intronic
1075715364 10:124552166-124552188 AAGTGAGTTCATGATGTTAATGG + Intronic
1076058342 10:127393499-127393521 AAGGCTGAGCAGGCTGTTAAGGG + Intronic
1076181371 10:128411482-128411504 AACTGTGGACAGGAAGTTAGGGG + Intergenic
1077098982 11:812952-812974 AAGTGTGGGCAACATGGTATTGG + Intergenic
1078035856 11:7804546-7804568 AAGAGTTGGCAAGATCTTAAAGG - Intergenic
1080224987 11:29950208-29950230 AAGTGTGGGGAGGAAGTGTATGG - Intergenic
1081858752 11:46320202-46320224 GAATGTGGCCAGGATGTTGAGGG + Intronic
1086574531 11:88323879-88323901 AATTGTGTGAAGAATGTTAATGG - Intronic
1089134295 11:116237013-116237035 GAGGATGGGCAGGATGTTGATGG + Intergenic
1090571251 11:128049069-128049091 GAGTGTGAGCAGGATGGGAAAGG + Intergenic
1090914337 11:131149829-131149851 AAGGGTTGAAAGGATGTTAACGG + Intergenic
1091094915 11:132811246-132811268 ATGTCTGGGCAGGATTTTAATGG - Intronic
1091641945 12:2244084-2244106 CAGAGTGGGCAGGATGCTTAAGG - Intronic
1091978903 12:4850062-4850084 GAGTGTGGGCCAGATGGTAAAGG + Intronic
1094754894 12:33456539-33456561 AACTGTGGGCAGGTTGTTCCGGG - Intergenic
1095449501 12:42315028-42315050 AAGTGTAGTCAGGATATAAAAGG - Intronic
1096018881 12:48305612-48305634 AAGTTTCTGCAGTATGTTAAAGG - Intergenic
1097927354 12:65143817-65143839 AGGTGTGGACAGGATTATAAAGG - Intergenic
1099841112 12:87968512-87968534 AACTGTTTGCAGGATGTCAAAGG - Intergenic
1105285818 13:19002578-19002600 AAGTGAGTGAAGGATATTAACGG - Intergenic
1105891338 13:24684624-24684646 AACTGAGGGGAGGATGTTAGTGG + Intronic
1107934863 13:45337448-45337470 AAATGTAGGCTGCATGTTAATGG - Intronic
1107974662 13:45677819-45677841 AAGTTTGGGCAGGAGGTTGCGGG - Intergenic
1110127159 13:71959317-71959339 CAGTGTGGGGAGGATTTCAAAGG - Intergenic
1110521806 13:76488259-76488281 AAGTGTTGTGAGGATGTTTAAGG - Intergenic
1111704427 13:91730879-91730901 AAATGTGGCCTGGATGTTACTGG - Intronic
1111961880 13:94820455-94820477 AAGTGGGGTCAGTATGTGAAAGG - Intergenic
1113139026 13:107126555-107126577 ATGTGTGGGCAGGAGGTTATAGG + Intergenic
1114519357 14:23323177-23323199 GAGTGTGGGAAGGAGGTTAAAGG + Intronic
1117783093 14:59255060-59255082 AAGTGTTTTCAGGATGCTAATGG + Intronic
1119027239 14:71163935-71163957 AAGTGTGGGTAGGATCATAGTGG - Intergenic
1119332209 14:73803195-73803217 CAGTGTTGGGACGATGTTAAGGG + Intergenic
1121013296 14:90534267-90534289 AAGTGTGGGAGGAATGTTAGTGG + Exonic
1121138116 14:91516776-91516798 GAGTCTGGGAAGGATGTTGAGGG - Intergenic
1125304861 15:38299812-38299834 AAGGGAAGGCAGGATGTTACCGG - Intronic
1126373296 15:47969543-47969565 AAGTGTGGGCAGGAGAAAAAGGG - Intergenic
1128650278 15:69406894-69406916 AATTGTTGGTAGGATGTTATGGG + Exonic
1128806788 15:70536909-70536931 AGGTGTGGCCAGGATCTTTAGGG + Intergenic
1129940666 15:79494283-79494305 AAGCCTGGGAAGGATGTCAAGGG + Intergenic
1130976685 15:88781936-88781958 AAGAGTGGGCACGGAGTTAAAGG + Intergenic
1131416658 15:92265855-92265877 AAGTGGGGGCAGGAGGGTGAAGG - Intergenic
1132308011 15:100831667-100831689 ACGTGTGAGCAGGATGGAAAAGG - Intergenic
1133983439 16:10650526-10650548 GAGTCTGGACAAGATGTTAAGGG - Intronic
1134418447 16:14064983-14065005 AAGTGTGTGCAGAATGTCATTGG + Intergenic
1134503581 16:14788120-14788142 CAATTTGGGCAGGATGTTGAGGG + Intronic
1134576987 16:15340778-15340800 CAATTTGGGCAGGATGTTGAGGG - Intergenic
1134725452 16:16415714-16415736 CAATTTGGGCAGGATGTTGAGGG + Intergenic
1134941980 16:18296144-18296166 CAATTTGGGCAGGATGTTGAGGG - Intergenic
1135010918 16:18878079-18878101 AAGTGAGGGGAGGATATTTATGG + Intronic
1135317805 16:21465666-21465688 AAGTGGGGGGAGGATATTTATGG + Intergenic
1135370699 16:21897465-21897487 AAGTGGGGGGAGGATATTTATGG + Intergenic
1135441086 16:22473254-22473276 AAGTGGGGGGAGGATATTTATGG - Intergenic
1135682528 16:24470309-24470331 ATGTGTGTGCAGGGTGTTCAAGG - Intergenic
1136314576 16:29445348-29445370 AAGTGGGGGGAGGATATTTATGG + Intronic
1136328019 16:29547116-29547138 AAGTGGGGGGAGGATATTTATGG + Intergenic
1136442703 16:30287117-30287139 AAGTGGGGGGAGGATATTTATGG + Intergenic
1136622484 16:31438685-31438707 AAGTGATGGCAGGATGTTAAGGG - Intronic
1136710886 16:32235317-32235339 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1136728244 16:32380325-32380347 AGGTGTGGGCTGGATGTCAGGGG + Intergenic
1136757024 16:32694094-32694116 GAGTGTGGGCTGGATGTGGAAGG - Intergenic
1136811085 16:33176281-33176303 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1136817561 16:33286361-33286383 GAGTGTGGGCTGGATGTGGAAGG + Intronic
1136824125 16:33342890-33342912 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1138378929 16:56587021-56587043 AAGGGTGGCCAGGATTTTGAGGG - Intergenic
1139520419 16:67479791-67479813 AAGGGTGGCCAGGATGTGAGGGG - Intronic
1139889448 16:70239605-70239627 AAGTGGGGGGAGGATATTTATGG + Intergenic
1202998194 16_KI270728v1_random:137429-137451 AGGTGTGGGCTGGATGTCAGGGG - Intergenic
1203059173 16_KI270728v1_random:954445-954467 GAGTGTGGGCTGGATGTGGAAGG - Intergenic
1143210499 17:5183592-5183614 GAGTGTGGGAAGGCTTTTAAGGG - Exonic
1144681594 17:17199479-17199501 CAGTGTGGGCAGACTGTTAAGGG + Intronic
1147053939 17:37819431-37819453 AAGGGTGGGCAGGATTTAGAAGG + Intergenic
1148377241 17:47159592-47159614 GAGTTTGGCCAGGATGTTGATGG + Intronic
1148492702 17:48033537-48033559 GAGCGTGGGCAGGAGGTAAACGG - Intronic
1152261535 17:79269898-79269920 CAGTGTGGGCAGGTGGATAAGGG - Intronic
1152960956 18:79920-79942 ACCTGTGGGCAGGATGCTGAGGG + Intergenic
1153710738 18:7796423-7796445 AAGTGTGGGCAGGAGGGCATGGG + Intronic
1154324409 18:13379827-13379849 AAGTGTGGGCAGGAAGGGAGGGG - Intronic
1155252515 18:23965817-23965839 AAGAGTGGGCAAAATGTCAATGG + Intergenic
1156068752 18:33177982-33178004 AAGTGAGAGCAGGTTGCTAAGGG - Intronic
1162765322 19:12915843-12915865 AAGTGTGGGCAGGGTGGGGAAGG - Intronic
1163489639 19:17609635-17609657 AAGTCTGGGCAGGAAGTGCATGG - Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1165845150 19:38813194-38813216 AAGTCTGGGCAGGGTTTTATGGG - Exonic
1166855274 19:45780117-45780139 AAGGGTGTGCAGGATGGTTAGGG + Exonic
926561138 2:14418814-14418836 AAGTTTGGGCATGATTCTAAAGG + Intergenic
927151608 2:20199493-20199515 GACTGTGGGCATGATGTAAAGGG + Intergenic
928719119 2:34098815-34098837 AATTGAGTGCGGGATGTTAATGG + Intergenic
930035209 2:47080924-47080946 AGGCGTGGGAAGGATCTTAAAGG - Intronic
930447133 2:51488165-51488187 AAGTGATGGAAGAATGTTAAAGG - Intergenic
932660159 2:73644561-73644583 AAGTCTGGGCAGGAAGTCCATGG + Intergenic
932666728 2:73704242-73704264 AAGTCTGGGCAGGAAGTCCATGG + Intergenic
933597843 2:84300644-84300666 ATGTGTGGGCTGGCTGCTAAGGG + Intergenic
935086562 2:99851807-99851829 AAGTGTTGGCAGGTTGTCAATGG - Intronic
935306079 2:101737852-101737874 AAGTGTGGTGAGAAAGTTAAAGG - Intronic
937318215 2:120945416-120945438 CACTGTGGGCAGGATGTCCAGGG + Intronic
940099708 2:150020620-150020642 AATTGTCCTCAGGATGTTAAAGG + Intergenic
940272220 2:151903644-151903666 AAGTGTGAGAAGCATGTTATTGG - Intronic
942248513 2:174028269-174028291 AAGTCAGGGCAGGATGACAACGG - Intergenic
944180661 2:196889341-196889363 CATTGTGGGCTGGATGCTAATGG - Intronic
944907659 2:204278836-204278858 AAGTTTGGGAAGGAAGTCAATGG + Intergenic
945552426 2:211236671-211236693 AAGTGAAGGCAGGATGTTCCAGG - Intergenic
946128618 2:217586601-217586623 AAGTGAGGGCAGGGTGTCAGTGG - Intronic
946137289 2:217657671-217657693 AAGTGTGGGCAGGATGTTAAAGG - Intronic
1169084441 20:2818017-2818039 AAGTGTGTACAAGATGTAAAAGG + Intronic
1169946428 20:10994105-10994127 GAATGTTGGCAGCATGTTAATGG - Intergenic
1171121877 20:22575646-22575668 GGATGTGGGCAGGATGTTACAGG - Intergenic
1173703193 20:45091357-45091379 AACTGTGAGCAGGATGATACAGG + Intergenic
1174503694 20:51003521-51003543 AAGTGGGGGCTGGAAGTAAAGGG - Intergenic
1177095973 21:16833568-16833590 AAATGTGGCTGGGATGTTAAAGG - Intergenic
1177664002 21:24128064-24128086 AAGTGAGGTCTGGATGTTACGGG + Intergenic
1180305899 22:11124431-11124453 AGGTGTGGGCTGGATGTCAGGGG - Intergenic
1180544418 22:16486614-16486636 AGGTGTGGGCTGGATGTCAGGGG - Intergenic
1180607965 22:17075496-17075518 TAGTGTGGGAAGGATGGTTAGGG + Intergenic
1182432079 22:30305175-30305197 AAGTGTGTGTAGGATTTTGATGG - Intronic
1182865996 22:33605077-33605099 AAGTGAGGACAGGCTGTTACTGG - Intronic
1182932926 22:34192083-34192105 AAGTGTGGGCTGGGTGGTCAGGG + Intergenic
1183279749 22:36925654-36925676 ACCTGGGGGCAGAATGTTAAAGG - Intronic
1183912656 22:41091487-41091509 AAGAGTGGGGAGGATTTTAAGGG - Intergenic
1184249644 22:43252857-43252879 ACGTGGGGGCAGGATGGGAACGG + Intronic
1184249671 22:43252985-43253007 ACGTGGGGGCAGGATGGGAACGG + Intronic
1184249685 22:43253050-43253072 ATGTGGGGGCAGGATGGGAACGG + Intronic
1184249700 22:43253115-43253137 ACGTGGGGGCAGGATGGGAACGG + Intronic
1184569729 22:45314596-45314618 CAGAGCGGGCAGGATCTTAAAGG - Intronic
949780859 3:7686232-7686254 AAGAGTGGGCATGATGTGTATGG + Intronic
951079262 3:18431808-18431830 AAGTGGGGGCAGGAAGCTACTGG + Intronic
952094094 3:29927505-29927527 AAGTGTGTGCAAAATGTTATGGG + Intronic
952282710 3:31938916-31938938 GAGGGTGGGCAGGAAGTTGAAGG - Intronic
952563075 3:34618854-34618876 ATGTGGGGGTACGATGTTAAAGG - Intergenic
953442250 3:42928357-42928379 ATGTGTGGGCAGGGAGGTAAGGG + Intronic
954575715 3:51674927-51674949 AAGAGTGGGCAGAATCTGAATGG - Intronic
957885802 3:86286252-86286274 AAGTGTGGGTAGGGGGTAAAGGG - Intergenic
957971153 3:87384320-87384342 ACCTGGGTGCAGGATGTTAATGG - Intergenic
958143657 3:89596595-89596617 AAGGGATGGCAGAATGTTAATGG - Intergenic
959560561 3:107774900-107774922 AAGTGTGGGTGGGATTTTCAAGG + Intronic
962290662 3:134134005-134134027 AAGTGAGGGCAGGTGGTTGATGG + Intronic
963219567 3:142793186-142793208 AAGTGGGGGGAGGAGGCTAATGG - Intronic
963720036 3:148851647-148851669 AAGTCTGGGCAGGATTTGAGTGG + Intronic
963861611 3:150316204-150316226 AAGTGAGGGCAGGATGAGTATGG - Intergenic
964709709 3:159658668-159658690 AAAAGTGGTCAGGATGTGAATGG - Intronic
966003783 3:174983171-174983193 AAGTTTGGTCAGGAAGTAAAAGG + Intronic
967844009 3:194030297-194030319 AGGTGTCTCCAGGATGTTAAAGG + Intergenic
968150882 3:196335733-196335755 CAGTGTGGGCAGGCTGTGAGGGG - Intronic
969375633 4:6761637-6761659 ATGGGAGAGCAGGATGTTAAGGG - Intergenic
969719018 4:8882892-8882914 AAGTGTGAGAAGGATTTTGAAGG + Intergenic
971565782 4:28139249-28139271 AACTGTGGTTAGTATGTTAAGGG - Intergenic
971962345 4:33505594-33505616 AGGTGTGGGCAAGATGTTAGAGG - Intergenic
972767148 4:42161716-42161738 AAGAGTGGCCAGGATGGAAATGG - Intergenic
975430482 4:74284492-74284514 AAGTGGGCGAAGGATATTAACGG - Intronic
977337653 4:95718678-95718700 ATGTGTGGGATGGATGCTAAGGG - Intergenic
977638012 4:99322979-99323001 AAGTTTGGGGAGGATTTGAATGG - Intergenic
981298530 4:143160567-143160589 AAGAATGTGCAGGATGCTAAGGG - Intergenic
988117582 5:26917490-26917512 AGGTGAGGGCAGGATGTAAATGG - Intronic
989113477 5:37929571-37929593 GAGTGTGGGCAGGGTGGGAAAGG + Intergenic
989122740 5:38020580-38020602 GAGTGTGGGAATGATGCTAACGG + Intergenic
989695631 5:44197152-44197174 AAGTGTGGCCAAGAGGTTGAGGG - Intergenic
991050992 5:62272708-62272730 ATGTTTGGGCAGGAAATTAAAGG + Intergenic
992195719 5:74336941-74336963 AAGTAGGGGCAGTATGGTAAAGG + Intergenic
992625374 5:78631967-78631989 AAATTTGGGCTGGATCTTAAAGG + Intronic
995783429 5:115802355-115802377 AAGTGTAGGTGGGATGTAAAAGG - Intergenic
996586965 5:125100053-125100075 AAGTCTTGGCTGGATGTTCAAGG + Intergenic
997523106 5:134535765-134535787 AAGTGTGGGGAGGTTGGTTATGG + Intronic
1005495089 6:26381466-26381488 AAGGCTGGGCAGGATTTCAAGGG + Intergenic
1005648162 6:27862117-27862139 AAGTGTGGACAGAATTTGAATGG + Intronic
1006339252 6:33437636-33437658 TGGGGTGGGCATGATGTTAAAGG - Intronic
1007481794 6:42155186-42155208 AACTGTGGGCAGGAGGTGAATGG - Intergenic
1007998879 6:46337972-46337994 AAGTGTGGGCTGCATGGGAATGG + Intronic
1008444447 6:51571806-51571828 AAGTGGGGTCAGGATAATAATGG + Intergenic
1013567990 6:111388697-111388719 AACTGTGGGCAGCATTTCAATGG + Intronic
1013766875 6:113584765-113584787 AAGCGTGGGCAGGAACTGAAGGG - Intergenic
1014793316 6:125700266-125700288 TAGTGTGGGCAGGTGGTTTAGGG - Intergenic
1014911061 6:127093393-127093415 TAGTGTGGGCATAATATTAATGG + Intergenic
1015082209 6:129240550-129240572 AGGTGTGACCAGGATGTTGATGG - Intronic
1017630643 6:156393192-156393214 GAGTGTGGAGAGGGTGTTAAAGG - Intergenic
1018893921 6:168000475-168000497 AAGTGTGGTCAGGATGGGAGTGG - Intronic
1020070197 7:5222430-5222452 AAGTGTGGAGATGATGTTCAAGG + Intronic
1020823151 7:12995656-12995678 AAGAGGGGGCAGCATGTGAAAGG + Intergenic
1020993883 7:15237418-15237440 AACTGTGGGCAAAATCTTAAAGG - Intronic
1022477403 7:30720478-30720500 AAATGTGAGCAGGACTTTAAAGG - Intronic
1022797314 7:33742429-33742451 CAGGGTAGGCAGGAGGTTAATGG + Intergenic
1029569853 7:101362380-101362402 AGGTGGGGGCTGGAGGTTAAAGG + Intergenic
1030238160 7:107290244-107290266 AAGAGTGGGCAGGAAGGGAAGGG - Intronic
1030608322 7:111661856-111661878 AAGTGTGTACAGGATGTTAGAGG - Intergenic
1032488424 7:132305859-132305881 AAGTTTGGGGAGGATGTGAAGGG - Intronic
1032806218 7:135357319-135357341 AACTTTAGGCTGGATGTTAAAGG - Intergenic
1033721931 7:144069646-144069668 AGCTGTGGGCAACATGTTAAGGG - Intergenic
1033765674 7:144487888-144487910 AAGTTTGGGCAAGATGGTGAAGG - Intronic
1035129197 7:156636610-156636632 AAGTGTGAGTAGAAAGTTAAAGG + Intergenic
1036801111 8:11793473-11793495 AAGAGTGGGCAGGTTTGTAACGG + Intergenic
1041607689 8:59802561-59802583 AAGAGTTAGCAGGATGATAAAGG - Intergenic
1043304586 8:78778769-78778791 AATTCTGGGAAGAATGTTAATGG + Intronic
1044109614 8:88255711-88255733 AAGGATGGGCAGGAAGTTAAGGG + Intronic
1045144977 8:99332537-99332559 CAGTGTGGAAAGGATGTTTATGG + Intronic
1045869997 8:106915508-106915530 AAATGTGGTCACAATGTTAAAGG - Intergenic
1046162559 8:110386706-110386728 AAGTGGGGGAAGGATATGAACGG - Intergenic
1046991404 8:120460051-120460073 AACAGTGGGCATGAAGTTAAAGG + Intronic
1047332443 8:123903957-123903979 AAGTGTGGGGAGGATTTGATTGG - Intronic
1048259520 8:132933951-132933973 CAGTGTGGGCAAGATGTGAGGGG + Intronic
1048617700 8:136095887-136095909 AAGTGTGGGCAGAAGGTCCATGG + Intergenic
1049566620 8:143343560-143343582 AAGAGTGGGCAGGCAGTAAAAGG + Intronic
1050115449 9:2258803-2258825 AAGTGTGGGCAGGCTCAGAAAGG - Intergenic
1050696015 9:8280071-8280093 AAGTGGCGGAAGGATGTTTAGGG + Intergenic
1050842333 9:10168016-10168038 AAGTGAGGGTAGGAAGTGAAAGG + Intronic
1051354668 9:16230886-16230908 AAATTTGGGCAGGATTTCAAGGG - Intronic
1052786146 9:32830469-32830491 CAGTGTGGCCAGGAAGTTCAGGG + Intergenic
1054373124 9:64425273-64425295 AGGGGAGGGGAGGATGTTAATGG - Intergenic
1055048637 9:71957197-71957219 AATTTGGGGCAGGATGTGAAGGG - Intronic
1056236721 9:84601817-84601839 AAGTTAGAGCAGCATGTTAAGGG - Intergenic
1058584742 9:106494853-106494875 AAGTGGGCGAAGGATGTGAACGG - Intergenic
1059701794 9:116782117-116782139 AAGTGTGGGCAGGGTAGCAAAGG + Intronic
1060860885 9:126954019-126954041 AAGTGTGGGCAGTGTGTGGAGGG - Intronic
1061690520 9:132324505-132324527 AACTGTGGGAAGTATGTTACAGG - Intronic
1061985102 9:134126031-134126053 AAGTGTGGCCAGGAGCTTACAGG + Intergenic
1186538545 X:10374910-10374932 GAAGGTGGGCAGGAAGTTAATGG - Intergenic
1186610044 X:11130121-11130143 TAGTGGGGGCAGGAAGATAATGG + Intergenic
1188952721 X:36396200-36396222 AATTCTGGGAAGGATGTCAATGG + Intergenic
1194389811 X:93302093-93302115 AAATGAGGGCAGGCTTTTAAGGG - Intergenic
1197102056 X:122668044-122668066 AAGTGTTGGGAGCATGTAAATGG + Intergenic
1197263911 X:124346465-124346487 AAGTGTGAGAAGGAGGTTTAAGG + Exonic
1198321920 X:135526619-135526641 AGGTGTGGACAACATGTTAAAGG - Intronic
1201185296 Y:11395794-11395816 AGGTGTGGGCTGGATGTCAGGGG - Intergenic