ID: 946137575

View in Genome Browser
Species Human (GRCh38)
Location 2:217660488-217660510
Sequence TGGATTCTGAAGGATTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946137575_946137584 14 Left 946137575 2:217660488-217660510 CCTTCCAAATCCTTCAGAATCCA 0: 1
1: 0
2: 3
3: 25
4: 304
Right 946137584 2:217660525-217660547 TCCTCTGGGATACTCCCTGGTGG 0: 1
1: 0
2: 0
3: 18
4: 264
946137575_946137583 11 Left 946137575 2:217660488-217660510 CCTTCCAAATCCTTCAGAATCCA 0: 1
1: 0
2: 3
3: 25
4: 304
Right 946137583 2:217660522-217660544 ACTTCCTCTGGGATACTCCCTGG 0: 1
1: 0
2: 2
3: 14
4: 179
946137575_946137579 -1 Left 946137575 2:217660488-217660510 CCTTCCAAATCCTTCAGAATCCA 0: 1
1: 0
2: 3
3: 25
4: 304
Right 946137579 2:217660510-217660532 AGCTCTATTCCCACTTCCTCTGG 0: 1
1: 0
2: 2
3: 25
4: 515
946137575_946137580 0 Left 946137575 2:217660488-217660510 CCTTCCAAATCCTTCAGAATCCA 0: 1
1: 0
2: 3
3: 25
4: 304
Right 946137580 2:217660511-217660533 GCTCTATTCCCACTTCCTCTGGG 0: 1
1: 0
2: 0
3: 28
4: 265
946137575_946137586 15 Left 946137575 2:217660488-217660510 CCTTCCAAATCCTTCAGAATCCA 0: 1
1: 0
2: 3
3: 25
4: 304
Right 946137586 2:217660526-217660548 CCTCTGGGATACTCCCTGGTGGG 0: 1
1: 0
2: 2
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946137575 Original CRISPR TGGATTCTGAAGGATTTGGA AGG (reversed) Intronic
904889005 1:33763993-33764015 TGGAGACTGAAGCCTTTGGATGG + Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905268359 1:36770491-36770513 TGGATGGGGAAGGATTGGGAAGG + Intergenic
905744345 1:40401357-40401379 TAGATTCCACAGGATTTGGATGG + Intronic
905787056 1:40766830-40766852 TGGGTGCAGAAGGATATGGAGGG - Intronic
906122352 1:43402695-43402717 TTGATTTTGAGGTATTTGGAAGG + Intronic
906462086 1:46042402-46042424 TGGTTTCTGAAGCTTTTGCAGGG - Exonic
907076563 1:51584407-51584429 TGGATTCTAAAGGCCTTGCATGG + Intronic
907245198 1:53103904-53103926 TGGATACTGGATGATTGGGAGGG - Intronic
907652290 1:56306651-56306673 AGGATTCTGATGGGTTTGCAGGG - Intergenic
907701698 1:56794550-56794572 TGCCTTCTGAAGATTTTGGAAGG + Intronic
908405511 1:63810625-63810647 TGGATACTGAAGGATCTTGAAGG + Intronic
909066006 1:70936752-70936774 TGGAATCTGTATTATTTGGAAGG + Intronic
909073122 1:71020079-71020101 TGTAATTTGAAGGATTTGCATGG + Intronic
909982285 1:82116961-82116983 TTGAAACTGATGGATTTGGATGG + Intergenic
909998353 1:82309254-82309276 TGCATACTGAAGTATTTGGGAGG - Intergenic
910013029 1:82488890-82488912 TGGAATCTGATGGAGTTTGATGG - Intergenic
910711871 1:90190193-90190215 GGGACTCTGAAGGAATGGGATGG - Intergenic
911179061 1:94844937-94844959 TGGGTTCTGTGGGATGTGGAGGG + Intronic
911488664 1:98534305-98534327 TATATTCTGAATGATTGGGAAGG + Intergenic
911498034 1:98654392-98654414 CGGATTGTCAAGGACTTGGAAGG - Intergenic
912202932 1:107479043-107479065 TGGAGCCTGAAGGATTTAGTAGG + Intronic
912483920 1:110008809-110008831 TTGTTTCTGCAGGATTTGGGAGG - Intronic
915504214 1:156342595-156342617 TGGGATCTGAAGGATTAAGAAGG - Intronic
918314802 1:183314324-183314346 TGGATTTTGAAGGGTTGGCAGGG - Intronic
919312804 1:195932679-195932701 TGGTTTCTAAAGGCTTTGGCTGG - Intergenic
919503772 1:198371875-198371897 AGAATTCTGAAGCATTTTGAGGG + Intergenic
919933965 1:202239287-202239309 TAAATTCTGAAGAATTTGGAAGG + Intronic
922218416 1:223539540-223539562 TTGATTCTGAAGGCTAGGGAGGG + Intronic
922269109 1:224015418-224015440 TGGACTCGAAAGGATTGGGATGG + Intergenic
923998930 1:239529038-239529060 TGGATTATGAAGGAAATGGGAGG - Intronic
924237285 1:242009858-242009880 TGGATTCTGAATGCCCTGGATGG - Intergenic
924416389 1:243860742-243860764 ATGATTCTGAAGGATATGGGAGG + Intergenic
924454480 1:244208140-244208162 TGGCTTCTGAGGGTTTAGGAAGG - Intergenic
1063729052 10:8675275-8675297 TGGGTTCTGATAGATTTGGTTGG - Intergenic
1064621553 10:17222546-17222568 TGGATTATGGAGTATTTGTAGGG - Intergenic
1064657078 10:17566873-17566895 AGGGTTCTGAAGGAGTTTGATGG - Intergenic
1066764995 10:38794652-38794674 TGGATTCGGAAGGAGTAGAATGG - Intergenic
1068088251 10:52401197-52401219 TGGATTATAAATGATTTGGAGGG + Intergenic
1068773258 10:60845739-60845761 TGGATTCTGACCATTTTGGAAGG + Intergenic
1069038901 10:63673565-63673587 TGGAAGCTGGAGGATATGGAAGG + Intergenic
1069689573 10:70341011-70341033 TGGATTCTGCAGGATCTCAAAGG - Intronic
1070016568 10:72539265-72539287 TGTATTCTGTAGCAGTTGGATGG - Intronic
1071817419 10:89247577-89247599 TGCATTCTGAGGGGTCTGGAGGG - Exonic
1074241704 10:111645955-111645977 TGGATTCTGATGGAGTCGGTGGG + Intergenic
1074608940 10:115002805-115002827 TGGGTTCTGAAGCATTTTCATGG - Intergenic
1074636891 10:115329350-115329372 TGAATTCTGCAGCTTTTGGATGG + Intronic
1074768146 10:116715843-116715865 TGGACTCTGAAAGCTTGGGAAGG + Intronic
1074890001 10:117727754-117727776 TGGCTGCTGATGGATTTGGGAGG + Intergenic
1075273326 10:121072001-121072023 TGAATTCTGAAGATTTTGGGTGG + Intergenic
1075876970 10:125815642-125815664 TTCACTCTGAAGCATTTGGAAGG + Intronic
1076355631 10:129850841-129850863 TGGGTTCTGTAGGGTTTGGGGGG - Intronic
1077266111 11:1651215-1651237 TAGAGGCTGGAGGATTTGGAAGG + Intergenic
1079745615 11:24125149-24125171 TGGATTCAGAAGGCATTGGCAGG + Intergenic
1080120966 11:28676655-28676677 TAGATTCTGTAGGATCTGCAGGG + Intergenic
1081296766 11:41399919-41399941 TAGATTCAGAAGGTTCTGGAAGG + Intronic
1081565607 11:44259104-44259126 TGGACTCTGAAGGATTTGGGGGG + Intergenic
1081891631 11:46547319-46547341 TGAATTCAGAAGCATGTGGAAGG + Intronic
1083229242 11:61305063-61305085 TGGATCCTGAAGGATCTGCCAGG - Intronic
1083719468 11:64597307-64597329 TGGGGTCTGCAGTATTTGGAGGG - Intronic
1084787238 11:71449425-71449447 TGGATACCGAAGTATTTGGGAGG - Intronic
1084892538 11:72243740-72243762 GGGATTCTGCAGGAATTGGAGGG + Intronic
1088250609 11:107858404-107858426 TGTATTTTGGAGGATTTGGGGGG - Intronic
1088823735 11:113476660-113476682 TGGACTCTGTGGGATTTGCAAGG - Intergenic
1090228428 11:125085245-125085267 TGCGTTCTGAAGGACTTTGACGG - Intronic
1090281065 11:125456217-125456239 TGGATCTTTAAGGAGTTGGAAGG - Intronic
1090521323 11:127482657-127482679 TGGACACTGAAGGATTTAGTAGG + Intergenic
1091107141 11:132933344-132933366 GAGATTCTGAACGATTTGCAAGG - Intronic
1092032509 12:5299508-5299530 GGGATTCTCAAGGTTTTGCATGG + Intergenic
1092655970 12:10686007-10686029 TGGATGCTCAGGGATTTGGCAGG - Intergenic
1092679235 12:10959078-10959100 TGGATTCTGTAGGTTTTTGAGGG + Intronic
1092681767 12:10990778-10990800 TGGATTCTGTATGTTTTTGAGGG + Intronic
1094120433 12:26968234-26968256 AGGATTCTGATTTATTTGGAAGG - Intergenic
1095736262 12:45559581-45559603 TGCATTATGAAGGAACTGGAGGG + Intergenic
1097155867 12:57011944-57011966 AGGATTCTGAGTGATTTGAAAGG + Intronic
1097658951 12:62406490-62406512 TGGTCTCTGAAGAATTAGGATGG - Intronic
1097829607 12:64210321-64210343 TGGATATTGATGGAGTTGGATGG - Intronic
1098005531 12:65993239-65993261 TGGATCTAGAAAGATTTGGAAGG + Intergenic
1101284222 12:103293476-103293498 TGGAGTGTGGAGGATTTGAAGGG - Intronic
1104497407 12:129253887-129253909 TAGATTCAAAAGGATTTGGTAGG - Intronic
1105627867 13:22130933-22130955 TGAACTCTGAAGGATTTTTATGG + Intergenic
1105801306 13:23904634-23904656 TGGAGTCAGAGGGATGTGGAAGG - Intergenic
1106889279 13:34225702-34225724 TGGTTTATGAAGGCTTCGGATGG - Intergenic
1107091338 13:36484226-36484248 TGTATTCTGCAGGTGTTGGATGG + Intergenic
1107997541 13:45875636-45875658 TGTATTCTGAAGCTATTGGATGG + Intergenic
1114260488 14:21033015-21033037 TGGAGTCTGGGGGATTTGGGAGG + Exonic
1114980672 14:28159013-28159035 AGGATTCTAAAATATTTGGAAGG + Intergenic
1116695717 14:48174665-48174687 TTGATTGTGAAGGATTTTGAGGG - Intergenic
1116938165 14:50763407-50763429 TGGATTCTGTAGTATCTGGCTGG + Intronic
1117823706 14:59678162-59678184 TGGGGTCTGGAGGATTTGGAAGG + Intronic
1118520049 14:66573160-66573182 TGGATTCTGCTGCTTTTGGAAGG + Intronic
1120359714 14:83483260-83483282 TGGATTCTGGAGGAGGTGGCTGG + Intergenic
1202874414 14_GL000225v1_random:194555-194577 TGGACTCTGAAGGAATGGAATGG + Intergenic
1124196228 15:27632347-27632369 AGGATTCTGAAGGATTCTGAAGG - Intergenic
1125361316 15:38867434-38867456 TGGATTCTGAAGGAAATAGCTGG + Intergenic
1125709305 15:41771832-41771854 TGCATTTTGGAGGATTGGGATGG + Intronic
1128405919 15:67338699-67338721 TGTATTCTTAACCATTTGGAGGG - Intronic
1128623243 15:69171342-69171364 TGGTTTCTGCAGGATTTTAATGG + Intronic
1129085917 15:73091769-73091791 TGGATTCTGTAGGATATTGTGGG + Intronic
1130635776 15:85618532-85618554 TGGATCATGAATGATTTGGGAGG - Intronic
1131358567 15:91768301-91768323 TGAATTCTGAAAGATGTGGCAGG - Intergenic
1133381127 16:5331432-5331454 TGGAGGCAGAAGGATTTAGATGG + Intergenic
1135264509 16:21011233-21011255 TTGATTTTGAAGGATGAGGAAGG + Intronic
1136126039 16:28181480-28181502 TGGATTCTCAGGGGTTTGGGGGG + Intronic
1139204429 16:65013430-65013452 AGGAATCAGAAGGAGTTGGAAGG + Intronic
1139461790 16:67128461-67128483 TGGATTCTGAAGGTGTTGGATGG - Intronic
1141295717 16:82767083-82767105 TGCATGCTGAAGTATTTAGAGGG - Intronic
1145332916 17:21887888-21887910 TGGAATCTGACGGAATTGAATGG + Intergenic
1147420522 17:40320073-40320095 TGGATTTGCAAGGATTTTGAGGG + Intronic
1148234393 17:45958278-45958300 TGGTTTCTGATGGTTTTTGATGG - Intronic
1148469133 17:47882690-47882712 TGGCCTCTGAAGGAGTTGGGAGG + Intergenic
1148735017 17:49860458-49860480 GGGATGCTGAATGATTTGGAAGG + Intergenic
1149180847 17:53934272-53934294 TGGCTTCTGAAAGTTTTGTATGG - Intergenic
1150473626 17:65458017-65458039 TGCTTTCTGGAGGGTTTGGAAGG - Intergenic
1150715515 17:67569582-67569604 TGGATTCCGTTGGGTTTGGAAGG + Intronic
1151481328 17:74371580-74371602 GGGTTTCAGAAGGATCTGGAAGG + Intronic
1203177619 17_KI270729v1_random:30882-30904 TGGACTCGAAAGGATTTGGATGG + Intergenic
1203178888 17_KI270729v1_random:40721-40743 TGGACTCCAAAGGATTGGGATGG + Intergenic
1203179577 17_KI270729v1_random:46094-46116 TGGACTCCAAAGGATTGGGATGG + Intergenic
1203180101 17_KI270729v1_random:49965-49987 TGGACTCGAAAGGATTTGGATGG + Intergenic
1203181163 17_KI270729v1_random:57951-57973 TGGATTCTTATGGAATTGAATGG + Intergenic
1153313644 18:3701391-3701413 AGGATTCTCAATGATTTGTAGGG - Intronic
1153586611 18:6627688-6627710 GGGAATCTGTAGGAATTGGAGGG - Intergenic
1153770961 18:8416231-8416253 AGGATTCTGTAAAATTTGGAGGG - Intergenic
1155900190 18:31380071-31380093 TGGACTCTGCAGGAATTTGAAGG - Intronic
1155925072 18:31647480-31647502 TGGACTCTGAGGGGTGTGGATGG - Intronic
1157870853 18:51229018-51229040 TGGATTGTCAGGGACTTGGAAGG - Intergenic
1158915035 18:62116064-62116086 TGGATTCACTGGGATTTGGAGGG + Intronic
1159909046 18:74126409-74126431 TGTATTGTGCTGGATTTGGAGGG - Intronic
1160760197 19:780182-780204 TGGATTCTCAGGGATGGGGAGGG - Intergenic
1163187288 19:15647695-15647717 TGGATTCTTCTGGATGTGGATGG + Intronic
1164310356 19:24040979-24041001 GTGATTCTGCAGGTTTTGGAGGG - Intronic
1164561645 19:29296447-29296469 TGGCTGCTGATGGATTAGGAGGG + Intergenic
1165816944 19:38648158-38648180 AGGCTGATGAAGGATTTGGAGGG + Intronic
1167590831 19:50403384-50403406 TGGGTTCTGCAGGATTTTCAGGG + Intronic
926182342 2:10656307-10656329 TTGAGTTTGAAGGATTTTGAGGG - Intronic
926420849 2:12696740-12696762 TGGCTGCTGAAGTATTTGGTAGG - Intergenic
926931799 2:18048424-18048446 CGGATACAGAAGGACTTGGAAGG - Intronic
928040270 2:27868811-27868833 TGAATTTTAAAGGATTTGAATGG - Intronic
929481894 2:42316455-42316477 TAGATTCTAAAGGACTTGAAGGG - Intronic
931848405 2:66228595-66228617 TGGATTATGGAAGATTTGGGGGG + Intergenic
933035288 2:77388997-77389019 TGGATTCAGAAAGAGTTAGATGG + Intronic
934895895 2:98119384-98119406 TGGATTCTGTAGTGTTTGGAGGG + Intronic
935055611 2:99563900-99563922 TCGATTCTGAAGTATCTAGAAGG + Intronic
935075525 2:99739435-99739457 GGGATTCTGAAGGAAGGGGAAGG + Intronic
935543852 2:104379554-104379576 TGGATTCTGATGGTCTTTGATGG + Intergenic
935625508 2:105169249-105169271 TGGATTCAGAACTGTTTGGAGGG + Intergenic
936255669 2:110908675-110908697 TGCATTCTGGAGTCTTTGGAAGG + Intronic
936774347 2:115954823-115954845 TGGATGGTCAAGAATTTGGAAGG + Intergenic
936996690 2:118422926-118422948 TGGTTTGTGAAGAATTTTGAGGG - Intergenic
937189143 2:120076914-120076936 TGGTTTTTGAAGGATTTAGCAGG + Intronic
937531268 2:122830183-122830205 TGCATGGTAAAGGATTTGGAGGG + Intergenic
939628705 2:144509964-144509986 TGGATGCTTCAGGATTTGTAGGG - Intronic
940004766 2:149000290-149000312 GTAATTCTGCAGGATTTGGAGGG - Intronic
941232832 2:162932376-162932398 TAGATTGAGAGGGATTTGGACGG + Intergenic
941577854 2:167257450-167257472 TGGATTTTGAACGAGCTGGAAGG - Intronic
942987960 2:182164354-182164376 TGGATGGTCAAGGACTTGGAAGG + Intronic
943196483 2:184758162-184758184 TGGATTCTTAAAGAATTGAATGG + Intronic
943613048 2:190057501-190057523 TGGATTTTGAAGCTTTTGGATGG - Exonic
945972665 2:216245644-216245666 TGGCCTAGGAAGGATTTGGAAGG + Intergenic
946137575 2:217660488-217660510 TGGATTCTGAAGGATTTGGAAGG - Intronic
946752718 2:222908487-222908509 TGGATACTTAAGGTTTTGGTTGG + Intronic
947396585 2:229693457-229693479 TGGATCCGGAACCATTTGGAGGG + Intronic
947869815 2:233428331-233428353 TGGATTCTGACTTATTTGGTGGG + Intronic
948717020 2:239871642-239871664 GGGTTTCTGGAGGATTTGGATGG - Intergenic
1169606416 20:7324692-7324714 TGGTTTCTGAAGAATATGCACGG - Intergenic
1169714742 20:8602530-8602552 AGGATTCTGAAGAATTTGATTGG - Intronic
1169963739 20:11191946-11191968 TGGACACTGAAGGTTTTTGAGGG + Intergenic
1170820288 20:19751805-19751827 TGGATTCTTAATTATTTTGAAGG - Intergenic
1171918281 20:31077219-31077241 TGGACTCTGATGGAATTGAATGG + Intergenic
1171918340 20:31077659-31077681 TGGATTCTAATGGAATTGAATGG + Intergenic
1171926768 20:31195302-31195324 TGGACTCTGATGGAATTGAATGG + Intergenic
1171926827 20:31195742-31195764 TGGATTCTAATGGAATTGAATGG + Intergenic
1172736595 20:37130467-37130489 TGGACCTTGAAGGATTTTGATGG - Intronic
1172881697 20:38204088-38204110 TGGTATCTGAAGGATAAGGAGGG + Intergenic
1174212405 20:48890321-48890343 TGGATCCAGAAGGTTTCGGATGG - Intergenic
1176751805 21:10697006-10697028 TGGATTCAAAAGGATTGGAATGG - Intergenic
1176751931 21:10697935-10697957 TGGACTCGAAAGGAGTTGGATGG - Intergenic
1176910717 21:14561565-14561587 CAGATTCTGAAGCATTTGGATGG + Intronic
1177222716 21:18215717-18215739 GTTATTCTGAAGGATTTGGTTGG + Intronic
1177703448 21:24669092-24669114 TGGAATATAAAGGATTTAGATGG - Intergenic
1178039417 21:28623097-28623119 TAGATTCTGAAGGATCTACAAGG - Intergenic
1178082870 21:29083075-29083097 TGAATTCAGAAATATTTGGAGGG + Intronic
1178179051 21:30138615-30138637 TGGAGTCTCAAGGATTAGAAAGG + Intergenic
1179604482 21:42504962-42504984 TGGATTTGGAATAATTTGGAAGG - Intronic
1180530944 22:16349596-16349618 TGGATTCAAAAGGAGTGGGATGG + Intergenic
1182029512 22:27146838-27146860 TGGCTTGTGAAGGATTTGGAAGG - Intergenic
1182837776 22:33358321-33358343 TTGATTTTGGAGGATTGGGATGG - Intronic
1203318702 22_KI270737v1_random:36211-36233 TGGATTCAAAAGGAGTGGGATGG - Intergenic
951106166 3:18745786-18745808 TTGATTCTGGAGGTCTTGGATGG + Intergenic
951119237 3:18905052-18905074 TGTTTTATGAGGGATTTGGATGG - Intergenic
951730130 3:25801102-25801124 TGGATGGAGAAGGATTGGGAAGG - Intergenic
952213600 3:31253763-31253785 TGGAAAATGAAGGAGTTGGACGG - Intergenic
952617399 3:35291192-35291214 TGGACTTTTGAGGATTTGGATGG - Intergenic
957298429 3:78361073-78361095 TGGATGATCAGGGATTTGGAGGG - Intergenic
961616623 3:128187891-128187913 AGAAGTATGAAGGATTTGGAGGG + Intronic
962133343 3:132706465-132706487 TGGATTTTGATGCATTTTGAAGG - Intronic
964119449 3:153167282-153167304 TGGATTTTGAAGGTTTGAGAAGG + Intergenic
964612753 3:158631449-158631471 TAGTCTCTGAAGGATTGGGAGGG + Intergenic
964745855 3:160011681-160011703 TGGATTCTGAAGAAATGGTATGG - Intergenic
965351092 3:167612009-167612031 TGTATTCTGCAGCTTTTGGATGG - Intronic
965963141 3:174452674-174452696 TGGCTTCTGGAGGATTTTAAGGG - Intronic
966016473 3:175145079-175145101 TGGATAGAGAAGGATTTGGGAGG + Intronic
966447636 3:180021138-180021160 TGGATTTTGAAGGATAAGCAAGG + Intronic
967293236 3:187942234-187942256 TGATTTCTGAAGGCTTTGGATGG - Intergenic
970903493 4:21187682-21187704 AGGATTCTGAAGAATTAGTAAGG - Intronic
972890960 4:43555272-43555294 TGTATTCTGCAGCAGTTGGATGG + Intergenic
973150323 4:46879781-46879803 AGGATCCTGAAGGATTGGAACGG - Intronic
973848097 4:54933651-54933673 TGCATTCTAGAGAATTTGGAGGG - Intergenic
974976832 4:68903240-68903262 TAGATTCTGTGGCATTTGGATGG - Intergenic
975194104 4:71502795-71502817 TGTATTCTGTAGCAGTTGGATGG + Intronic
975558694 4:75689631-75689653 TTGATCCTGAAGGATTTGTTTGG - Intronic
975649414 4:76577686-76577708 TGGATTGTGAAGGAGTTATAGGG - Intronic
978427275 4:108595656-108595678 TGGACTCTGAAAAATTTTGAAGG - Intergenic
978568567 4:110111706-110111728 TGGACCCTGAAGGTTTTGGATGG + Intronic
979879214 4:125933182-125933204 TGTATTCTGCAGCTTTTGGATGG - Intergenic
980059051 4:128109350-128109372 TGATTTCTGAGGGATTTGTATGG + Intronic
981696905 4:147568151-147568173 TGGATGCTGACTGATTTGGTCGG - Intergenic
983129390 4:163996630-163996652 GGGATTCTGTAGGAATTGGTGGG - Intronic
984271220 4:177550692-177550714 TGGACTGGGAAGGATTTGGGAGG - Intergenic
984745233 4:183209068-183209090 TAGAGTCTGAAGGCTGTGGAAGG + Intronic
984762542 4:183375569-183375591 GGTATTCTGAAGGATTTCCAGGG - Intergenic
986266267 5:6194071-6194093 TGGAAGCTGAAGGATTCTGAGGG + Intergenic
986571917 5:9174547-9174569 TGCATTCTGAAGGACATGGAAGG - Intronic
986715061 5:10517520-10517542 CGGATTCTTATGCATTTGGATGG - Intronic
986810648 5:11354776-11354798 TGTATTCTGAAGCTGTTGGATGG - Intronic
986818336 5:11437405-11437427 TGGATTCTCATGCATCTGGAAGG - Intronic
987794529 5:22609025-22609047 TGGTTCCTTCAGGATTTGGAAGG - Intronic
989277631 5:39608433-39608455 TGGATTCAGAAGGTCTGGGAGGG - Intergenic
989676838 5:43982632-43982654 TGGATGATGAGGGACTTGGAAGG - Intergenic
990865709 5:60377611-60377633 TGGTTTCTGTAGGAGTTGGCAGG - Intronic
990969148 5:61484044-61484066 TATATTCTGAAGTTTTTGGAGGG + Intronic
991931366 5:71756118-71756140 TGTCTTCTGTAGGATCTGGATGG + Intergenic
992341046 5:75823811-75823833 TGGAATCTGCAAGACTTGGAGGG + Intergenic
993426782 5:87775046-87775068 TGGTTTCTCAAGCATATGGATGG - Intergenic
993707162 5:91184021-91184043 AGGAATCTGAAGGATTCAGACGG + Intergenic
997229174 5:132230282-132230304 GGGAATCTGAAGGATTCTGAAGG - Intronic
999088515 5:148914360-148914382 TGGATGCTTAAGGATTGGAAGGG - Intergenic
999330114 5:150667857-150667879 TGCATTCTGAAGAATTTGCGGGG - Intronic
1000967612 5:167677504-167677526 TGTATTCTGACAGATTTTGATGG - Intronic
1001584833 5:172826807-172826829 TGGATGGTGAAGGACTTTGAGGG - Intergenic
1002766660 6:246252-246274 TGGATTCTGAAGGATTTTACAGG + Intergenic
1003586014 6:7389880-7389902 TGGCTTCTGAATGGTTTGCAAGG + Exonic
1006606796 6:35263246-35263268 TTGATTCTGAAGGACTTCAAAGG - Intronic
1007315128 6:40981665-40981687 TGGATTTTGAAATAGTTGGATGG + Intergenic
1007371833 6:41431142-41431164 TGGACTTTGAAGGATGTAGATGG + Intergenic
1008053846 6:46926595-46926617 TGGAATGTGAAGGCTGTGGACGG - Intronic
1008065815 6:47046922-47046944 TGGACTCTATAGGATTTTGATGG - Intergenic
1008098064 6:47360470-47360492 TGTCTTTTGAAGGAATTGGAAGG - Intergenic
1008843144 6:55928683-55928705 AGGATACTGAAGGACTTGAAGGG + Intergenic
1008889282 6:56467337-56467359 AGGATCCTGAGGGATTTGGTTGG - Intronic
1010777779 6:79906714-79906736 TAGATGCTCAAGGATTTGGAAGG - Intergenic
1011719854 6:90144318-90144340 TGTTTTTTGAAGGATTGGGAAGG + Intronic
1012540060 6:100352133-100352155 AGGATTTTAAAGGATTTGCAGGG + Intergenic
1012817978 6:104048594-104048616 TTGATTATGAAGGAGTTGGAGGG - Intergenic
1013159374 6:107526510-107526532 TGGGTCTTGAAGGATTTGGAAGG - Intronic
1013681667 6:112530846-112530868 TGGCTTCTGTAGAAATTGGATGG - Intergenic
1013922508 6:115424876-115424898 TCTATTAGGAAGGATTTGGAGGG + Intergenic
1013972023 6:116031504-116031526 TGGATATTGAACAATTTGGATGG + Intronic
1016355809 6:143217178-143217200 TGGAGTCTGAAGGATCAGGCTGG - Intronic
1017941698 6:159058775-159058797 AAGATTCTGAAGCAATTGGACGG - Intergenic
1021250952 7:18324191-18324213 TGGACTTTGAAGGATGAGGAAGG + Intronic
1021488240 7:21190252-21190274 TGGATCCTGAAGTATGTGGAAGG - Intergenic
1021752535 7:23817641-23817663 GGGATTCTGAAGGATGAGAAGGG - Intronic
1021860217 7:24898549-24898571 TGGATTGTGAAGGCCATGGATGG - Intronic
1022062119 7:26807758-26807780 TGGTTGCTGAAGGTTTGGGATGG - Intronic
1022133515 7:27425607-27425629 TGGGGTCTGAGGGATGTGGATGG + Intergenic
1023532101 7:41168658-41168680 TGCATTCTGATGGTCTTGGAGGG - Intergenic
1024144140 7:46494262-46494284 TGTAATGTGAAGGGTTTGGAAGG + Intergenic
1024372293 7:48599883-48599905 TGTATTCTGTAGTAGTTGGATGG + Intronic
1024387502 7:48769603-48769625 TGGAATCTGGAGGCTCTGGAAGG + Intergenic
1024776575 7:52794162-52794184 TGGCATCTGAAGGCTTTGTATGG - Intergenic
1026383197 7:69819853-69819875 TGTATTCCTAATGATTTGGAAGG - Intronic
1027446540 7:78280137-78280159 TAGTTTCTGGGGGATTTGGAAGG + Intronic
1027883686 7:83874965-83874987 AGGATTCTGAAGTGATTGGATGG - Intergenic
1028047720 7:86143864-86143886 TGAAGTCTGAAGTATTTGAAAGG - Intergenic
1032263584 7:130355161-130355183 TAGCTTCTGTAGGACTTGGAGGG - Intronic
1032899154 7:136287310-136287332 TGCATGCTGAAAGATTTAGAGGG + Intergenic
1033377269 7:140774030-140774052 CAGTTTCTGAAGGATTTGGCAGG - Intronic
1033858405 7:145594396-145594418 TGGATGGTGAAGGACTTAGAAGG + Intergenic
1034034471 7:147804453-147804475 TGGAGTGTGAAGTCTTTGGAAGG - Intronic
1034587292 7:152105873-152105895 TGGAATCAGAAGGATTAAGAGGG - Intronic
1034940609 7:155228020-155228042 AGGATTTTGAAAGATTTGGAGGG + Intergenic
1035323510 7:158049973-158049995 TGGTTCCTGAAGGAGTTGAAAGG + Intronic
1036976844 8:13423015-13423037 AGAATTCTGAAGGAGTTGGGGGG + Intronic
1037992206 8:23328972-23328994 TGGAATCTGCAGACTTTGGAGGG - Intronic
1038352184 8:26786713-26786735 TGGAGTCTGAGGTATATGGATGG - Intronic
1038845931 8:31229637-31229659 AGGATTCTGAAGGATATGTATGG - Intergenic
1040679262 8:49789031-49789053 TGAATTATCAAGGACTTGGAAGG + Intergenic
1042977886 8:74491236-74491258 GGGATTCTGGAGGATATGAATGG - Intergenic
1044384220 8:91568014-91568036 TGGAGTCTGACTGATTTTGATGG - Intergenic
1044731542 8:95232374-95232396 TGGGTTCTGCAGGGCTTGGAAGG - Intergenic
1045171419 8:99674052-99674074 TGAATTCTGCAGCTTTTGGATGG + Intronic
1045378425 8:101599354-101599376 TGGGGCCTGAAGGATTTGGGTGG - Intronic
1045725165 8:105163689-105163711 TGGAAACTGAAGTGTTTGGATGG + Intronic
1046760057 8:118011422-118011444 TGGATTTTGATGGATTTTGTAGG - Intronic
1049563567 8:143325645-143325667 TGGATTGTGAAGGGCTTTGAGGG - Intronic
1050283118 9:4073369-4073391 TGGATTCAGAAGATCTTGGATGG + Intronic
1051153637 9:14115153-14115175 TGGTTTCTGAAAGACTAGGAAGG - Intronic
1054882198 9:70155642-70155664 TGGAGGCTGAAGGAATGGGAGGG - Intronic
1056752297 9:89361246-89361268 TGGATCCTGAAGGAATTAGCAGG + Intronic
1058713256 9:107699390-107699412 TGAATTCTGAAAGATTTCCAAGG - Intergenic
1059445937 9:114337809-114337831 GGGATTCTGCAGGAGTGGGAGGG + Intronic
1061468023 9:130798661-130798683 CGGATTCTTTAGGAATTGGAAGG + Intronic
1203724542 Un_GL000216v2:39128-39150 TGGACTCGAAAGGATTCGGATGG - Intergenic
1185485161 X:476553-476575 GGAATGCTGAAGGATCTGGAAGG - Intergenic
1185485164 X:476574-476596 GGAATGCTGAAGGATCTGGAAGG - Intergenic
1185485167 X:476595-476617 GGAATGCTGAAGGATCTGGAAGG - Intergenic
1185485170 X:476616-476638 GGAATGCTGAAGGATCTGGAAGG - Intergenic
1185485173 X:476637-476659 GGAATGCTGAAGGATCTGGAAGG - Intergenic
1186556994 X:10570238-10570260 TGGATTCTGAAGACCTTGCAGGG - Intronic
1188978881 X:36708268-36708290 TGGCTTCTGAAAGATTTTGTGGG + Intergenic
1190290683 X:48990248-48990270 TGGAACCTGAAGGATCTGGGTGG - Intronic
1190523995 X:51310402-51310424 TGGTTTCTGAAAGATTTGATGGG + Intergenic
1190925769 X:54902539-54902561 TGAATTCTGAATGACTTGCATGG + Intergenic
1191739421 X:64421036-64421058 TGGATTTTGCAGGGTGTGGATGG + Intergenic
1192615471 X:72616679-72616701 TGTATTCTGTAGCTTTTGGATGG - Intronic
1195043513 X:101035296-101035318 AGGTGTCTGAAGTATTTGGAAGG - Intronic
1195262740 X:103149555-103149577 TGGATGGTCAAGGACTTGGAAGG + Intergenic
1195370147 X:104165870-104165892 TGGAGTTTGAAGGATTAGCAGGG + Intergenic
1195514231 X:105754291-105754313 TAGTTTCTGAAGGTTTTAGATGG - Intronic
1197696363 X:129554458-129554480 TGGATTCTGAAGTTTCTGGGAGG + Intronic
1198470661 X:136943367-136943389 TGGATTCTGAAATATTTCAAAGG - Intergenic
1198853668 X:140993078-140993100 TGCATGCTGAAGTATTTAGAAGG - Intergenic
1199084922 X:143617418-143617440 TAGATTCTGAAGGGTCTTGAAGG - Intergenic
1199843133 X:151671147-151671169 TGCATTCTGCTGGTTTTGGATGG - Exonic
1200701130 Y:6403491-6403513 GGGATCCAAAAGGATTTGGAAGG - Intergenic
1200965565 Y:9033570-9033592 TCTATTCTTAAGTATTTGGAAGG + Intergenic
1201032982 Y:9761207-9761229 GGGATCCAAAAGGATTTGGAAGG + Intergenic
1201141931 Y:11035623-11035645 TGGAGTCTAAAGGAATGGGATGG - Intergenic
1201210547 Y:11676615-11676637 TGGATTGGAAAGGATTTGAAGGG + Intergenic
1201325207 Y:12749016-12749038 TGTATGCTGAAGGACTTGCAGGG - Intronic
1201735585 Y:17257003-17257025 TGGATATTAAAGGATTAGGAGGG - Intergenic