ID: 946138445

View in Genome Browser
Species Human (GRCh38)
Location 2:217667444-217667466
Sequence AACAAGAAGGTGGGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 357}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946138439_946138445 16 Left 946138439 2:217667405-217667427 CCAAAGAAAAGAAAATGTTTATT 0: 1
1: 1
2: 9
3: 160
4: 1426
Right 946138445 2:217667444-217667466 AACAAGAAGGTGGGGACAAAGGG 0: 1
1: 0
2: 2
3: 36
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946138445 Original CRISPR AACAAGAAGGTGGGGACAAA GGG Intronic
902565665 1:17309772-17309794 ACCAAGAAGTTGGGGAGAAAAGG + Intronic
906376538 1:45301166-45301188 CAGAAGGTGGTGGGGACAAAGGG + Intronic
908076198 1:60521854-60521876 GACAAGAACGTGGGAAAAAATGG - Intergenic
909506718 1:76399504-76399526 AACAAGATGGTGTGGACACAAGG - Intronic
909969617 1:81966019-81966041 ATAAAGGAGGTGGGGAAAAAAGG - Intronic
913351876 1:117870445-117870467 ACCAGAGAGGTGGGGACAAAAGG + Exonic
914360522 1:146932120-146932142 AACAAGATAGCTGGGACAAAGGG - Intergenic
914493225 1:148167779-148167801 AACAAGATAGCTGGGACAAAGGG + Intergenic
914742486 1:150476948-150476970 AACAAAATAATGGGGACAAAGGG - Intergenic
915170603 1:153974551-153974573 AAGAAGAAGATGGGGAAAAGGGG + Exonic
915947742 1:160166392-160166414 AAAGAGTAGGTGGGAACAAAAGG + Intronic
916682551 1:167117583-167117605 AACCAGAGGGTTAGGACAAAGGG - Intronic
917134335 1:171774725-171774747 AACAGGAAGGAGGGGAAAATAGG + Intergenic
917222169 1:172743543-172743565 AACAAGGAGAGGGGGAAAAAAGG - Intergenic
918065201 1:181095877-181095899 AACAAGCAGGTGGGAACACATGG - Intergenic
918498690 1:185169604-185169626 AGCAAGAAGCTGGGCACAATGGG + Intronic
919509123 1:198438978-198439000 GACAAGAAGGTAGGGAAGAAGGG + Intergenic
919522832 1:198610177-198610199 AATAAGGAGGTTTGGACAAAGGG + Intergenic
921802432 1:219416798-219416820 AACCAGCAGATGGCGACAAAAGG - Intergenic
923024153 1:230191076-230191098 AGCAAGAAAGTGGAGACCAAGGG + Intronic
923696134 1:236254316-236254338 AAGAGGTAGGTGGTGACAAATGG - Intronic
924723172 1:246642886-246642908 AACAAAAAAGGGGGGAAAAAAGG - Intronic
1063518977 10:6723723-6723745 AACAAGAAGGGAGGAAGAAAGGG + Intergenic
1064098454 10:12441996-12442018 CACAATAATGTGGGGAAAAAAGG + Intronic
1064152779 10:12878727-12878749 AGCAAGTATGTGGGGAAAAAAGG + Intergenic
1064498344 10:15939886-15939908 AGCAAGATGGAGGGGCCAAACGG - Intergenic
1065119587 10:22515587-22515609 AACAAGGTGGTGGGCACAGAGGG + Intergenic
1065938140 10:30539623-30539645 GAAATGAAGGTGGGGGCAAAGGG - Intergenic
1067082756 10:43220927-43220949 AACAAGAAAGTGATGTCAAAAGG + Intronic
1067153055 10:43752209-43752231 AACCAGAATCTGGGGAGAAAGGG - Intergenic
1069361248 10:67644052-67644074 AACAAGATGGCTGGGTCAAATGG + Intronic
1070090642 10:73281976-73281998 AAAGAGAAGGTGGGGAAAAGGGG + Intronic
1070465327 10:76716970-76716992 AAAGAGAAGATGGGAACAAAAGG - Intergenic
1071954587 10:90743952-90743974 ATCAAGAAAATGGGGAGAAATGG + Intronic
1072222259 10:93336443-93336465 AACTACAACGTGGGGATAAAAGG + Intronic
1072718387 10:97766393-97766415 TCCAAGAAGGTGGGGCCACAGGG - Intergenic
1074839127 10:117330610-117330632 AACAAGAAGGAAGGGACACGTGG - Intronic
1076174660 10:128358867-128358889 AACGAGAACGTGTGGACACAGGG + Intergenic
1077943161 11:6865913-6865935 AACGAGAGGGTGGGGACAAGAGG - Intergenic
1078641982 11:13105262-13105284 AAGAGGAAGTGGGGGACAAATGG - Intergenic
1078757505 11:14224768-14224790 GAGAAGTAGGTGGGGCCAAAGGG + Intronic
1079194386 11:18312725-18312747 CTCAAGAAAGTGGGGGCAAAGGG - Intronic
1080851386 11:36073268-36073290 AGCAGGAAGATGGGGACCAAGGG - Intronic
1083010578 11:59394315-59394337 AACAAGAAGGTGTGGATAATGGG + Intergenic
1083584712 11:63848360-63848382 AAAAAGAAGGTGGAGAAAAAAGG - Intronic
1084441798 11:69178891-69178913 AAGAGGAAGGAGGGAACAAAGGG + Intergenic
1085104303 11:73829084-73829106 GAGAGGAAGGTGGGGACAGACGG - Intronic
1086145815 11:83550437-83550459 AAAGAGAAGGTGGGCTCAAATGG - Intronic
1086213478 11:84349316-84349338 AAAAAGAAGGTGGGGGCAGGGGG - Intronic
1086617542 11:88840464-88840486 AAAAAAAAGGTGGGGGTAAAGGG - Intronic
1087308562 11:96513212-96513234 AACTTGAAAGTGAGGACAAAAGG - Intergenic
1088006050 11:104941932-104941954 AATAAGACATTGGGGACAAAAGG - Intergenic
1088136830 11:106565599-106565621 AACAAGGAAGTGTTGACAAAGGG + Intergenic
1088419143 11:109623030-109623052 TGAAAGAAGGTGGGAACAAAGGG - Intergenic
1089905987 11:122039142-122039164 AATAGGAAGGTGGGCAGAAAAGG + Intergenic
1090208605 11:124899482-124899504 AGCAAGAAGCTGAGGACAGAGGG + Intergenic
1090629408 11:128633193-128633215 AACAAGAAGGTTAGGAAAAAAGG + Intergenic
1090878645 11:130814020-130814042 AACAAAAAGGTGGAGGCAGAAGG + Intergenic
1090950296 11:131467190-131467212 GACAAAAAGGTGGGGACAGATGG + Intronic
1091814667 12:3428306-3428328 AAAAAAAAAGCGGGGACAAAAGG - Intronic
1092576353 12:9787473-9787495 AAAAAGAAGGAGTGGAGAAACGG - Intergenic
1094359101 12:29610537-29610559 GACAGTAATGTGGGGACAAAGGG + Intronic
1097235354 12:57535754-57535776 GACAAGAGAGTGGGGACAAAGGG - Exonic
1099254414 12:80297980-80298002 AACAAGAACTTGGAGACAATTGG - Intronic
1101308420 12:103554305-103554327 AACCAGGTGGTGGGGAGAAAAGG + Intergenic
1101405063 12:104421284-104421306 AACAAGCAGGAGGGGAAAAAAGG - Intergenic
1101818553 12:108164884-108164906 TAGGAGAAGGTGGGGACAAAGGG + Intronic
1104776794 12:131394153-131394175 AAAAGGAAGGTGGGGAGAGAGGG - Intergenic
1105977413 13:25484353-25484375 AACAAGATGGAAGGGAAAAAAGG - Intronic
1107643093 13:42464510-42464532 AACAAGAACATGTGGACACAGGG + Intergenic
1108034352 13:46273122-46273144 AACAAATAGTTGGGGACATAGGG + Intronic
1108977747 13:56470093-56470115 ATGAAGAACGTGGAGACAAATGG - Intergenic
1109443147 13:62400440-62400462 GATAAGGAGGAGGGGACAAAGGG - Intergenic
1110640342 13:77816542-77816564 AATAAGAAGATGGGAAAAAAAGG - Intergenic
1110923291 13:81116809-81116831 AGCAAGATGGTGGGAGCAAATGG + Intergenic
1111438971 13:88253126-88253148 CCAAGGAAGGTGGGGACAAAAGG + Intergenic
1111767450 13:92549832-92549854 GACAAGAAGGTAGGGGTAAAAGG + Intronic
1113014154 13:105808463-105808485 AAGAAAGAGGTGGAGACAAAGGG + Intergenic
1113193658 13:107779761-107779783 TAGAAGAAGGTGGAGACAAGAGG - Intronic
1113557405 13:111249437-111249459 AACAAGCAGGAGGGGAAAAAAGG + Intronic
1114314336 14:21495715-21495737 AACTAGAATTTGGGGAGAAATGG + Intronic
1114361977 14:21983803-21983825 AACAAGAAAGTGGAGAGAACTGG + Intergenic
1114538437 14:23437519-23437541 AGCTGGAAGGTGGGGACGAAAGG - Intergenic
1114745580 14:25142982-25143004 AAAAAGAAGGTGTACACAAAAGG - Intergenic
1115502476 14:34061513-34061535 AACAAGAAGGTGAGGACAGATGG - Intronic
1115773894 14:36694431-36694453 AACAAGATGGCTGGGTCAAATGG + Intronic
1116082914 14:40199175-40199197 AACAAGAAAGTGGGGAGAACTGG - Intergenic
1116130769 14:40854201-40854223 AGGAAGAAGCTGGGGACAAGCGG + Intergenic
1116188887 14:41637150-41637172 AACAAGAAAGAGGGGAGAATTGG + Intronic
1117445130 14:55797016-55797038 AAAAAGAAGGTGTGGCCTAATGG + Intergenic
1118073451 14:62271402-62271424 AGAATGAAGGTGGGGACAAAGGG - Intergenic
1118171600 14:63394668-63394690 AAAAAGAAGGTGGAGTCACATGG - Intronic
1118263396 14:64269626-64269648 AAGAAGAACGTGGGGACATGTGG + Intronic
1120460213 14:84785599-84785621 AACAATAATGTGGGCTCAAAAGG - Intergenic
1120651673 14:87141159-87141181 AAGTAGAAGTTGGGGAGAAAAGG + Intergenic
1121209759 14:92199463-92199485 AACAGGAAGGAGGAGACGAAGGG + Intergenic
1121449274 14:93997117-93997139 CCCAAGAAGATGGGGAGAAAGGG - Intergenic
1122612993 14:102998801-102998823 AGAAAGAATGTGGGGACAGAGGG + Intronic
1122889637 14:104726342-104726364 CACTCGCAGGTGGGGACAAAGGG - Intronic
1123452751 15:20381993-20382015 AAGAAGAGGGTGGTGACTAAAGG + Intergenic
1123758556 15:23415696-23415718 AACAAGACGGGGAGGAGAAATGG - Intergenic
1123857782 15:24431595-24431617 TATGAGAAGGTGGGGATAAATGG + Intergenic
1123862415 15:24482153-24482175 TATGAGAAGGTGGGGATAAATGG + Intergenic
1126105264 15:45143078-45143100 ACCTAGGAGGTGGGGACAATAGG + Intronic
1126318824 15:47399702-47399724 AAGGAGAAGCTGGGGACTAAAGG + Intronic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1127361056 15:58245618-58245640 AAGGAGAAGGTGGGGACACGTGG - Intronic
1128565056 15:68695584-68695606 AACAAGGAGGGAGGGAGAAAAGG + Intronic
1129414972 15:75370974-75370996 AAAAAAAAGTTGGGGGCAAAGGG + Exonic
1129798921 15:78398749-78398771 ATCAGGGAGGTGGGGAAAAAGGG - Intergenic
1130209806 15:81912569-81912591 AAAAAGAAAGTTGGGACAGAAGG - Intergenic
1130559180 15:84945254-84945276 AAAGGGAAGGTGGGGACAGATGG - Exonic
1131735953 15:95332579-95332601 AATAAGAACGTGGGTATAAATGG - Intergenic
1132829894 16:1922869-1922891 AACCAGACTGTAGGGACAAAGGG + Intergenic
1134032419 16:11003195-11003217 AAGAAGAAGATGAGGAGAAAGGG + Exonic
1134398909 16:13890653-13890675 AACAGGAAGGTGGAGACAGGAGG + Intergenic
1134624323 16:15713185-15713207 AACAAGAGGGTCGGGTCCAATGG + Intronic
1135192776 16:20368317-20368339 AACAAGGAGGTGGGAGCACAGGG + Intronic
1135427552 16:22351879-22351901 AACCAGAAAGAGGGGAGAAATGG + Intronic
1137469838 16:48744381-48744403 AATAAGAAAATGGGCACAAAAGG - Intergenic
1138310101 16:56016402-56016424 AACTGGAAGGTGAGGACACAAGG + Intergenic
1138892482 16:61161941-61161963 AACAAGTGGTTGGAGACAAATGG - Intergenic
1139076917 16:63462670-63462692 AAAAAGAAGGTGGGAAAGAATGG + Intergenic
1139288821 16:65839122-65839144 TACAAGATGGTGGAGACACAGGG - Intergenic
1139321496 16:66117968-66117990 CACAGGAAGGTGGTGCCAAAAGG - Intergenic
1140740336 16:77936051-77936073 AAAAAGGAGGTGGGAAGAAATGG + Intronic
1141606816 16:85158655-85158677 GACCAGAGGGTGGGGACAATCGG - Intergenic
1142656383 17:1397197-1397219 TACAAGAAAGTGGGGAAGAAAGG - Intronic
1143357397 17:6340590-6340612 CACAAGCACTTGGGGACAAATGG - Intergenic
1143712452 17:8744065-8744087 AAGAAGAAGGTGGGGACTCAGGG - Exonic
1144144620 17:12385107-12385129 AAAGAGAAGGTAGGGAAAAACGG - Intergenic
1144187922 17:12813930-12813952 ACCAAGAAGGTGAGGTCGAAGGG - Intronic
1144476616 17:15594572-15594594 GAGAAGATGGTGGGGAAAAATGG + Intronic
1144921636 17:18768830-18768852 GAGAAGATGGTGGGGAAAAATGG - Intronic
1145839357 17:27981316-27981338 AAGAAGAAGGAGGAGACAGAAGG + Intergenic
1147610880 17:41801280-41801302 AGCAGGGAGGTGGGGGCAAAGGG - Intergenic
1148011890 17:44489324-44489346 AAAGAGGGGGTGGGGACAAAAGG - Intronic
1148073600 17:44922617-44922639 AGCAAGGAGGTGGGCATAAAAGG + Intergenic
1150460809 17:65348951-65348973 AAAAAATAGGTGGGAACAAATGG + Intergenic
1150656957 17:67045507-67045529 AAAAAGAAGGTGGGGGCAGGTGG - Intronic
1150686103 17:67322197-67322219 TACAATAAGGAGAGGACAAAAGG + Intergenic
1150745706 17:67814860-67814882 AAAAAGAAGCTGAGGACTAACGG + Intergenic
1151153170 17:72105258-72105280 GACAAGAAGGTGAGAACAAAGGG + Intergenic
1151214649 17:72569312-72569334 AAAAATGAGGTGGGGAAAAAAGG + Intergenic
1151366654 17:73621991-73622013 ATAAAGAAAGTGGGGACAAGAGG + Intronic
1151444627 17:74155123-74155145 AACATGAGGGTGAGGACAAGTGG + Intergenic
1151546124 17:74794273-74794295 AACGAGAAGTTGGGAACACAGGG - Intronic
1151712299 17:75813732-75813754 AACAAGAGGGTGGGGTCAGATGG - Intronic
1151887113 17:76929637-76929659 TCGAAGAAAGTGGGGACAAAAGG + Intronic
1155673599 18:28402536-28402558 AGAAAGAAGATGGAGACAAATGG + Intergenic
1155694553 18:28669958-28669980 AACAAGAAGTTGAGCAGAAAAGG + Intergenic
1156848314 18:41695772-41695794 AACAAAAACCTTGGGACAAAGGG - Intergenic
1158536405 18:58311961-58311983 AGTAAGAAGGAGGGGACAAGTGG - Intronic
1158882711 18:61796331-61796353 AACAAGGTGGTGTGGACAGAAGG + Intergenic
1159200445 18:65176941-65176963 AAGAAGAAGGGGAGGAGAAAAGG + Intergenic
1159474926 18:68909161-68909183 AACAAGAAGGAAGGGAGGAAGGG + Intronic
1159726604 18:71967987-71968009 ATCAAGAGGATGGGTACAAAAGG + Intergenic
1159871520 18:73763616-73763638 CACATGAAGGTGGGGACTTAGGG + Intergenic
1159876674 18:73819720-73819742 TAGAAGAAGATGAGGACAAAAGG + Intergenic
1160368841 18:78353636-78353658 CAAAAGAAGGCAGGGACAAAAGG - Intergenic
1160577044 18:79862667-79862689 AACAAAAAGCTGGGGACGAAAGG - Intergenic
1160877770 19:1305150-1305172 GACCAGAGGGTGGGGACCAAGGG - Intergenic
1162302851 19:9854059-9854081 AGCAAAAAGGCGGGGAGAAAGGG + Exonic
1164441108 19:28281659-28281681 AAGAAGAGGGTGGGGGCTAAGGG - Intergenic
926020910 2:9495079-9495101 GACAAGAAAGTTGGGACAAAGGG - Intronic
926482450 2:13416252-13416274 AAGAAGAGGGTGGTGACTAAAGG - Intergenic
927720316 2:25378084-25378106 AACAAGGCGGTGGGGGCACATGG + Intronic
928820000 2:35350128-35350150 GACAAGATGGTGGGGACTAGGGG + Intergenic
931202970 2:60118264-60118286 AACCAGCAGATGGTGACAAAAGG - Intergenic
931440942 2:62290067-62290089 AAAGACAAGGTGGAGACAAATGG + Intergenic
931594412 2:63926114-63926136 AGCAGGAAGGAGAGGACAAAGGG - Intronic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932173976 2:69582732-69582754 AACAAGAAGTGGTGGTCAAAAGG + Intronic
933082542 2:78010345-78010367 AACAATAAAATGGGAACAAAAGG + Intergenic
936953973 2:118006017-118006039 GAAAAAAAAGTGGGGACAAAAGG - Intronic
937183556 2:120017412-120017434 AACAAGAAGCTGTGCAGAAAAGG - Intronic
937672308 2:124551119-124551141 AAGAAGAAGCCGGGCACAAAGGG - Intronic
937809757 2:126186302-126186324 ACCAAGAAAGAGGGGACAAGTGG - Intergenic
939015281 2:136896211-136896233 AGCAAGAATGTGGGGAAACAGGG - Intronic
939414262 2:141873078-141873100 AAAGCAAAGGTGGGGACAAATGG + Intronic
939856538 2:147365495-147365517 AGAACGCAGGTGGGGACAAAGGG + Intergenic
942142404 2:172990509-172990531 AGCAGGAAGGTGGGGAGCAAAGG - Intronic
942355452 2:175107286-175107308 GACAAGAATGTGGGAACAACTGG + Intronic
942706154 2:178775207-178775229 AAGAAAAAGGTGGGGGAAAAAGG + Intronic
942917009 2:181323049-181323071 AACAAAAAGGGGGGGTCAAGAGG - Intergenic
942973698 2:181988663-181988685 AACAATAATGGGTGGACAAAAGG + Intronic
943982433 2:194571963-194571985 AACTACAAGCTGAGGACAAAAGG + Intergenic
944747772 2:202675602-202675624 CACCAGAAGGTGGGAACAACTGG - Intronic
945337428 2:208609114-208609136 TACAAGAATTTGGGGAGAAAGGG - Intronic
946138445 2:217667444-217667466 AACAAGAAGGTGGGGACAAAGGG + Intronic
946182626 2:217957855-217957877 AAAAAAAAGGTGGGGAGAAGAGG + Intronic
947013391 2:225590556-225590578 AACAATAACTTGGGGACATATGG + Intronic
947177149 2:227379327-227379349 AACCAGAAGATTGGGATAAAAGG - Intronic
947347166 2:229204529-229204551 AACAAAATGGTGGGCACAGATGG - Intronic
1168849324 20:965670-965692 AACAAATGGGTGGGGAGAAAGGG + Intronic
1169314443 20:4576800-4576822 AACAAGGAGGTGGGGATCACTGG + Intergenic
1169320448 20:4628444-4628466 AACAAGAAACAGGGAACAAATGG + Intergenic
1169801827 20:9518482-9518504 AAGAAGAAGGAGGAAACAAAGGG - Intronic
1170678334 20:18502768-18502790 AGCAAGAAAGTGGGGAGAACTGG - Intergenic
1172121084 20:32599065-32599087 AATAGCAAGGTGGGGACAATAGG + Intronic
1172338668 20:34138003-34138025 AAAAAAAAGGTGGGGAGACAGGG + Intergenic
1172477205 20:35247911-35247933 GACAGGGAGGTGGGGAGAAATGG + Intronic
1173158748 20:40636998-40637020 AACAAGCAGGTGGGGAAGGAAGG - Intergenic
1173599922 20:44287331-44287353 AACAAGAAAGTGGGGAGAACTGG - Intergenic
1173690831 20:44960033-44960055 AACAAGCAGGTGGAAAGAAAGGG + Intronic
1176093665 20:63329845-63329867 AACAGGAATGTGGGGTCACAGGG + Intronic
1176914309 21:14606256-14606278 AAGAAAAAGCTGGGGAAAAATGG - Intronic
1177957170 21:27613177-27613199 ACCAAGAAATTGGGGAGAAAAGG - Intergenic
1178787073 21:35663665-35663687 AACAAGAAGGTGGAAAGATAGGG + Intronic
1181017951 22:20081911-20081933 AACTTGAAGGTGGTGAGAAATGG - Intronic
1181594025 22:23902806-23902828 AACAAGGAGGTGAGGAAGAACGG - Intergenic
1181710223 22:24679807-24679829 GAAAAGAAGGTGGGGAAAAATGG + Intergenic
1182048649 22:27296767-27296789 AACAAGAAACTGGGAATAAAGGG - Intergenic
1183268160 22:36843617-36843639 AATGAGAAGGAGGGGAAAAAAGG + Intergenic
949134212 3:542990-543012 AGCTAGAAGGTGAGGACCAAAGG + Intergenic
949355910 3:3180018-3180040 AAAAACAAGGTGGAGACTAAAGG - Intergenic
950444340 3:13027526-13027548 GACAGGAAGGTGAGGACAAGAGG + Intronic
951011539 3:17687492-17687514 AACAAGGAGAGGGGGAAAAAAGG + Intronic
951069306 3:18307706-18307728 AGCAAGAAGGTAGGGAACAATGG - Intronic
952423688 3:33153447-33153469 AGGAAGAAGATGGGGACAGAGGG - Exonic
953838476 3:46368444-46368466 CACAAGAAAGTGGGGACCCATGG - Intergenic
953886111 3:46715198-46715220 AACAAGGATGTGGGTGCAAAGGG + Intronic
954380234 3:50215372-50215394 AACAGGAACCTGGGGACACATGG - Exonic
954418320 3:50405176-50405198 AAGAGGGAGGTGGGGACAAAAGG + Intronic
955856245 3:63277106-63277128 AAGAAGAAGAAGGGGAAAAAAGG - Intronic
956863886 3:73350729-73350751 AACAAGAACTTGGGGACATGGGG - Intergenic
957187637 3:76963052-76963074 AAAATGAAGGTGGGAACAAATGG + Intronic
957474626 3:80707156-80707178 AAAAAGATGGTGGGGACCCAGGG - Intergenic
957660485 3:83145272-83145294 AGCATGAAGGTGAAGACAAATGG - Intergenic
959903910 3:111689699-111689721 AAGAAGAAGGAGGGGAAAGATGG + Intronic
962866422 3:139451408-139451430 TCTAGGAAGGTGGGGACAAAGGG + Intergenic
962904539 3:139789870-139789892 GAAAAGGAGGTGAGGACAAAAGG + Intergenic
964878851 3:161400971-161400993 AAAAAGGAGGTGGGGAAATATGG - Intergenic
965909798 3:173759072-173759094 AGAAAGAAGGTGGTGAGAAAGGG - Intronic
966055311 3:175679935-175679957 AAAAAGAAGGTGAGAAAAAAAGG + Intronic
967587921 3:191237055-191237077 AGCAAGCAGGAGGGGAAAAATGG + Intronic
968887629 4:3343504-3343526 AACAAGTGGGTGGGGGCATAAGG - Intronic
969238589 4:5885343-5885365 AACAAGCAGGTGGGGACCTGGGG + Intronic
969312314 4:6360901-6360923 AATAAGAATGTGAGGACACAAGG - Intronic
972610773 4:40653528-40653550 AAAAAGAAGGGAGGGAGAAAGGG + Intergenic
972821210 4:42703964-42703986 AAGAAGAAAATGGGGCCAAACGG + Intergenic
973546081 4:51983187-51983209 AACAAAAAGGTGGAGAAAAGAGG + Intergenic
973966206 4:56164539-56164561 TGCAAGAAGCTGGGCACAAAAGG + Intergenic
974721071 4:65738386-65738408 AGCAAGAAAGTGGGGAGAAATGG + Intergenic
974767147 4:66361677-66361699 AACAAGGACGAGGTGACAAAAGG + Intergenic
975001880 4:69234555-69234577 AATAAGATTGTGGGGTCAAAAGG + Intergenic
975003563 4:69257536-69257558 AATAAGATTGTGGGGTCAAAAGG - Intergenic
975966005 4:79973116-79973138 AAGAGGAAGGTGGGGAGGAAGGG + Intronic
975971658 4:80046563-80046585 AACAAGAAAGTGGGCAAATAAGG - Intronic
976215273 4:82710251-82710273 ATCGAGAAGGTGGGGCCACATGG - Intronic
976467370 4:85386320-85386342 AGAAAAAAGGTGGGGAGAAATGG + Intergenic
977031017 4:91883199-91883221 AACAAGAAGGAGGAGGGAAAAGG + Intergenic
977195824 4:94057660-94057682 AAAAAGAAGGAGGGGAGGAAAGG - Intergenic
977917215 4:102607579-102607601 CACTGGGAGGTGGGGACAAAAGG + Intronic
978398864 4:108310544-108310566 ACCAAGAAGGTGGGTGCAAAAGG + Intergenic
978501804 4:109417817-109417839 AACAGGAAAGTGGGGAGTAATGG + Intergenic
978903532 4:113980198-113980220 AAAAAAAAGGTAGGGACAAAAGG - Intergenic
978963197 4:114709460-114709482 AACAGGATTGTGGGGTCAAATGG - Intergenic
979869541 4:125801686-125801708 AACAAAATGGTGGCGACAAAGGG + Intergenic
979899996 4:126203571-126203593 AACAAGAAGGTGGAGTGATATGG - Intergenic
980347570 4:131641826-131641848 GACAAGAATGTGGAGAAAAAAGG + Intergenic
980382998 4:132050097-132050119 AAGAAGAAGTTGCTGACAAAGGG - Intergenic
982178919 4:152732038-152732060 AAAAAAAAGGTGGGGAGAGAGGG + Intronic
984996367 4:185434389-185434411 AAAAAGAAAGTAGTGACAAAAGG - Intronic
986194186 5:5522637-5522659 AGCAAGAAGGTTGTGACAATGGG - Intergenic
986509278 5:8486363-8486385 AATAAAAAGGTGGGGGTAAAGGG + Intergenic
986549259 5:8934630-8934652 TACAAGAAGGTGGAGCCACATGG - Intergenic
986637232 5:9835308-9835330 CACATGAATGTGGGGACACAAGG - Intergenic
987299785 5:16587065-16587087 CATAAGAATGCGGGGACAAAAGG + Intronic
989035696 5:37169408-37169430 CAACAGAAGGTGTGGACAAAAGG + Exonic
989408995 5:41095771-41095793 AGCAAGAAAGTGGGGAGATATGG - Intergenic
989568634 5:42925122-42925144 AAGGGGGAGGTGGGGACAAAGGG - Intergenic
989665000 5:43843509-43843531 AACTAGAAGGTGGGCAGAGAAGG + Intergenic
989846960 5:46156817-46156839 AATAGGATGGTGGGGTCAAATGG + Intergenic
990443001 5:55865580-55865602 AACAAGAAGGTGGTGTAAAGGGG - Intronic
990748929 5:58990879-58990901 AACTAGAAGATGTGAACAAATGG - Exonic
993065433 5:83091995-83092017 TGCAAGAAGGTGGAGAAAAAGGG - Intronic
993598355 5:89888290-89888312 AAAAAGCAGGTGGGGCAAAAGGG - Intergenic
993754759 5:91714784-91714806 TAAAAGAACGTGGGGAAAAAGGG - Intergenic
994430753 5:99657572-99657594 AACAATTAGGTGGGGAGAAGTGG + Intergenic
996108762 5:119539594-119539616 AAAAAGAAGAAGTGGACAAAAGG + Intronic
999415219 5:151389174-151389196 CACAGGAAGGTGGAGACAGAGGG - Intergenic
1000289890 5:159860418-159860440 AGCAAGAAGCTGGGGAGTAAAGG + Intergenic
1001382423 5:171313297-171313319 AACAAGAAAGGGAAGACAAAAGG - Intergenic
1001616775 5:173049099-173049121 AACAAGGAAGTGGGGCCAGAGGG + Intergenic
1001667840 5:173448113-173448135 AACCAGAAGCTGTGGACAAGGGG - Intergenic
1002027529 5:176405673-176405695 AACAAGTAGCTGGGTACACAGGG + Intronic
1002508948 5:179699924-179699946 GACAAGAACGGGGGCACAAAGGG - Intronic
1003031874 6:2608302-2608324 AAAAAGAAGTTTGGGTCAAAGGG - Intergenic
1003224781 6:4193377-4193399 AACAAAAAGTTTGGTACAAAAGG - Intergenic
1003808905 6:9757988-9758010 AATAAGAGGGTGGGGAAAAAGGG + Intronic
1004593803 6:17079701-17079723 AACAAGAACATGTGGACACAGGG + Intergenic
1005631283 6:27710656-27710678 AAGAAGTAAGTGGGGAAAAAGGG - Intergenic
1005653346 6:27906089-27906111 TACAAAAAGATAGGGACAAATGG + Intergenic
1005847132 6:29790909-29790931 GACAAGGTGGTGGGGACTAAGGG + Intergenic
1005978497 6:30818059-30818081 TACAAGGAGGTGGGTAGAAAAGG - Intergenic
1006735027 6:36267527-36267549 TCCAAGCAGGTGGGGACAACGGG + Intronic
1006967935 6:38008671-38008693 AGCAATGGGGTGGGGACAAAGGG - Intronic
1009277223 6:61698671-61698693 AAATACAAGGGGGGGACAAATGG - Intronic
1012810499 6:103950616-103950638 AATGAGATTGTGGGGACAAATGG + Intergenic
1013733094 6:113192646-113192668 AACCAGCAGGTAGGGAGAAATGG - Intergenic
1014408118 6:121077373-121077395 AAAAGGAAGGTGGAGACAAGAGG - Intergenic
1014468583 6:121786249-121786271 AAAAGGAAGCTGGGGAAAAAAGG - Intergenic
1015443460 6:133274689-133274711 AACAAGAAGATGGAAACAAAGGG - Intronic
1015447199 6:133320155-133320177 AGCAAGAAGTTGGGAAAAAAAGG - Intronic
1017291242 6:152740717-152740739 TACAAGAAAGTGAGAACAAAAGG + Intergenic
1017541690 6:155409204-155409226 AAAAAGAAGGTGGGGAACAGTGG + Intronic
1020681328 7:11240685-11240707 CACAAGAAACTGGGAACAAAAGG + Intergenic
1021179968 7:17494771-17494793 GACAAGAAGCTGGGTACCAAGGG + Intergenic
1022359790 7:29646924-29646946 TACAAGAAGGTGGGGATCATGGG - Intergenic
1022385460 7:29894725-29894747 AACAAGCAGGTGGGGACAGAGGG - Intronic
1022448589 7:30492695-30492717 AACAAAATGGTGGGGGCAGAGGG - Intergenic
1022897760 7:34769897-34769919 AACAAGACCTTGGGAACAAAGGG - Intronic
1023271479 7:38467906-38467928 AAATAGAAGGTGGGTACAGATGG + Intronic
1023289570 7:38655550-38655572 AACAAGATGCTGGAGACCAAGGG + Intergenic
1023588253 7:41753446-41753468 AAGAAGCAGGAGGGGAAAAAAGG + Intergenic
1023871594 7:44266221-44266243 CACAAGAAGGAGGGGGCACAAGG + Intronic
1024085110 7:45886153-45886175 AACAGGAAAGTGGTGAGAAAAGG + Intergenic
1026040699 7:66865787-66865809 AAAAAGAAGGGAGGGGCAAAAGG - Intergenic
1027464009 7:78491988-78492010 AAGAAGCAGGTGAGGACAAAAGG - Intronic
1027737208 7:81948440-81948462 AATAAAAAGGTGGGGGGAAATGG - Exonic
1028177850 7:87678528-87678550 AAAAAGAAGGTGGTGAAAAAAGG + Intronic
1028987485 7:97019511-97019533 AAGAAGAAGGAAGGGACACAGGG + Intergenic
1029025011 7:97407195-97407217 AAGAAGAAAGAGGGGAAAAAAGG + Intergenic
1032527350 7:132588848-132588870 AACAAGAAAGGAGGGAGAAAGGG + Intronic
1033512952 7:142078605-142078627 GACAAGTAGGTGGGGACATGTGG + Intronic
1033582971 7:142753240-142753262 AAGAAGAAGCTTGGGAGAAAGGG + Intronic
1033586005 7:142774724-142774746 AATAAGAAGCTTGGGAGAAAGGG + Intergenic
1034231042 7:149528797-149528819 AACTAGAGGTTTGGGACAAAGGG - Intergenic
1034777153 7:153838509-153838531 AACAGCAAGGTGAAGACAAAGGG + Intergenic
1037015945 8:13906086-13906108 AATAAGAATGTTGGGTCAAATGG - Intergenic
1037547991 8:19941835-19941857 AACAAGAATATGAGGACAAGAGG + Intronic
1037691265 8:21183374-21183396 AAAAAGAAGGTGGGGAGGAGAGG - Intergenic
1038103754 8:24410310-24410332 AACAACACAGTGGGGCCAAATGG - Intergenic
1038654367 8:29435803-29435825 AAGAAGAAGGAAGGCACAAAAGG + Intergenic
1041973343 8:63768441-63768463 CTCTGGAAGGTGGGGACAAAAGG - Intergenic
1042238726 8:66640909-66640931 ACCAAGAGGGTGGGTGCAAAAGG + Intronic
1042899994 8:73715558-73715580 AACAAGTATGTGGGGAAAATGGG + Intronic
1044269945 8:90230290-90230312 AGCAACAAGCTGGGGATAAATGG - Intergenic
1044411531 8:91889580-91889602 ACCAAGAAGGTTTGGACAGAGGG - Intergenic
1044773244 8:95659984-95660006 AACAAGAAGCTGGGAAAGAAAGG - Intergenic
1045414865 8:101955686-101955708 TACAATAAGGAGGGGAGAAATGG + Intronic
1045523119 8:102920578-102920600 AACCAGAATGAGGGGAAAAAGGG + Intronic
1045552660 8:103186370-103186392 AACAAGTAGGTGGTGATGAAGGG + Intronic
1046438744 8:114230781-114230803 GACATGAAGGTGGATACAAAAGG + Intergenic
1048805004 8:138231922-138231944 AAAAAGAGGGTGGGGAGAAAGGG + Intronic
1049855204 8:144857389-144857411 CCCCAGAAGGTGGGGACACAAGG - Intergenic
1049990709 9:989085-989107 AAGAAGAAGGAGGGAAAAAAAGG - Intronic
1051239000 9:15032135-15032157 TACAAGAAGGTGGAGGCAATTGG - Intergenic
1051521486 9:17993797-17993819 ATCATGAAGCTAGGGACAAAAGG - Intergenic
1051580287 9:18665650-18665672 AAGAAGATGGTGGGAACAAAAGG - Intronic
1052289281 9:26823803-26823825 TACAAGAGGGTGGGTGCAAAAGG - Intergenic
1053004729 9:34596917-34596939 GAGAAGCAGGTGGGGAGAAAGGG + Intergenic
1053653977 9:40197190-40197212 GAAAAGATGGTGGGGAAAAAAGG + Intergenic
1053677494 9:40449462-40449484 AAAAAGAAGAGGAGGACAAAAGG + Intergenic
1053904367 9:42826365-42826387 GAAAAGATGGTGGGGAAAAAAGG + Intergenic
1054290567 9:63284990-63285012 AAAAAGAAGAGGAGGACAAAAGG + Intergenic
1054366096 9:64343406-64343428 GAAAAGATGGTGGGGAAAAAAGG + Intergenic
1054507128 9:65926832-65926854 AAAAAGAAGAGGAGGACAAAAGG - Intergenic
1054530619 9:66179149-66179171 GAAAAGATGGTGGGGAAAAAAGG - Intergenic
1054673723 9:67833136-67833158 GAAAAGATGGTGGGGAAAAAAGG + Intergenic
1054905420 9:70410682-70410704 ATCAAGAAGGTGGGCAGAGATGG - Intronic
1055351807 9:75397063-75397085 AACAAGAAAGTAGAGAAAAATGG - Intergenic
1055694902 9:78873351-78873373 AACAAGGAGGCCGGGACAAGAGG - Intergenic
1055839225 9:80482622-80482644 AACAGGAAGGAGGTAACAAATGG - Intergenic
1056225349 9:84489742-84489764 AAAAAGTAGGTGGAGGCAAAGGG + Intergenic
1057150455 9:92791835-92791857 AACAAGAAGATGGAGACCACAGG + Intergenic
1058318485 9:103599325-103599347 ACCAAGAGGGTGGGTCCAAAAGG + Intergenic
1058321455 9:103636489-103636511 ACCAAGAAGGCGGGTGCAAAAGG + Intergenic
1058473497 9:105305657-105305679 AATAAAAAGGTAGGGAAAAAAGG - Intronic
1059405013 9:114094064-114094086 AGGAAGCAGGTGGGGACATAAGG + Intronic
1059884520 9:118730758-118730780 TACAAGAAGGTGGGAAAATAAGG - Intergenic
1060341794 9:122783693-122783715 AAGGAGAGGGTGGGAACAAAGGG + Intergenic
1060611045 9:124964802-124964824 AACAAGAAGGTCTGGACAACAGG - Intronic
1062330039 9:136036621-136036643 AACAGGAATGAGGGGAGAAATGG + Intronic
1203638852 Un_KI270750v1:139140-139162 AGCAAGAAGGGAGGGACAGAGGG - Intergenic
1185479986 X:438780-438802 GCCAGGAAGCTGGGGACAAACGG + Intergenic
1186133655 X:6496211-6496233 ATGGAGAAGGTGGGGAGAAAGGG - Intergenic
1186554416 X:10542508-10542530 AACAAAAAGGTGAAGAAAAAAGG + Intronic
1188187628 X:27134493-27134515 AACTAGTAGATGGTGACAAAAGG + Intergenic
1188468531 X:30510629-30510651 AACTTGAAGGTGAGGACAAAGGG - Intergenic
1188928482 X:36075717-36075739 AACAAAAAGATGGCCACAAAAGG - Intronic
1192462213 X:71326405-71326427 AACAAGAAGATGGTCAAAAAAGG - Intergenic
1192606774 X:72526858-72526880 AATAAGAAGGAGGGGCCAAAGGG - Intronic
1193704043 X:84798805-84798827 TATAAAAAGGAGGGGACAAAGGG - Intergenic
1193920799 X:87423718-87423740 AAAAAGGAAGTGGGGAGAAAAGG - Intergenic
1195246425 X:102999527-102999549 GACAAGAAGTTGGGGGCAGAGGG - Intergenic
1195577679 X:106468740-106468762 AACACGAAGGTGGGGCGAAGTGG + Intergenic
1196135217 X:112201332-112201354 AACAAGAAGGAGGTGTGAAAAGG - Intergenic
1196158533 X:112457015-112457037 AACAAGAAGCAGGGAACAGAGGG - Exonic
1196935220 X:120723756-120723778 AAAAAGGGGGGGGGGACAAAAGG - Intergenic
1197077508 X:122370439-122370461 AAAAAGGAGGTGGGGAAAAGTGG + Intergenic
1197268031 X:124396831-124396853 AAAGAGAAGGGGGGGAAAAAAGG + Intronic
1197888025 X:131238373-131238395 TACAAGAAGGTGGGGGTGAAGGG + Intergenic
1199405343 X:147451935-147451957 AACTATAAAGTGGGTACAAAAGG + Intergenic
1201535168 Y:15039206-15039228 AACATGAAGGTAGGAACAACTGG - Intergenic