ID: 946140668

View in Genome Browser
Species Human (GRCh38)
Location 2:217688043-217688065
Sequence CTGGCTGCATATTTGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946140668_946140672 5 Left 946140668 2:217688043-217688065 CCAGGCTGCAAATATGCAGCCAG 0: 1
1: 1
2: 2
3: 12
4: 133
Right 946140672 2:217688071-217688093 CCCCTAATACACACCAATTCTGG 0: 1
1: 0
2: 0
3: 3
4: 67
946140668_946140676 18 Left 946140668 2:217688043-217688065 CCAGGCTGCAAATATGCAGCCAG 0: 1
1: 1
2: 2
3: 12
4: 133
Right 946140676 2:217688084-217688106 CCAATTCTGGTGACCAACATTGG 0: 1
1: 0
2: 0
3: 6
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946140668 Original CRISPR CTGGCTGCATATTTGCAGCC TGG (reversed) Intronic
904236848 1:29122136-29122158 CAGGCGGCAGATTTGCAGCCCGG - Intronic
905574936 1:39036498-39036520 CTGGCAGGATCATTGCAGCCCGG - Intergenic
905611236 1:39353639-39353661 CTGTCTGCCTATTTGCAACTTGG + Intronic
905703449 1:40036755-40036777 CTGCCTGCATCTGTGCAACCTGG - Intergenic
906477707 1:46181018-46181040 CTGGCTGAATATCTGAAGCCAGG + Intronic
908456840 1:64312487-64312509 CTGGCTGGATATCTGCCCCCAGG - Intergenic
909173965 1:72331424-72331446 CTGGCTTCATATTTGTAACATGG - Intergenic
912259460 1:108095870-108095892 ATGACTGCAAAGTTGCAGCCAGG - Intergenic
916958618 1:169866274-169866296 GTGGCTTCATATTTACTGCCTGG + Intronic
921845475 1:219875155-219875177 CTGGCTAATTATTTGTAGCCAGG + Intronic
923082660 1:230673357-230673379 CTGGCTTCAGATTTCCAGCTTGG + Intronic
924613358 1:245591825-245591847 CTGTCTCCATCCTTGCAGCCTGG + Intronic
1063449247 10:6140484-6140506 CTGGCTGCATGTTTGCATTTTGG - Intergenic
1066598119 10:37075438-37075460 CTGGCTGCATAACTTCAGACAGG - Intergenic
1067233567 10:44428072-44428094 CTAGCTGAATCTTTACAGCCTGG + Intergenic
1067565839 10:47336147-47336169 CTGGCTGCATGGTCACAGCCAGG + Intergenic
1074129800 10:110563907-110563929 CTATCTGCATCTTTGCTGCCTGG + Intergenic
1074686319 10:115965361-115965383 CCGGCTGCATTTTGGCAGACAGG - Intergenic
1078437359 11:11336562-11336584 CCAGCTCCATATTTGCAGCTGGG + Intronic
1078815973 11:14822966-14822988 CTGGCTGCATTTTTGTAGGGTGG - Intronic
1080819710 11:35793695-35793717 CTGGCTGCATTTATTCAGCTGGG - Intronic
1080890930 11:36408633-36408655 GTGGCTGCATTTTGGCAGCGAGG + Intronic
1083809032 11:65092488-65092510 CTGCTTGCATCTTTGCAGTCCGG + Intronic
1084781202 11:71409643-71409665 CTGACTGCGTATCTGCAGCCAGG + Intergenic
1086268358 11:85028798-85028820 GTGGCTGCACAGTTGCACCCAGG + Intronic
1089360440 11:117882562-117882584 ATGGGTGCATATTTGCAGAGAGG - Intergenic
1090554988 11:127864500-127864522 CTGGCTACATATTTCTAACCAGG + Intergenic
1091677505 12:2501889-2501911 CTGGGAGAATCTTTGCAGCCAGG + Intronic
1094003016 12:25716578-25716600 GTGACTGCATATTTTAAGCCTGG + Intergenic
1094191767 12:27705591-27705613 ATGGCAGCATGTTAGCAGCCCGG + Intergenic
1096797554 12:54087405-54087427 CTGGCTACACATTAGCAACCTGG - Intergenic
1096812081 12:54177201-54177223 TTGGCTGCATATTGGTAGCATGG + Intronic
1097233692 12:57526419-57526441 TTGGCTGCCTCTTTCCAGCCAGG - Intronic
1097677285 12:62616365-62616387 CTACTTGCATATTTGGAGCCTGG - Intergenic
1099306788 12:80966829-80966851 CTTGCTGCACATTTGCTACCTGG + Intronic
1099333251 12:81319110-81319132 CTGGCTCCATAATTTCTGCCAGG - Intronic
1099857826 12:88190459-88190481 CTGGCTGCATATTTTTTACCAGG - Exonic
1101423522 12:104568517-104568539 CTGGCTGCCTAGTTGCTTCCTGG + Intronic
1103175809 12:118862235-118862257 CTGGCTCCATATCTGCAGATAGG - Intergenic
1103446065 12:120996134-120996156 CTGGCTGCATAAAGGCAGACAGG + Intronic
1104498376 12:129262074-129262096 CTGGATGCAAATTTTCAGCCAGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106477139 13:30108512-30108534 CTGGGTCCATTTTTGCAGCTGGG + Intergenic
1109106404 13:58256544-58256566 ATGGCTCCAGATTTGCAGCATGG - Intergenic
1109185514 13:59263151-59263173 CTGGTTGCATATTTCCAGAGAGG + Intergenic
1114534563 14:23414693-23414715 CTGGCTACATATTTGCTTTCTGG + Intronic
1114781033 14:25538371-25538393 CTGGCTGCATAGTTACATCTGGG + Intergenic
1115645695 14:35367253-35367275 CCGGCTCCACATTTGCAGACAGG - Intergenic
1115645697 14:35367254-35367276 CTGTCTGCAAATGTGGAGCCGGG + Intergenic
1122293417 14:100691912-100691934 GTGGCAGCGTATTTGCAGCCGGG - Intergenic
1127705360 15:61541624-61541646 CTGGTTCCCTATTTCCAGCCTGG + Intergenic
1128395876 15:67225044-67225066 ATGGCTGTATATTTGAATCCCGG + Intronic
1128793970 15:70451473-70451495 CTGGCTGTGTCTTTGCAGCGTGG - Intergenic
1132288853 15:100685493-100685515 CTGGGTGCAGATTTGCACCATGG + Intergenic
1143016953 17:3896000-3896022 TTGGCTGCATATTTCCACCGAGG + Intergenic
1148717024 17:49723186-49723208 CTTCCTGCTTATTTGCAGCGGGG - Intronic
1149664722 17:58357747-58357769 CTGGGTGCACAGTTGCATCCTGG + Exonic
1151177651 17:72301911-72301933 CTTGCTGAATATTTACAGCTAGG - Intergenic
1151853927 17:76708714-76708736 CTGGCTTAATGTTTGCAGGCAGG + Intronic
1155495954 18:26441972-26441994 CTGGCTGCATGCTTGAATCCTGG - Intergenic
1158636732 18:59165555-59165577 CTGGCTTCTTATTTGCTCCCTGG + Intergenic
1159428954 18:68326031-68326053 CTGGCCGTATTTTTGCAGCATGG + Intergenic
1161570926 19:5030568-5030590 CTGGCTGCCTCTCTGCAGGCCGG - Intronic
1163693626 19:18751111-18751133 CTGGCTGCCTCCTCGCAGCCTGG + Intronic
925543391 2:4990860-4990882 CTGGGTGCATATAAGCACCCAGG - Intergenic
926761096 2:16279875-16279897 CTGACTGCATAATAGGAGCCAGG + Intergenic
930741396 2:54836130-54836152 CTGGAGACAGATTTGCAGCCAGG + Intronic
933992200 2:87641788-87641810 GTGGCTGCATTTTTGCAGCATGG - Intergenic
936301649 2:111309049-111309071 GTGGCTGCATTTTTGCAGCATGG + Intergenic
943643043 2:190379924-190379946 CTGGCCTCATATTCACAGCCCGG + Intergenic
945542431 2:211105393-211105415 GTGGGTGAATATCTGCAGCCTGG - Intergenic
946140668 2:217688043-217688065 CTGGCTGCATATTTGCAGCCTGG - Intronic
946140762 2:217688661-217688683 CTGGCTGGATATTTGCAGCCTGG + Intronic
947461161 2:230306069-230306091 CTGTCTGCCTCCTTGCAGCCTGG - Intronic
947997443 2:234540300-234540322 CTGGCTGTATGATTGCAGACTGG - Intergenic
1170613819 20:17933892-17933914 CTGTGTGCATAGCTGCAGCCAGG + Intergenic
1173089545 20:39957189-39957211 CAGGAAGCATATTTGTAGCCAGG - Intergenic
1173098121 20:40057513-40057535 CTGGCTGTATCTTTGCATGCTGG - Intergenic
1174734846 20:52956214-52956236 CTGGCTGTATATTTGAATTCCGG + Intergenic
1181933582 22:26423345-26423367 CTGCCCTCATATTTGCAGCTTGG - Intergenic
955525247 3:59813318-59813340 CCGGCTGCATATTTACACCTTGG + Intronic
955547457 3:60046388-60046410 CTGGCTGCATCTGTGCTGGCTGG + Intronic
956274601 3:67484374-67484396 CTAGCTGAATATTCTCAGCCAGG - Intronic
959881338 3:111447895-111447917 ATGGCTGAATAGATGCAGCCAGG + Intronic
962122523 3:132577285-132577307 CTGGCTGGATCTATGGAGCCTGG - Intronic
967078152 3:186023945-186023967 CAGAATGCATCTTTGCAGCCTGG - Intergenic
967982320 3:195073066-195073088 CTGCCTGCATTTTTGCAGAAAGG + Intronic
968134408 3:196210850-196210872 CTGCCTGGGTATTTGGAGCCTGG - Intronic
969576432 4:8038708-8038730 CTGGCTGCCCCTTTGGAGCCTGG + Intronic
972971179 4:44577823-44577845 TTGTCTGAATATTTGCAGACAGG + Intergenic
976318623 4:83686293-83686315 CTGGCTGCTCACTTCCAGCCTGG - Intergenic
979649682 4:123115087-123115109 CTGTCTGCCTCCTTGCAGCCTGG + Intronic
981042662 4:140237761-140237783 CTGGCTGCACATTGGCTGCTGGG - Intergenic
981743673 4:148030756-148030778 TGGGTTGCATCTTTGCAGCCTGG + Intronic
983769298 4:171528725-171528747 CTGGCTTCCTATTTGCAGATTGG - Intergenic
985758879 5:1734620-1734642 CTGGCTGCAGGTTTGCAGATGGG - Intergenic
986318615 5:6609365-6609387 CGGGCTGCATCTTTCTAGCCAGG + Intronic
986550088 5:8943633-8943655 ATGGCTGCATATTTTTAGCTTGG + Intergenic
990370060 5:55108845-55108867 CTGGCTGGAAATATTCAGCCAGG - Intronic
994842127 5:104938146-104938168 GTAGCTGCAAATTTGCAGCACGG - Intergenic
995030232 5:107472504-107472526 ATGGTTGCTAATTTGCAGCCAGG - Intronic
995871867 5:116751866-116751888 CTTGCTGCATAGTTGCATGCAGG - Intergenic
996877286 5:128253468-128253490 CTGGTTGCCTAGTTGCAGTCTGG - Intergenic
997131516 5:131281796-131281818 TTTGCTGCATATTTGCTGCGTGG + Intronic
1006843521 6:37047410-37047432 CAGGCTGCAGGTTTGCACCCTGG + Intergenic
1009545711 6:65017575-65017597 CTGGCTGCATAATCGGACCCTGG + Intronic
1010294253 6:74177644-74177666 CTGGCTGCATATATGGAGCTGGG - Intergenic
1016933169 6:149428794-149428816 CTGTCTGCAGCTTGGCAGCCAGG + Intergenic
1018643667 6:165928641-165928663 CTGTCTTCATATTTGAAACCTGG + Intronic
1019551305 7:1603945-1603967 CGGGCTGCATTTTTGCAATCTGG - Intergenic
1021899740 7:25272920-25272942 CTGGATGGATATGTGCAGACTGG + Intergenic
1028456331 7:91041882-91041904 CTGGGTGCATATCTGGTGCCGGG + Intronic
1030140248 7:106296883-106296905 CTGGCTACAAACATGCAGCCAGG - Intergenic
1030140249 7:106296884-106296906 CTGGCTGCATGTTTGTAGCCAGG + Intergenic
1034440038 7:151081696-151081718 CAGGCTGCCGATTTCCAGCCCGG + Exonic
1036499074 8:9296795-9296817 CTGTCTGCATAACTGCATCCAGG + Intergenic
1036614263 8:10376281-10376303 CTGGCTGCATTGTAGAAGCCAGG - Intronic
1040634545 8:49256726-49256748 CTGATTGCATATTTGGAGACAGG - Intergenic
1041040554 8:53842637-53842659 TTGGCTGCAGAGTTCCAGCCTGG - Intronic
1045231167 8:100309359-100309381 CTCGCTGCAAATTTGGAGCCGGG - Intronic
1045231169 8:100309360-100309382 CCGGCTCCAAATTTGCAGCGAGG + Intronic
1045781710 8:105872618-105872640 ATTGATGCATATTTTCAGCCTGG + Intergenic
1048088015 8:131205195-131205217 CTGGGTTCCTATTTGCAGCCTGG - Intergenic
1049338868 8:142101236-142101258 CTGGGTGCACACTTGGAGCCAGG + Intergenic
1049662719 8:143827385-143827407 CCGGCTGCCTCTTTGCAGCAAGG - Intronic
1052388878 9:27855302-27855324 CTGGCAGCATAGTAGCAGTCAGG + Intergenic
1053787184 9:41660553-41660575 CTGGCTACACATTAGCAACCTGG - Intergenic
1054157945 9:61654215-61654237 CTGGCTACACATTAGCAACCTGG + Intergenic
1054175462 9:61871892-61871914 CTGGCTACACATTAGCAACCTGG - Intergenic
1054477718 9:65585220-65585242 CTGGCTACACATTAGCAACCTGG + Intergenic
1054662075 9:67708918-67708940 CTGGCTACACATTAGCAACCTGG + Intergenic
1057263836 9:93601239-93601261 CTGTCTGCACATATACAGCCAGG + Intronic
1059935962 9:119310937-119310959 CTGGGTGCATATTTGCATATGGG + Intronic
1060116474 9:120945253-120945275 CTGCCTTCCTATATGCAGCCTGG - Intergenic
1060485304 9:124042527-124042549 CTGGCTGCATTTTAGGATCCTGG + Intergenic
1061036091 9:128115097-128115119 CTGGCTGCCTCCTCGCAGCCAGG + Intergenic
1061541848 9:131281674-131281696 CTGGCTGCAAATCTGGAGGCTGG + Intergenic
1203759605 EBV:5269-5291 CTGGCTGAACATTAGCATCCCGG + Intergenic
1203769986 EBV:44975-44997 CGGGGTGCACATCTGCAGCCAGG + Intergenic
1186673448 X:11791275-11791297 CTGGGAGCTTATCTGCAGCCAGG + Intergenic
1186788615 X:12975551-12975573 CGGGCTGCATCTGTGCAGCCTGG + Exonic
1189561282 X:42193829-42193851 CCAGCTGCATATTTGCAGCCAGG + Intergenic
1192227048 X:69236708-69236730 CTGGCTGTGATTTTGCAGCCTGG + Intergenic
1198156947 X:133970250-133970272 CTGGCTTTATATGTGGAGCCCGG - Intronic
1201411536 Y:13703646-13703668 CGGGCTGCATCTGTGCAGCCTGG + Exonic
1201646445 Y:16237955-16237977 CTTGCTGCATATGTCTAGCCAGG - Intergenic
1201656368 Y:16347362-16347384 CTTGCTGCATATGTCTAGCCAGG + Intergenic
1201861121 Y:18598265-18598287 CTGACTGTATACTTGCAGGCTGG - Intergenic
1201872202 Y:18722115-18722137 CTGACTGTATACTTGCAGGCTGG + Intergenic