ID: 946142098

View in Genome Browser
Species Human (GRCh38)
Location 2:217700188-217700210
Sequence CTTGTTCTGTATCTTGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946142098_946142101 15 Left 946142098 2:217700188-217700210 CCTGGCACAAGATACAGAACAAG 0: 1
1: 0
2: 0
3: 23
4: 213
Right 946142101 2:217700226-217700248 AGAGCCTGGGACCCAGCCACTGG 0: 1
1: 0
2: 1
3: 47
4: 420
946142098_946142099 1 Left 946142098 2:217700188-217700210 CCTGGCACAAGATACAGAACAAG 0: 1
1: 0
2: 0
3: 23
4: 213
Right 946142099 2:217700212-217700234 GCAAGTTCATAGACAGAGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 182
946142098_946142102 16 Left 946142098 2:217700188-217700210 CCTGGCACAAGATACAGAACAAG 0: 1
1: 0
2: 0
3: 23
4: 213
Right 946142102 2:217700227-217700249 GAGCCTGGGACCCAGCCACTGGG 0: 1
1: 0
2: 5
3: 42
4: 427
946142098_946142100 2 Left 946142098 2:217700188-217700210 CCTGGCACAAGATACAGAACAAG 0: 1
1: 0
2: 0
3: 23
4: 213
Right 946142100 2:217700213-217700235 CAAGTTCATAGACAGAGCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946142098 Original CRISPR CTTGTTCTGTATCTTGTGCC AGG (reversed) Intronic
900001667 1:17945-17967 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
900021388 1:188469-188491 CTTGCTCTGGATCCTGTGCGGGG + Intergenic
901201111 1:7467923-7467945 CTTCTTCTGTCTCTGGTGCTCGG + Intronic
903363616 1:22792712-22792734 CTTGTTGAGTGTCATGTGCCAGG + Intronic
904217941 1:28939086-28939108 CTTGCTCTGTATGTTGTTACAGG + Intronic
910969379 1:92839869-92839891 CTTGTTCTGTTTCCTGGGCTGGG + Intronic
911115630 1:94243968-94243990 CATTTTCTGTTTCTTGTGTCAGG - Intronic
912209957 1:107546484-107546506 TTTGTTCTGTATCTTATTCTTGG - Intergenic
912750761 1:112285445-112285467 CATGTTCTGTATCTTGAAGCTGG + Intergenic
912874120 1:113339296-113339318 CTTGTCATCTATCATGTGCCAGG - Intergenic
915195665 1:154187735-154187757 CTTGTTCTTTTTCTTGCTCCTGG + Intronic
915717072 1:157954756-157954778 TTTGTTCTGGACCTTCTGCCTGG + Intergenic
916187951 1:162151383-162151405 CATGTTCTGTAGCATGTACCTGG + Intronic
919587319 1:199454997-199455019 CTTGTTCTGTCTCTTGTAGCAGG + Intergenic
920938502 1:210458338-210458360 CTTGTTTTGTGTTATGTGCCAGG + Intronic
924319776 1:242837641-242837663 CTTGTTCTGGCTTTTGTTCCTGG - Intergenic
1063653968 10:7968468-7968490 CTTGTCCTGGATCTTATTCCAGG - Intronic
1063980669 10:11449185-11449207 CTTTTTCTGTGTCTGCTGCCTGG - Intergenic
1064928017 10:20591583-20591605 CCTGTTCTGTATGTTGTGGGTGG + Intergenic
1066369635 10:34809556-34809578 CATTTTCTGTTTCTTCTGCCTGG - Intronic
1067187462 10:44043088-44043110 CTGATTCTGTCTCCTGTGCCTGG + Intergenic
1067203746 10:44196373-44196395 ATTGATGTCTATCTTGTGCCAGG - Intergenic
1068890010 10:62139056-62139078 TTTGTTTTGTTTCTTGTGACAGG + Intergenic
1070809869 10:79292313-79292335 CTTGTTCTGTGTCTCCTGCAGGG - Exonic
1071153387 10:82662589-82662611 CTTGCTCTGTAGCTTCAGCCTGG - Intronic
1071458801 10:85872143-85872165 CTTATTCTGTATCCTGTGTTCGG - Intronic
1073720013 10:106157755-106157777 CTACTTCTGTATCTTAAGCCCGG + Intergenic
1074566634 10:114585344-114585366 CTGGGGCTGTCTCTTGTGCCTGG - Intronic
1074690572 10:116000622-116000644 CTTGTTCAGTGTCTTCTTCCAGG + Intergenic
1074986571 10:118664820-118664842 TTTCTTCAGTATTTTGTGCCAGG - Intergenic
1075435789 10:122440429-122440451 TTTGTGCTGTTTCTTCTGCCTGG + Exonic
1079104328 11:17560814-17560836 CTTGGTCTGTGTCTGCTGCCGGG + Exonic
1081950849 11:47041166-47041188 CTTGGCCTGGATCTTGTGTCAGG + Intronic
1084287032 11:68138684-68138706 AATGTTCTGTATCTTGAGCTAGG + Intergenic
1085128216 11:74016511-74016533 CTTGTTCTGATTCCTGGGCCTGG - Intronic
1085450485 11:76629297-76629319 CTGGCTCTGTGTCCTGTGCCAGG + Intergenic
1085779783 11:79397601-79397623 CTTATTCTGTATCTGGTTGCTGG - Intronic
1086090615 11:83001109-83001131 CTTATTCTGTAGCTTGCTCCAGG - Intronic
1086320029 11:85636327-85636349 TTTGTTCTGTGCCTTTTGCCTGG + Exonic
1087251023 11:95900326-95900348 CTTGTTTTATATCTTGTCCCTGG - Intronic
1087958448 11:104319101-104319123 CTTGCACTGTATCTTTTGTCTGG - Intergenic
1088563571 11:111142775-111142797 GTTGTTCTGTAAATTGTACCAGG - Intergenic
1090092011 11:123706376-123706398 AATGTTCTGTATCTTGTTCTAGG - Intergenic
1091374753 12:18067-18089 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1091854815 12:3731112-3731134 GTTGTTCAGTATCTGGTGTCTGG + Intronic
1097045415 12:56184189-56184211 CATGTTGTGTATCCTGTCCCGGG - Exonic
1098296851 12:69012575-69012597 TTTGTTCAGAATCTTCTGCCTGG - Intergenic
1099955654 12:89351098-89351120 CTTGTGGTGTTTCTTGCGCCGGG - Intronic
1101368619 12:104102022-104102044 CTGAATCTGTATCCTGTGCCTGG - Exonic
1105475912 13:20728154-20728176 CTTGTTCTTTATCTTGTCTGTGG - Intergenic
1106860776 13:33905236-33905258 ATTGTTCTGTATCTTAAGCAAGG + Intronic
1109462920 13:62687194-62687216 CTTGTTCCTTAGCTTGTGGCTGG + Intergenic
1111866307 13:93772977-93772999 CTTGTTCTCTACCATGTTCCCGG + Intronic
1112100645 13:96184910-96184932 CATGTTCACTACCTTGTGCCAGG - Intronic
1114075889 14:19160965-19160987 CTTGGTGTGTACCTTGTCCCCGG - Intergenic
1114086275 14:19238607-19238629 CTTGGTGTGTACCTTGTCCCCGG + Intergenic
1114882554 14:26804882-26804904 CTTACTCTGTTTCTTGTGTCTGG + Intergenic
1115486668 14:33917176-33917198 CTGGTATGGTATCTTGTGCCAGG - Intergenic
1115923480 14:38404931-38404953 CATGATCTGTATTTTGTGGCTGG - Intergenic
1117061127 14:51964934-51964956 CTTGATTTGTTTCTTGTCCCAGG - Intronic
1117116601 14:52520189-52520211 CCTGTTCTGTATTCTGTCCCTGG - Intronic
1121638895 14:95472296-95472318 CTTGTCCTGTATCTGGGTCCTGG - Intronic
1122761687 14:104033419-104033441 CTGTTTCTGTATCTCCTGCCAGG - Intronic
1123018938 14:105388597-105388619 CATGTTCTGCACCTGGTGCCGGG + Intronic
1123077212 14:105673331-105673353 TTTGTTCTCTATCTTGAGCGGGG + Intergenic
1123685728 15:22795759-22795781 CCTCTTCTGTATCTTGCCCCTGG - Intronic
1124060377 15:26288510-26288532 TTTGTTCTGTTTCTTCAGCCTGG + Intergenic
1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG + Intronic
1129757394 15:78106665-78106687 CATGTGCTGTTTCTTCTGCCTGG + Intronic
1130506161 15:84544334-84544356 CTTGTTTTTTATCTTGTGAAGGG + Intergenic
1130872791 15:87984411-87984433 TTTGTTCTGTATCTTTTCCTTGG + Intronic
1131064525 15:89425554-89425576 CCTGTTGTGCATCTTGTCCCCGG + Intergenic
1131864140 15:96689077-96689099 CTTGTGCTGTTTCTTCTGCCTGG + Intergenic
1132451842 15:101972995-101973017 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1132455050 16:17634-17656 CTTGCTCTGGATCCTGTGGCGGG + Exonic
1134215023 16:12310685-12310707 CATGTTCTGTGTCTTGTGATGGG + Intronic
1134313002 16:13093183-13093205 CTTGTTCTGAGTCTTGGCCCAGG + Intronic
1134802647 16:17099712-17099734 CATGTTCTGTATTTGGTGCTGGG + Intergenic
1135291483 16:21242886-21242908 CTTTTTGTGTGTATTGTGCCAGG + Intronic
1136655811 16:31708533-31708555 CAGGTTCTGTCGCTTGTGCCAGG + Intergenic
1137315094 16:47310304-47310326 GTTGTTTTGTATCATGAGCCTGG + Intronic
1140105043 16:71952236-71952258 CTTGCTCTGTCTCTGTTGCCAGG + Intronic
1140342711 16:74180843-74180865 CTTGTTATGTAAACTGTGCCAGG + Intergenic
1140546468 16:75814767-75814789 CGTATTCTGTTTCATGTGCCAGG + Intergenic
1141571114 16:84934157-84934179 CTTGTTCTGTTTCCTTTGCCCGG + Intergenic
1144665937 17:17102328-17102350 CTTGTACTCTATGTTGTGCCAGG + Intronic
1144808493 17:17983510-17983532 CTTGTGCTGTTTCTGGGGCCAGG - Intronic
1146085613 17:29825828-29825850 CTTGTTTCGTATCATGTGGCAGG - Intronic
1146262525 17:31431409-31431431 CTTGTTCTATTTCTTGTTCCAGG - Intronic
1146523746 17:33547976-33547998 CTGAACCTGTATCTTGTGCCTGG - Intronic
1146595049 17:34161421-34161443 CTAGTTCTGTAGGTTTTGCCTGG - Intronic
1146930621 17:36775000-36775022 CTTGTGCTGTGTCTTCTGCCTGG - Intergenic
1146957560 17:36945243-36945265 CTTAATATGTATCTTGTGCCAGG - Intergenic
1151688200 17:75662277-75662299 CTTGTTCTGGATCCTGTGGAAGG - Intronic
1152308133 17:79533023-79533045 CTTGTCCTGTCTCAAGTGCCAGG + Intergenic
1153228695 18:2916780-2916802 CTTGCTTTGTACCTTCTGCCAGG - Intergenic
1153480949 18:5545326-5545348 CGTGTTCTGTATCTTGTCTTTGG - Intronic
1153759483 18:8316920-8316942 CTTGTTGTGGAATTTGTGCCTGG + Intronic
1154156847 18:11950600-11950622 CCTGGTCTCTATCTTATGCCTGG + Intergenic
1159342209 18:67149670-67149692 CTAGTTCTGTCTTTTGTTCCAGG - Intergenic
1160052575 18:75449398-75449420 CTTGTTCTGTAAGGTGTTCCAGG - Intergenic
1162736015 19:12747558-12747580 CTTGGCCTGGATCTTGTGACGGG - Exonic
1163135737 19:15309879-15309901 AGTGTTCTGTGACTTGTGCCTGG - Intronic
1163427784 19:17248463-17248485 CTTGTTCTGTTTCTGGGGTCAGG + Intronic
1165393239 19:35550181-35550203 ACTGTGCTGTATCTGGTGCCAGG - Exonic
1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG + Intergenic
1166354319 19:42217896-42217918 CTTGGGCTGTATCTGGTACCCGG + Intronic
1166955758 19:46463791-46463813 ATTGTTCTGTAACTTGTCGCAGG + Intergenic
1167286377 19:48600946-48600968 CTTGTTCTGCAACTTGGGCCGGG - Exonic
1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG + Exonic
925303758 2:2835101-2835123 CTTCTTCTGGATGTTCTGCCTGG - Intergenic
931071585 2:58657557-58657579 GTAGTCCTGTATCATGTGCCAGG - Intergenic
931789537 2:65652336-65652358 CATGTGCTGTATCCTCTGCCTGG + Intergenic
932302711 2:70678438-70678460 CTGGTTCTGGGTCATGTGCCTGG + Intronic
932439899 2:71727781-71727803 CTTGTCCTGTCTCTTGCTCCTGG - Intergenic
936568056 2:113595463-113595485 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
938218449 2:129544019-129544041 CTTGTTTTATATCTTCTGTCTGG + Intergenic
938691260 2:133791672-133791694 CTTGTTCTTTATATTTTGTCAGG - Intergenic
938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG + Intronic
939368106 2:141261451-141261473 CCTGTTCTGTATCTTATGAATGG - Intronic
940053117 2:149484979-149485001 CTTGTTCTGTTTCTTGTCTTGGG + Intergenic
942677901 2:178448156-178448178 CTTGTTATGTATCTTCTGGACGG + Intronic
944136929 2:196409919-196409941 CTTTTTATGATTCTTGTGCCAGG - Intronic
944561274 2:200940911-200940933 CATGTTCTGTTTCTTTTGCAGGG - Intronic
944950429 2:204742475-204742497 CTTGGCCTGTAACTTGTGCTGGG + Intronic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
1169434507 20:5573711-5573733 CTTGTTCTGTCACCTGGGCCTGG - Intronic
1169547743 20:6667995-6668017 CTTGTTCTTTAGCTTCTACCTGG + Intergenic
1170582611 20:17710568-17710590 CTTATTCTGTTTCTAGTCCCGGG + Intronic
1171243413 20:23589234-23589256 CTAGCTCTGTGTCTTGTGTCTGG + Intergenic
1172102896 20:32496208-32496230 CATGTGCTGTCTCCTGTGCCTGG + Intronic
1174013416 20:47469098-47469120 CTTGTTCTGTCTCCTATGTCTGG + Intergenic
1174233164 20:49064194-49064216 CTTTTTCTCTATCATGAGCCAGG - Intronic
1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG + Exonic
1174962006 20:55168490-55168512 GTTGTTCTGTATCTTGAGCTGGG - Intergenic
1180239688 21:46493208-46493230 CTGGTTTTGTTTCTTGTGCTTGG + Intronic
1180291589 22:10854129-10854151 CTTGGTGTGTACCTTGTCCCCGG - Intergenic
1180494394 22:15883551-15883573 CTTGGTGTGTACCTTGTCCCCGG - Intergenic
1181863290 22:25835824-25835846 CTTGTCCTGCATCGTGTTCCTGG - Intronic
1183251420 22:36733005-36733027 CTTGCTCTGTATCCTGAGCCTGG + Intergenic
1184012935 22:41762967-41762989 ATTGTTCTGTGCCTTGTGCAAGG - Intronic
1184658558 22:45954665-45954687 CCTGCACTGTATTTTGTGCCAGG + Intronic
949216279 3:1572267-1572289 TTTTTTATGTATCTTGTGCTTGG - Intergenic
949532846 3:4974590-4974612 AGTGTTCTGTATCTTGTGTGGGG + Intergenic
951371977 3:21860586-21860608 CTTGATCTGTTTCCTGTCCCAGG - Intronic
952198237 3:31098360-31098382 GTTGTGCTGGATCATGTGCCAGG - Intergenic
955118189 3:56026889-56026911 CTTGTTCTGTATCTTGACTTTGG - Intronic
955294857 3:57725528-57725550 CTTCATCTGTATCTTGTATCAGG - Intergenic
955474726 3:59324860-59324882 CATGTTCTGTATCTTGTTTCGGG + Intergenic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
957069502 3:75555162-75555184 CTTGTTCTCTATCTTGAGAGGGG + Intergenic
957212723 3:77280993-77281015 CATATTCTGTTCCTTGTGCCTGG - Intronic
957651768 3:83015684-83015706 CTGTCTCTGTATTTTGTGCCAGG + Intergenic
959261601 3:104089152-104089174 ATTGTTCTGTATCCTGCACCAGG + Intergenic
959714262 3:109415602-109415624 ATTGTGCAGTATCTTCTGCCTGG + Intergenic
963240130 3:142994869-142994891 CTGTTTCTGTATTTTGTCCCTGG - Intronic
963812532 3:149792953-149792975 ATTGTTCTGTACCCTGTGGCAGG - Intronic
967286728 3:187878621-187878643 CTTGTGCTCTGTCCTGTGCCTGG + Intergenic
967514641 3:190352282-190352304 CTTTTTCTAGATATTGTGCCTGG + Intronic
967741739 3:193010509-193010531 CATGTTCTCAATCTGGTGCCTGG - Intergenic
975912237 4:79280624-79280646 CAGTTTCTGTTTCTTGTGCCTGG + Intronic
976070842 4:81237700-81237722 CATTTTCTGTTTCTTCTGCCTGG + Intergenic
978107927 4:104927207-104927229 TATGTTCTTTATCTTGTGACTGG - Intergenic
981681178 4:147400115-147400137 AATGTTCTGTATCTTGAGCTGGG - Intergenic
981724906 4:147837069-147837091 CTTGTTCTTTCTCTTATGTCAGG + Intronic
984670973 4:182486928-182486950 TTTGTTCCGTTTCTTTTGCCAGG - Intronic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
987284096 5:16438817-16438839 CTGATACTGTATATTGTGCCGGG - Intergenic
988660783 5:33265711-33265733 CTTGTTCTGTATTCTGTGCTTGG - Intergenic
989168809 5:38455491-38455513 CATGTTCTATATCTTGTTCTGGG - Intronic
992825456 5:80545798-80545820 AATGTTCTCTATCTTGTTCCGGG + Intergenic
993085879 5:83363282-83363304 CCTGATCAGTATCTTGTGGCAGG + Intergenic
995828128 5:116324569-116324591 CTTGTTATGTTTCTTTTGCTTGG - Intronic
996782556 5:127203406-127203428 CTTTTTCTGTATCTATTGCAAGG - Intergenic
996988487 5:129598534-129598556 ATTGTTCTGTTTCTTGGGCTGGG - Intronic
997879431 5:137576177-137576199 ATTGTTGTGTATTTGGTGCCAGG - Intronic
999525413 5:152400358-152400380 CTTGCTGAGTATCATGTGCCAGG - Intronic
999619612 5:153459323-153459345 CATGCTCTGTTTCTTCTGCCTGG + Intergenic
1000521650 5:162301551-162301573 CTAGTCTTGTATCTTTTGCCAGG - Intergenic
1000916875 5:167093334-167093356 TTGGTCCTGTATTTTGTGCCAGG + Intergenic
1001482407 5:172097382-172097404 AATGTTCTGTATCTTGAGCTGGG - Intronic
1002816782 6:688419-688441 GTTGTTCTGTAGCATCTGCCTGG - Intronic
1004602311 6:17162261-17162283 TTTGTTCTGTTGTTTGTGCCTGG - Intergenic
1005077097 6:21919120-21919142 CCTGTTCTGGATCATGTGCCAGG - Intergenic
1009334083 6:62463342-62463364 CTGGGTGTGTATTTTGTGCCAGG - Intergenic
1010433342 6:75802802-75802824 CTAGTTCTGTAATTTGTGCTAGG - Intronic
1013249805 6:108322783-108322805 CTTGTTCTGAAAAATGTGCCAGG + Intronic
1014208139 6:118679297-118679319 TTTTTTCTTCATCTTGTGCCAGG - Intronic
1015704887 6:136077024-136077046 CTTCTTATGTACCCTGTGCCAGG + Intronic
1015730986 6:136348174-136348196 CCTGTTCTTTATCCTTTGCCAGG - Intronic
1016895397 6:149046394-149046416 CTTGTTCTGGATCATCTGCTAGG + Intronic
1018514700 6:164566284-164566306 CTTGTTCTTTTTCTTCTGCCTGG + Intergenic
1019448014 7:1081422-1081444 TTTGTTCTGGTTCTTCTGCCCGG - Intronic
1019624058 7:2006903-2006925 CTTGTGTTGTATCTGGTGTCTGG - Intronic
1020008884 7:4797677-4797699 CTTGTTCTGTTTCTTTTCCTAGG - Intronic
1021553440 7:21896212-21896234 CTTTTTTTGTATCTTGTTCTGGG + Intronic
1022946525 7:35290862-35290884 TCTGTCCTGTCTCTTGTGCCTGG - Intergenic
1025926787 7:65966979-65967001 CTTGAGCTGTTTCTTCTGCCTGG - Intronic
1026465471 7:70649945-70649967 TTTGTTCTGTTACTTGTGGCTGG - Intronic
1032916348 7:136494337-136494359 TTTATTCTGAATTTTGTGCCTGG + Intergenic
1033539830 7:142346089-142346111 GATGTTCTGAATCTTCTGCCGGG - Intergenic
1041717260 8:60943549-60943571 CATGTTCTGTCCCTTCTGCCTGG + Intergenic
1042361821 8:67892232-67892254 CTTCTTCTGTCTCTTGAACCTGG + Intergenic
1042762115 8:72282205-72282227 GTTGTTCTATTTCTTGTGGCTGG - Intergenic
1043373439 8:79620455-79620477 TTTGTTCTGAAGCCTGTGCCAGG + Intronic
1044319358 8:90785201-90785223 TTTCATCTGTATCTTGTGCCTGG - Intronic
1044893119 8:96858301-96858323 CATTTTCTCTATCTTGTGGCAGG + Intronic
1046174944 8:110563054-110563076 CTTGTTCTGTTTCATTTGGCTGG - Intergenic
1047036633 8:120946805-120946827 GTTGTTCTGTTTCAAGTGCCAGG + Intergenic
1047702059 8:127458592-127458614 TTTGTTATGTATCTTTTGCAAGG + Intergenic
1048394929 8:134005124-134005146 CTTGTTCTATAACCTGTACCTGG + Intergenic
1048569857 8:135643185-135643207 CATATTCTGTTTCTTCTGCCTGG + Intronic
1049884475 9:18058-18080 CTTGCTCTGGATCCTGTGGCGGG + Intergenic
1050959972 9:11717248-11717270 CTTGTGCTTAACCTTGTGCCTGG - Intergenic
1055926671 9:81517410-81517432 CTTTTTCTGTCTCTTGTGTGAGG - Intergenic
1056043158 9:82688385-82688407 TTTGTTCAGTAGATTGTGCCAGG + Intergenic
1056203870 9:84301736-84301758 GTTGTTCCCTATCTTGTGCCAGG + Intronic
1056974980 9:91244709-91244731 CCTGTCCTGTATCCTGTTCCAGG + Intronic
1057249715 9:93491046-93491068 CTTGTTCTGAAAGTTATGCCTGG + Intronic
1057279788 9:93701361-93701383 CATGTACTGTATCCAGTGCCTGG - Intergenic
1057712928 9:97463525-97463547 CTTGTTCTTTGTATTGTTCCAGG - Intronic
1058287542 9:103198268-103198290 CTTGTTCTGTTCCTTCTACCAGG + Intergenic
1058858965 9:109095744-109095766 GCTGTTCTGTATCTTGTGTCAGG - Intronic
1186140823 X:6571567-6571589 CTTGTTCTATTCCTGGTGCCTGG - Intergenic
1187228012 X:17392808-17392830 AATGTTCTGTATCTTGTCCCAGG - Intronic
1193527404 X:82610864-82610886 ATTATTCTATATCTAGTGCCTGG + Intergenic
1194859288 X:98976231-98976253 CTTTTTCTGTATCTTTTGATAGG - Intergenic
1195159831 X:102160454-102160476 TTTGATCACTATCTTGTGCCAGG - Intergenic
1195707786 X:107750561-107750583 CTTGTTCTGTCTCCTGTTTCTGG - Intronic
1198494399 X:137176908-137176930 CTTGTGCTGTATCAGGTGCTGGG + Intergenic
1198520214 X:137444850-137444872 CATGTTCTCTATTCTGTGCCTGG - Intergenic
1198666215 X:139026020-139026042 CTAGTTCTGAATCCTGTGGCAGG - Intronic
1198736816 X:139794899-139794921 CCTGTTCTGGATTTAGTGCCTGG - Intronic
1199715307 X:150503688-150503710 CTTGTTCTCTACTTTCTGCCCGG + Intronic
1200401331 X:156022093-156022115 CTTGCTCTGGATCCTGTGGCGGG - Intergenic
1202363810 Y:24140287-24140309 CTTGTTTTTTATCTTGTGAAGGG - Intergenic
1202506970 Y:25529835-25529857 CTTGTTTTTTATCTTGTGAAGGG + Intergenic