ID: 946143257

View in Genome Browser
Species Human (GRCh38)
Location 2:217709777-217709799
Sequence CAGAACACCATGGGTACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946143257_946143265 28 Left 946143257 2:217709777-217709799 CCTGCTGTACCCATGGTGTTCTG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 946143265 2:217709828-217709850 GGCCTCTCCATTGCTTCCAGTGG 0: 1
1: 0
2: 1
3: 19
4: 176
946143257_946143263 7 Left 946143257 2:217709777-217709799 CCTGCTGTACCCATGGTGTTCTG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 946143263 2:217709807-217709829 TGTGGTGCTCACATCCACAGTGG 0: 1
1: 0
2: 4
3: 27
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946143257 Original CRISPR CAGAACACCATGGGTACAGC AGG (reversed) Intronic
901192346 1:7420130-7420152 GAGAACAGCATGGGTTCAGGAGG - Intronic
901816367 1:11795741-11795763 CAGTGCAGCATGGGAACAGCTGG - Intronic
901839284 1:11943881-11943903 TAGGAAACCAAGGGTACAGCTGG - Intronic
902642623 1:17776432-17776454 CTGTACACCAGGGGCACAGCGGG - Intronic
904409438 1:30316281-30316303 CAAAAGACCATGAGTACAGGAGG - Intergenic
911564959 1:99453321-99453343 AAGAACTTCATGGGTATAGCAGG - Intergenic
912243818 1:107939936-107939958 AAGAACTTCATGGGTACATCTGG - Intronic
914373841 1:147054378-147054400 CAGAACATTATGGGGACAACAGG + Intergenic
919839341 1:201597797-201597819 CAGGACATCACGGGCACAGCAGG - Intergenic
920107947 1:203567675-203567697 AAGAACACCAGTGGTTCAGCTGG - Intergenic
920512083 1:206558901-206558923 CAGAACACCGTGGCTGCAGAGGG + Intronic
922998208 1:229983697-229983719 CAGAAAAGCAAGGGTACAGTTGG + Intergenic
1063466413 10:6247979-6248001 CAGGTCACCCTGGGTAGAGCAGG + Intergenic
1063499821 10:6543404-6543426 CACAACACCATGGGGAAAGGTGG + Intronic
1067415010 10:46096157-46096179 AGGACCACCATGGGGACAGCAGG + Intergenic
1067581164 10:47447060-47447082 ATGACCACCATGGGGACAGCAGG - Intergenic
1069578973 10:69552232-69552254 AAGAACTTCATGGGTGCAGCAGG + Intergenic
1070834973 10:79442474-79442496 CAAAACACCATGAATGCAGCTGG - Intronic
1071358200 10:84818893-84818915 CAGAGGCCCATGGCTACAGCAGG + Intergenic
1073730691 10:106284240-106284262 GAGAACACTATGGAGACAGCTGG - Intergenic
1076631806 10:131856217-131856239 CAGAGCACCAGGGGCACCGCTGG - Intergenic
1083242952 11:61403345-61403367 CATCACCCCATGGGTACCGCAGG + Exonic
1084698369 11:70769906-70769928 CAGCACACCCTGGGTCCTGCAGG + Intronic
1087105026 11:94400138-94400160 CAGTATCCCATGGGTACGGCTGG + Intronic
1087882245 11:103431096-103431118 ATGAACACCCTGGTTACAGCCGG + Intronic
1088659400 11:112030324-112030346 AAGAACACCATGGGGTTAGCAGG + Intronic
1088803788 11:113332433-113332455 CAGAGCACCGGGGTTACAGCAGG - Intronic
1089588324 11:119523990-119524012 CAGGACAGCGTGGGGACAGCAGG + Intergenic
1091048633 11:132348306-132348328 CAGAGCGACATGGGGACAGCTGG + Intergenic
1095053522 12:37575339-37575361 CAGTATTCCATGGTTACAGCTGG - Intergenic
1095365967 12:41405793-41405815 CACAGCAACATGGGTAGAGCTGG + Intronic
1098028823 12:66233599-66233621 CAGAACACCATGGGTGAAGTCGG + Intronic
1099674594 12:85742591-85742613 CAGAACAACGTAGGTACAGTAGG + Intergenic
1100132238 12:91510260-91510282 TAGAACACCACAGGTACAGATGG + Intergenic
1100150502 12:91730910-91730932 CAGAACACAATAGGTACTACCGG - Intergenic
1100241982 12:92718817-92718839 CAGAGCACCATGGTAACTGCTGG - Intergenic
1101197127 12:102395037-102395059 CAGAACACCATGACTATAGGAGG + Intergenic
1104406822 12:128524882-128524904 CAGAGCACCCTGGGCAAAGCAGG - Intronic
1105425457 13:20291166-20291188 CAGAACACCACGTTTACAGGTGG - Intergenic
1108783365 13:53864811-53864833 AAGAACACCATGTGGATAGCTGG - Intergenic
1118362561 14:65068879-65068901 CAGGCCATCATGGGTACAGAAGG - Intronic
1118841275 14:69514798-69514820 TAGAATAGCATGGGTACAGTGGG + Intronic
1119379530 14:74219657-74219679 CAGATCACCGTTGGGACAGCTGG - Intergenic
1120929214 14:89831263-89831285 CAGAAAACCATGGGAAAAGCAGG + Intronic
1121275436 14:92664179-92664201 CAGAACCCCATGTGTAAAACAGG - Intronic
1125671973 15:41480362-41480384 CAGAAAACCATGGATCCATCTGG - Intronic
1129765645 15:78164646-78164668 CAGAAAACCATGTCCACAGCTGG - Intronic
1130274064 15:82467430-82467452 CAGAACATGAAGGGTACTGCTGG + Intergenic
1130588706 15:85199397-85199419 CAGAACATGAAGGGTACTGCTGG + Intergenic
1133131773 16:3680551-3680573 CCTACCACCATGGGAACAGCGGG + Intronic
1133616648 16:7483124-7483146 CAGCACAGCCTTGGTACAGCTGG - Intronic
1139476132 16:67203401-67203423 CAGAACAAGGTGAGTACAGCGGG + Exonic
1141156236 16:81599160-81599182 CACAACACCAAGGGCACAGCTGG + Intronic
1141732554 16:85832788-85832810 CAGAACGCCCTGGGGACAGGCGG - Intergenic
1143393296 17:6573107-6573129 CAGCACTGCATGGGCACAGCCGG + Intergenic
1146243758 17:31258365-31258387 CAGAACAGCATCGGTGCAGTAGG + Exonic
1146376155 17:32295928-32295950 CAGAAAACCTGGGGTCCAGCCGG + Intronic
1152133438 17:78490888-78490910 CAGAACACCATTGGGATGGCAGG - Intronic
1152404166 17:80087052-80087074 GGGCACACCATGGGGACAGCAGG + Intronic
1153730495 18:8006600-8006622 CAGGAAACCATGGGTAGAACTGG + Intronic
1153763344 18:8352581-8352603 TGGTACAACATGGGTACAGCTGG - Intronic
1154067967 18:11126983-11127005 CAAGACACTGTGGGTACAGCAGG + Intronic
1155586567 18:27373074-27373096 CTGAAGAGCAAGGGTACAGCTGG + Intergenic
1156204433 18:34870776-34870798 CAGAGCAACCTGGGAACAGCAGG - Intronic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157795436 18:50570200-50570222 CACAACACCCTGGTTGCAGCTGG + Intronic
1159516183 18:69461390-69461412 CACTCCACCATGGGAACAGCTGG + Intronic
1164524078 19:29000686-29000708 CAGAAAACCAGGGGAAGAGCTGG - Intergenic
1164929645 19:32165652-32165674 CAGAAGACACTGGGGACAGCTGG - Intergenic
1165314549 19:35046650-35046672 CACATCACCATGGGTGCAGATGG + Intronic
1165780304 19:38429510-38429532 CAGAACACCATGAGGCCAGGGGG - Intergenic
1167555396 19:50191870-50191892 CAAAATACCAGGGGTACATCTGG + Intronic
928982102 2:37146651-37146673 TAGGACACCATGGGCAAAGCTGG - Intronic
931705263 2:64941839-64941861 CAGATCACCAAGGGTACTTCAGG - Intergenic
934877416 2:97937421-97937443 CAAAACACCATCTGTACAACAGG + Intronic
935502986 2:103864914-103864936 CAGAACACCAGGGATTTAGCAGG - Intergenic
936118496 2:109721780-109721802 CATAGCCCCATGGGTGCAGCTGG + Intergenic
936616124 2:114049417-114049439 CACAATGCCATGGGTACAGATGG + Intergenic
937382023 2:121387130-121387152 CAGACCCCCATGGGAACAGTTGG + Exonic
938427752 2:131206476-131206498 CTGAACAACATGAGTACAGAAGG + Intronic
938468680 2:131540477-131540499 CTGAACAACATGAGTACAGAAGG + Intergenic
941008764 2:160274285-160274307 CAGAACACCATGGGTGAAGTCGG + Exonic
946143257 2:217709777-217709799 CAGAACACCATGGGTACAGCAGG - Intronic
947939110 2:234033550-234033572 CAGAAGACCCAGAGTACAGCAGG + Intergenic
1174087244 20:48018164-48018186 CAGGAGGCCATGGGTACAGAGGG - Intergenic
1175205202 20:57305952-57305974 CAGAACACCAAGGGCAAATCTGG - Intergenic
1175553921 20:59834315-59834337 CAGACCACCATAGGAAAAGCAGG - Intronic
1178177355 21:30118377-30118399 CAGAACACCAGGAGGAAAGCAGG - Intergenic
1178268295 21:31165894-31165916 CAGAATATCATGGGAAGAGCAGG - Intronic
1179450803 21:41467044-41467066 CAGAAAAGGATGGGCACAGCCGG + Intronic
1179523754 21:41962153-41962175 CAGAACACCAGGGACCCAGCGGG - Intergenic
1179711687 21:43267262-43267284 CAGGAGGCCAGGGGTACAGCTGG - Intergenic
1183193070 22:36334297-36334319 CCCAACACCATGGCTGCAGCCGG - Intronic
1183423112 22:37723690-37723712 CAGGACACCCTGTGTCCAGCAGG + Exonic
950214874 3:11152460-11152482 CTGATCACCATGGGTTTAGCAGG + Intronic
952881075 3:37986704-37986726 GAGGACACCACGGGAACAGCTGG - Intergenic
956266903 3:67406572-67406594 CAGAATACCATGTATACAGGTGG + Intronic
957497161 3:81007251-81007273 CAGATCACAATGGGCACAGGTGG + Intergenic
957582601 3:82093452-82093474 TACAACAACATGGATACAGCTGG - Intergenic
960813742 3:121652083-121652105 CACAACACCATGGATAAATCTGG + Intronic
961673751 3:128552520-128552542 GAGATCACCATGGGAACTGCTGG - Intergenic
968467642 4:760502-760524 GAGGACACCAGGGGTACAGACGG - Intronic
969267573 4:6074538-6074560 CAGTCCCCCATGGGTACCGCAGG - Intronic
969315036 4:6376930-6376952 GAGAACACCATCAGAACAGCAGG + Intronic
969877632 4:10147667-10147689 CAGAACACCATGGGGACTAGGGG - Intergenic
971228993 4:24782525-24782547 CAGAACAGCATGGGGAGAGAGGG - Intergenic
972581627 4:40400216-40400238 CTGAACCCTATGGGTTCAGCTGG - Intergenic
978281179 4:107016803-107016825 GAGAAAACCATGGGTGCAGCAGG + Intronic
978469237 4:109044606-109044628 CACAGCACCATGGGAACTGCGGG + Intronic
981809775 4:148760604-148760626 CAGAACACCATGAGTTCAACAGG - Intergenic
986537948 5:8812293-8812315 CGCAACAACATGGGTGCAGCTGG + Intergenic
989016215 5:36937959-36937981 CTGAAAACCTTGGGTTCAGCGGG + Intronic
991590848 5:68250090-68250112 CGGCACACCTTGGGAACAGCTGG + Intronic
992309176 5:75477301-75477323 CATAACATCAAGGGTACAGCTGG + Intronic
993292337 5:86090428-86090450 CCGAACACCAAGTTTACAGCAGG - Intergenic
1001851849 5:174974673-174974695 GAGAACAGCATGGGAACAACTGG + Intergenic
1003834223 6:10050626-10050648 CAGAACACCCTGGGGAAAACAGG + Intronic
1004048618 6:12050607-12050629 TTAAACACCATGGGTCCAGCTGG + Intronic
1004320500 6:14628099-14628121 CAGAGCACCCTGGGTGCATCTGG - Intergenic
1005392051 6:25343854-25343876 CCGTACACCATGGGTAGAGCTGG + Intronic
1005881915 6:30068714-30068736 CAGAACTCCAGGGCTACTGCGGG - Intronic
1008536406 6:52509431-52509453 CAGAACACCACAGGCCCAGCTGG - Intronic
1013195413 6:107840794-107840816 CAGAGCAGCATGGGTTCAGATGG - Intergenic
1014113255 6:117644914-117644936 CTGAACAGCATGGGGAGAGCTGG + Intergenic
1015591847 6:134829844-134829866 CAGAACACCATGGATCCCCCTGG - Intergenic
1016298435 6:142601638-142601660 CACAGCAACATGGATACAGCTGG + Intergenic
1018617607 6:165702777-165702799 CAGTGCACCATGGGAACTGCAGG - Intronic
1021621228 7:22552742-22552764 CAGGACACCCTGGATGCAGCAGG + Intronic
1024827190 7:53404434-53404456 TGGAACACCCTGGGCACAGCTGG + Intergenic
1025739523 7:64183874-64183896 GAGAACACCCAGGGTACAGGAGG + Intronic
1032497305 7:132372089-132372111 CTGACCACCTTGAGTACAGCTGG - Intronic
1032755913 7:134890753-134890775 CAGAGTACCATGGGTGCAGACGG + Intronic
1034690748 7:153011698-153011720 CAGAACACCTGGGGCACACCTGG - Intergenic
1035310382 7:157964147-157964169 TGGCACACCATGGGGACAGCTGG + Intronic
1037743824 8:21627968-21627990 CAACTCACCATGGGAACAGCAGG + Intergenic
1039312514 8:36332937-36332959 CAGAACAGCATGGCTAGAGTGGG - Intergenic
1039666670 8:39540818-39540840 TACAGCACCATGGATACAGCTGG - Intergenic
1039930540 8:41984102-41984124 AAGAACAGCATGGGCATAGCTGG - Intronic
1040073600 8:43207205-43207227 GAGAACCCCATTAGTACAGCCGG + Intergenic
1040462299 8:47660614-47660636 TAGAATACCATGTCTACAGCGGG - Intronic
1041978623 8:63829295-63829317 CAGAACTCTCAGGGTACAGCTGG - Intergenic
1042781886 8:72500402-72500424 TGCAACAACATGGGTACAGCTGG + Intergenic
1043654234 8:82641582-82641604 CAGAACACAAGGGGTACAACTGG + Intergenic
1045654354 8:104371550-104371572 CAGAAAGCCATGTGTGCAGCTGG - Intronic
1049096761 8:140552958-140552980 CAGAAAGCAATGTGTACAGCAGG - Intronic
1049402335 8:142434021-142434043 CAGAACAGCCAGGGTGCAGCAGG - Intergenic
1055783274 9:79843113-79843135 CAGAGGACCATGGCTACAGTTGG + Intergenic
1057877390 9:98768270-98768292 GTGAACACCATGGGCACAGAGGG + Intronic
1059344756 9:113620624-113620646 CAGAACTCCAGGGAAACAGCGGG - Intergenic
1061447384 9:130648025-130648047 CACAATGCCTTGGGTACAGCTGG - Intergenic
1062163171 9:135090919-135090941 CAGAACCACATGGGAACAGCAGG + Intronic
1187483396 X:19679046-19679068 CTGAAAACCATGGGTCCAGTAGG - Intronic
1188018063 X:25126772-25126794 TACAGCAACATGGGTACAGCTGG + Intergenic
1188959712 X:36476041-36476063 CACAACAACATGGATAGAGCTGG + Intergenic
1192095655 X:68207863-68207885 CAGGACAACAGGGGTAAAGCAGG + Intronic
1192875580 X:75226006-75226028 GAGAACACTATGGATAAAGCAGG - Intergenic
1194943526 X:100041340-100041362 CAAAACAACAGGGATACAGCAGG + Intergenic
1198004663 X:132480633-132480655 CAGAGCACCATGGGCAGAGCTGG - Intronic
1198152396 X:133923654-133923676 CTGAACAGCATGGGAACAACTGG + Intronic