ID: 946143658

View in Genome Browser
Species Human (GRCh38)
Location 2:217712907-217712929
Sequence CTGGGGACACAGCCCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 289}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946143653_946143658 19 Left 946143653 2:217712865-217712887 CCTGCAAGGTTCTATTCTTCAAT 0: 1
1: 0
2: 0
3: 5
4: 134
Right 946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG 0: 1
1: 0
2: 0
3: 36
4: 289
946143650_946143658 26 Left 946143650 2:217712858-217712880 CCACCACCCTGCAAGGTTCTATT 0: 1
1: 0
2: 1
3: 18
4: 174
Right 946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG 0: 1
1: 0
2: 0
3: 36
4: 289
946143651_946143658 23 Left 946143651 2:217712861-217712883 CCACCCTGCAAGGTTCTATTCTT 0: 1
1: 0
2: 0
3: 14
4: 174
Right 946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG 0: 1
1: 0
2: 0
3: 36
4: 289
946143649_946143658 27 Left 946143649 2:217712857-217712879 CCCACCACCCTGCAAGGTTCTAT 0: 1
1: 0
2: 0
3: 18
4: 142
Right 946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG 0: 1
1: 0
2: 0
3: 36
4: 289
946143652_946143658 20 Left 946143652 2:217712864-217712886 CCCTGCAAGGTTCTATTCTTCAA 0: 1
1: 0
2: 1
3: 5
4: 174
Right 946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG 0: 1
1: 0
2: 0
3: 36
4: 289
946143657_946143658 -8 Left 946143657 2:217712892-217712914 CCAAATAACTTGTAACTGGGGAC 0: 1
1: 0
2: 0
3: 9
4: 124
Right 946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG 0: 1
1: 0
2: 0
3: 36
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946143658 Original CRISPR CTGGGGACACAGCCCAAACA TGG Intronic
901515330 1:9741469-9741491 CAGAGGACACAGCCCAAGTAGGG + Intronic
901828178 1:11876167-11876189 CTGGGATCACAGCAGAAACAAGG + Intergenic
903519509 1:23935969-23935991 CTGGGTACACCTCCCAGACAGGG - Intergenic
903646452 1:24898951-24898973 CTGGGACCACAGCCCAACAATGG - Intergenic
904052301 1:27646995-27647017 ATGGGGACACAGCCCAATTCGGG - Intergenic
904058527 1:27688007-27688029 CTTGGAACACAGGCCATACAGGG - Intergenic
904910507 1:33930919-33930941 CTGGGGACACAGCACAGACTAGG - Intronic
906369415 1:45240066-45240088 CACGGGACACAGCCCTTACAGGG + Intronic
906532709 1:46532763-46532785 CAGGGGTCACACCCCAAAGAAGG - Intergenic
907944655 1:59124341-59124363 CTGGGGAGACAGACCCAAGAAGG - Intergenic
908027516 1:59968495-59968517 GTGGGCACACAGCCTGAACAGGG + Intergenic
908884283 1:68770078-68770100 CTGGGGAAACATCACAATCATGG + Intergenic
911127267 1:94352207-94352229 CTGGGGACACATACATAACAAGG - Intergenic
914890695 1:151619992-151620014 GTGGGGAGACAGCTCATACAAGG + Intronic
915440988 1:155945391-155945413 CTGGAGACACAGCCCAGAGTGGG - Intergenic
916260246 1:162834671-162834693 CTTGGGACACAGCCTATACGGGG - Intronic
916567424 1:165993340-165993362 CTGGGAACACAGCACAGAGAAGG - Intergenic
919163594 1:193863574-193863596 CTGGGGAAACATCACAATCATGG - Intergenic
919204265 1:194400369-194400391 ATGGAGAGACAGCTCAAACAAGG + Intergenic
919844391 1:201632196-201632218 CTGGGCATAGAGTCCAAACAAGG + Intronic
919894355 1:201999737-201999759 CTGGGGACCCAGGGCAAATAGGG - Intronic
919942511 1:202297887-202297909 CTCTGGACACATCCCAACCAAGG - Intronic
922216560 1:223524824-223524846 ATGGAGACAAAGGCCAAACAGGG + Intergenic
922444251 1:225683262-225683284 ATGAGAACACAGCCCAAAGACGG + Intergenic
922791683 1:228314496-228314518 CTGGGCACATGGCCCCAACAGGG - Intronic
923247724 1:232149066-232149088 CTGGGGACACAGCCATAAATAGG - Intergenic
924216182 1:241824717-241824739 CTGGAGCCACAGCTCAAAGATGG + Intergenic
924647244 1:245889566-245889588 CTTGGGACAGAGACCAGACAAGG - Intronic
1063175903 10:3550791-3550813 CTGAGTACACAGCCCCAACAAGG + Intergenic
1063335783 10:5211825-5211847 CTGGGGACACCTCACAATCATGG + Intronic
1063341038 10:5263269-5263291 CTTGGGACACACCCCAAAATGGG - Intergenic
1063609379 10:7550205-7550227 CTGGGGACCCAGCCCATCCCAGG + Intergenic
1064745655 10:18475724-18475746 CAGGGGACACACTCAAAACAAGG - Intronic
1065868234 10:29932838-29932860 CTGGGGAGGCAACCCAAGCATGG + Intergenic
1068208279 10:53886308-53886330 CTGGTTACACAGCCCACTCATGG + Intronic
1069914380 10:71778316-71778338 CATGGGACACAGCCCCAACTTGG + Intronic
1072936332 10:99717102-99717124 GTGGGGACTCAGCCCACACCAGG + Intronic
1072941579 10:99768905-99768927 CTGGGAACACAACACAAACAGGG + Intergenic
1073445052 10:103575542-103575564 CTGGGGACACAACCCATCCATGG - Intronic
1074857083 10:117481471-117481493 CTGGGGTCCCAGCCCTAATAGGG - Intergenic
1075573752 10:123563541-123563563 CTGGGAAAACAGACCCAACAAGG - Intergenic
1075626995 10:123970697-123970719 CTGGGAATACAGCCCAAGCAAGG - Intergenic
1076903630 10:133351763-133351785 CTTGGGACACTGCTCAACCAAGG + Intronic
1077890982 11:6418540-6418562 CTGGGGACACAGCCGCCCCAGGG + Intronic
1079110958 11:17604966-17604988 CTGGGGACACAGGGGACACATGG + Intronic
1079248591 11:18771297-18771319 CTGAGGGAACAGCACAAACAAGG - Intronic
1079281315 11:19089637-19089659 CTGGGGAAACAGGTCAGACAAGG - Intergenic
1080646026 11:34188308-34188330 CTGAGGACACAGCAGGAACAGGG + Intronic
1080692935 11:34574239-34574261 CTGGGGATAATGCCCAAACCTGG + Intergenic
1080982502 11:37424951-37424973 CTGGGGAGACCTCCCAATCATGG + Intergenic
1081767982 11:45625603-45625625 CTGGGGACACCTCACAATCATGG + Intergenic
1081869056 11:46375072-46375094 CTGGGAGCACAGCCCAAAGGTGG + Intronic
1082589963 11:54994373-54994395 CTGGGGACAATGTCCAAAAATGG + Intergenic
1082900257 11:58241491-58241513 CTGGGGATTAAGCCCAAACTAGG + Intergenic
1083439495 11:62666455-62666477 GTGGGGACAGTGCCCAAACGAGG - Exonic
1084416631 11:69036204-69036226 CTGGGCACAGGGCCCAAAAATGG - Intergenic
1087605728 11:100375559-100375581 CTGGGGACACTGCAAGAACATGG + Intergenic
1087976606 11:104557154-104557176 CTGGGGACTGAGCTGAAACAGGG - Intergenic
1088365094 11:109032178-109032200 CTCTGGAAACAGCCCAAACCAGG + Intergenic
1088695294 11:112361209-112361231 CTAGGGACTCAGCCAACACAGGG - Intergenic
1089601641 11:119619266-119619288 CTGGTGACACTGGCCAAACAAGG + Intergenic
1090270701 11:125383993-125384015 CTGGGGAGACAGACCAGAGAGGG + Intronic
1090451030 11:126806576-126806598 TTGGAGACACAGCCAACACATGG - Intronic
1091174590 11:133546878-133546900 CTGGGGGCAGAGGCCACACAGGG - Intergenic
1091663041 12:2398758-2398780 CTGGTGAGACAGCCCAAAGGAGG + Intronic
1091730692 12:2877837-2877859 CTGGGCTCACAGCCCAATCCTGG + Intronic
1092543546 12:9434731-9434753 ATGGGGACTCAGCAGAAACAAGG - Intergenic
1094437775 12:30440504-30440526 CTGGGGGGACAGCCCAATCGTGG - Intergenic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1097626935 12:62011217-62011239 CTGGGTACACTTCCCAGACAGGG - Intronic
1098181864 12:67855810-67855832 CTGAGGACACAGGGTAAACAAGG - Intergenic
1099768935 12:87027962-87027984 CTGGGGAGACCGCACAATCATGG + Intergenic
1099956724 12:89358286-89358308 CAGAGGAAACAGCCCACACAGGG - Intergenic
1102048482 12:109845310-109845332 CTTAGGAAACAGCCCAAGCACGG + Intergenic
1102618173 12:114172915-114172937 CTACGGACACAGGCCATACAGGG + Intergenic
1103468487 12:121161114-121161136 CTGGGGACAGAGCCGAAGCATGG - Intronic
1103722791 12:122983579-122983601 ATGGGGACACTGCTCACACATGG + Exonic
1103933156 12:124461104-124461126 CAGGGGACTCAGCCCCAACCTGG + Intronic
1104452938 12:128886138-128886160 CTGGGGAGACCTCCCAATCATGG - Intronic
1104460071 12:128948114-128948136 GAGGGGACACAGCCCAGCCAGGG - Intronic
1106796985 13:33216924-33216946 CTTGGAACACAGGCCATACAGGG + Intronic
1107947608 13:45433515-45433537 CTGAGAACACAGCCCTCACAGGG - Intergenic
1108502149 13:51078394-51078416 CTGGGCACACCTCCCAGACAGGG - Intergenic
1113441700 13:110334084-110334106 CTGGGGACACAGGCCACACCTGG - Intronic
1114288131 14:21265273-21265295 TTGGAGCCACAGCCCAAACCTGG + Intronic
1115939581 14:38593225-38593247 GTGAGGACACAGCAAAAACATGG + Intergenic
1116139225 14:40968423-40968445 CTGGGGACAAAGCCCAGACTGGG - Intergenic
1118851567 14:69587649-69587671 CAGAGGACCCAGCCCAAACAAGG + Intergenic
1119533458 14:75380044-75380066 CTTGGAACACAGGCCATACAGGG - Intergenic
1120219265 14:81714126-81714148 CTGGGGACAAAGCATAAACAAGG + Intergenic
1120397737 14:83989532-83989554 CAGGGTACACAACCCAAACTGGG + Intergenic
1120694861 14:87633308-87633330 CTGGTGACACAGCCCTCAGAAGG + Intergenic
1122502533 14:102210852-102210874 CGGGGGACGAAGCCCAAACGAGG - Intronic
1122549717 14:102543461-102543483 CTGGGGCATCAGCCCAGACAGGG - Intergenic
1202863723 14_GL000225v1_random:101884-101906 CTGTGGGCACAGCCTAGACAAGG - Intergenic
1123429600 15:20203796-20203818 CTGGGCACACCTCCCAGACAGGG + Intergenic
1123583404 15:21736819-21736841 CTGCAGAAACACCCCAAACAAGG + Intergenic
1123620054 15:22179416-22179438 CTGCAGAAACACCCCAAACAAGG + Intergenic
1124066177 15:26346193-26346215 CTGGGGACACCTCACAATCATGG - Intergenic
1124533204 15:30523650-30523672 CTGAGGAAACAGGCCAAAAAGGG + Intergenic
1128318851 15:66678779-66678801 CTTGGGACCAAGCCCAGACAGGG + Intronic
1129279959 15:74476892-74476914 CTGGGGACACCTCACCAACATGG + Intergenic
1130549165 15:84878821-84878843 CAGGGGACACAGCACACACAAGG + Intergenic
1130830625 15:87594887-87594909 CAGGGGACACAGCTCATGCAAGG - Intergenic
1131015150 15:89051752-89051774 CTGGGGACACCTCACAATCATGG - Intergenic
1131511837 15:93053442-93053464 CTGGGGTCACAGCCCAGTCCTGG + Intronic
1132622793 16:875703-875725 CTGGACACACAGCCCAGGCAGGG - Intronic
1132831410 16:1930047-1930069 CAGGGGCCACAGCCCCACCAGGG + Intergenic
1135411983 16:22242296-22242318 CCAAGGACTCAGCCCAAACAGGG - Intronic
1135900563 16:26455813-26455835 CTGAGCACACAGAACAAACAAGG + Intergenic
1136684553 16:31986574-31986596 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1136785179 16:32930117-32930139 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1136884603 16:33923687-33923709 CTGGGAAAACAGCCCAGAGAGGG - Intergenic
1139679768 16:68552448-68552470 AGGGGGACACAGCCCAGACCTGG + Intronic
1140326292 16:74006083-74006105 CTGGGGACCCAGCCACACCATGG + Intergenic
1140776222 16:78250914-78250936 CGTGGAACACAGGCCAAACAGGG - Intronic
1141784124 16:86187114-86187136 CTGTGGACACAGCACAAAAATGG - Intergenic
1141916253 16:87099214-87099236 ATGGGGACACAGCCTAACCAAGG - Intronic
1142229853 16:88895095-88895117 GTGGGGACGCAGCCCAGAAAGGG - Intronic
1203087839 16_KI270728v1_random:1194126-1194148 CTGGGAAAACAGCCCAGAGAGGG + Intergenic
1143625744 17:8109415-8109437 CTGGGGACTCGGCCCAAGGAGGG + Intronic
1144230021 17:13192624-13192646 CTGGGGACACTTCACAATCATGG - Intergenic
1144300192 17:13916394-13916416 GTGAGGACAGAACCCAAACATGG + Intergenic
1144653262 17:17019973-17019995 CTGGGGACACAGCCTTCCCAAGG - Intergenic
1144841763 17:18190960-18190982 CTGGGGGCTCAGCCCAGAGAGGG + Intronic
1145902933 17:28499729-28499751 CTGGGGACACAGCTCGAATCAGG - Intronic
1146833541 17:36090791-36090813 CTGTGGAAACAACCCAAATATGG + Intergenic
1146848128 17:36197716-36197738 CTGTGGAAACAACCCAAATATGG + Intronic
1146908478 17:36632906-36632928 CTGGGCACACAGCCGTAAAATGG + Intergenic
1147145485 17:38482255-38482277 CTGGGAAAACAGCCCAGAGAGGG + Intronic
1150593147 17:66580503-66580525 CTGGAGGCGGAGCCCAAACATGG - Intronic
1152067891 17:78121509-78121531 CTGGGGACACGTTCCAAGCAAGG + Intronic
1152244322 17:79177258-79177280 CTGGGGACACAACCCAAAGGTGG - Intronic
1156312348 18:35936084-35936106 CTGAAGACAAAGCCCACACAGGG + Intergenic
1159545062 18:69830472-69830494 GTGAGGACACAGCACAAAGATGG + Intronic
1159734469 18:72076643-72076665 GTGGGGACACAGCCAAATCGTGG + Intergenic
1160884006 19:1336409-1336431 CGGGGGCCACCACCCAAACACGG + Intergenic
1161479983 19:4505606-4505628 CTGGGGACACAGCAACAACGAGG - Intronic
1162833331 19:13300331-13300353 CTGGGGATACAGCATTAACAAGG - Intronic
1162927004 19:13935833-13935855 GTGGGGACACAGCCCACAGCCGG + Intronic
1164483796 19:28637512-28637534 CAGGGAACACAGCTCAATCAAGG - Intergenic
1165064764 19:33222509-33222531 CTGGGAACAGAGCCCAAATCTGG + Intronic
1166104539 19:40590804-40590826 CTGGGGAGACAGCCCCATGAGGG - Exonic
1166110876 19:40622356-40622378 CTGGGGATTCAGCCCACACTGGG + Intronic
1166268126 19:41697286-41697308 CTGGGGACACTGCCCATGAAGGG + Intronic
1167109203 19:47448923-47448945 CTGGGGACACAGCAGTAACCAGG + Intronic
1167560720 19:50225502-50225524 CTGGAGACACAGCCCGAGCTGGG + Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
924971035 2:127112-127134 CTGGGCACACCTCCCAGACAGGG - Intergenic
925024535 2:597292-597314 CTGGGGACACACCACCATCAAGG + Intergenic
928360907 2:30661630-30661652 ATGGAGTCACAGCCCAATCATGG - Intergenic
928396800 2:30948923-30948945 CTGGAGACAGAGCCCATGCATGG - Intronic
928397425 2:30953776-30953798 CTTGGGACACTGCCCAAAATAGG + Intronic
929557576 2:42935123-42935145 CAGGGAGCACAGCCCAGACAGGG - Intergenic
930050445 2:47211593-47211615 CTGGGCACAGAGCCCAGACAAGG + Intergenic
932191028 2:69741853-69741875 CTGGGGACACTGTCCAATCCGGG + Intronic
933251250 2:80031378-80031400 CTGGGGAGGCCTCCCAAACATGG + Intronic
933317721 2:80735917-80735939 CAGTGGACTCAGCCCACACAAGG + Intergenic
935360286 2:102240924-102240946 CTTGAGACACAGGACAAACAAGG + Intergenic
936042744 2:109162023-109162045 CTGAGGACACATCCCAAGGAGGG - Intronic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936735347 2:115435179-115435201 CTGGGTACACAGCCTAAGAAAGG - Intronic
937128687 2:119490665-119490687 GTGGGGACACTGACCACACATGG - Intronic
937543618 2:122988990-122989012 CTGGGTCCATAGCCCCAACATGG - Intergenic
940712305 2:157176889-157176911 CTGGGGAGACATCACAATCATGG - Intergenic
941602811 2:167563160-167563182 CTGGGCACACCTCCCAGACAGGG + Intergenic
942511071 2:176702062-176702084 CTGGGACCACAGCCCATAGAAGG - Intergenic
943749989 2:191501141-191501163 TTGCGGAAACAGGCCAAACACGG + Intergenic
946134879 2:217637366-217637388 CTGGGGAGACAGCCCACCCGAGG + Intronic
946143658 2:217712907-217712929 CTGGGGACACAGCCCAAACATGG + Intronic
946573591 2:221050730-221050752 CATGGAACACAGGCCAAACAAGG + Intergenic
1169269428 20:4187817-4187839 CTGGGGACACAGCCAGGCCAGGG - Intergenic
1170012322 20:11737456-11737478 AAGGTGACACAGCCCAAACTTGG - Intergenic
1170775529 20:19371687-19371709 CTGGGGTCCCACCCCAAAAAAGG - Intronic
1171118826 20:22550524-22550546 CTGGGGACACCTCACAATCATGG + Intergenic
1172444688 20:34986863-34986885 CTGGGGACACAGGGCAGAGAAGG - Intronic
1172928532 20:38563850-38563872 CTGGGGACAAAGCCAAAATATGG - Intronic
1173542085 20:43861618-43861640 CTGGTCACACAGCCAAGACAAGG - Intergenic
1173854325 20:46240376-46240398 ATTGGGACACAGCTGAAACAGGG - Intronic
1175482828 20:59323479-59323501 CTGGGGACATAGCAGGAACAAGG + Intronic
1175636285 20:60586982-60587004 CTGGGGCCACTGTCCAAAGAAGG - Intergenic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1175934145 20:62507418-62507440 CTGTGGGCACAGCCCCATCATGG + Intergenic
1176118467 20:63443661-63443683 CTGGAGACAGAGCCCAAAGTGGG - Intronic
1176978661 21:15353728-15353750 CGTGTGACACAGACCAAACAGGG - Intergenic
1178399556 21:32273522-32273544 CTGGGGACTAAGACCAAACATGG + Intronic
1178756477 21:35354851-35354873 GTGGGGACGCAGCCAAACCATGG - Intronic
1179008018 21:37531592-37531614 CTGGGGGCACAGCAAGAACAGGG - Intergenic
1180148822 21:45937263-45937285 CTGGGGACACAGGCCAGTCCAGG + Intronic
1180832230 22:18912180-18912202 CTGGGCACACAGCCCAGGAAGGG - Intronic
1180988891 22:19921822-19921844 GAGGGGACAGAGCCCACACAGGG + Intronic
1181067612 22:20314162-20314184 CTGGGCACACAGCCCAGGAAGGG + Intergenic
1181107969 22:20585850-20585872 CTGGGGACCCAGGGCAAGCAGGG + Intronic
1181724009 22:24798579-24798601 CTGAGGGCACAGCCAATACAGGG + Intergenic
1181724203 22:24800124-24800146 CTGAGGGCACAGCCAATACAGGG - Intergenic
1182484480 22:30631514-30631536 CTGGGCACACCTCCCAGACAGGG + Intergenic
1183564960 22:38607685-38607707 CTGGGGACCCAGGGCAACCAGGG + Intronic
1184602535 22:45552125-45552147 CTGGGTAGACAGCCCACAGAGGG + Intronic
1185222317 22:49635263-49635285 CTGGGGACAGAGTCCCACCAGGG + Intronic
949565676 3:5242881-5242903 CTGGGTACACCTCCCAGACAGGG + Intergenic
951272742 3:20647149-20647171 CTGGGGACACATTCAAACCATGG - Intergenic
951756575 3:26097392-26097414 CTGGGGACACCTCACAATCATGG + Intergenic
951924324 3:27890639-27890661 CTGGGGGCAGGACCCAAACATGG - Intergenic
952859948 3:37804629-37804651 CTGGGGACACAGTGGAAACAAGG - Intronic
953447228 3:42978925-42978947 TTGGGGACTGAACCCAAACAAGG + Intronic
954187513 3:48929550-48929572 CTTTGGACACAGACCAAAGAAGG - Intronic
954418052 3:50403768-50403790 CTTGGGATACAGCACAAACAAGG - Intronic
954446180 3:50547995-50548017 CTGAAGACACAGCCCAGACTCGG - Intergenic
954862950 3:53705290-53705312 CTGGGGAAATGGCACAAACAAGG + Intronic
956560573 3:70569982-70570004 CTGGGGACACCTCACAATCATGG + Intergenic
956713641 3:72059704-72059726 TTGGGGACAAAACCCAAATATGG - Intergenic
958582691 3:96046289-96046311 GTGGGGACACAGCCAAACCAGGG + Intergenic
959014632 3:101120159-101120181 CTGAGGTCTCAGCCAAAACAGGG - Intergenic
960630450 3:119725396-119725418 ATGGGGACAAAACCCAAAGATGG + Intronic
961008505 3:123420848-123420870 CTGGGGAAACAGCCCTCAGAAGG - Intronic
961358603 3:126354062-126354084 CTGGGGACGCAGCAGAGACATGG - Intronic
961531773 3:127544464-127544486 CTGGGGCCACAGCCCTCCCAGGG - Intergenic
964590822 3:158360824-158360846 CTGGGTCCACAGCCCCAACTTGG + Intronic
965678830 3:171229783-171229805 CTGGGGAAAGAGCACAAAGAAGG + Intronic
966756329 3:183374769-183374791 CTTTGAACACAGCCCAAACCTGG - Intronic
967610583 3:191501049-191501071 ATGAGGACAGAGCCCAAAGAAGG + Intergenic
967845957 3:194042956-194042978 CTGGGGACAAATCTCAATCATGG + Intergenic
968436395 4:592424-592446 CTGGGCACACTTCCCAGACAGGG - Intergenic
969370592 4:6728761-6728783 CTGAGGACACAGGGCAAGCAGGG - Intergenic
969491407 4:7501159-7501181 ATGGGGACAGTGTCCAAACAGGG - Intronic
969578095 4:8048129-8048151 CTGGGGACTGAGCCCAGAGAAGG - Intronic
969595968 4:8149474-8149496 CTGTGGACACAGACCAAGCTGGG - Intronic
972938492 4:44168083-44168105 CTGGGTACACCTCCCAGACAGGG - Intergenic
974330340 4:60469570-60469592 CTGGGGAGGCCTCCCAAACATGG - Intergenic
977317046 4:95463259-95463281 ATGTGGACACATCCCTAACAGGG + Intronic
981277087 4:142913313-142913335 CTGGCCACATAGCCCAAACAAGG - Intergenic
983628843 4:169828707-169828729 TTGGGTACACATCCCAGACAGGG - Intergenic
985626298 5:990336-990358 CAGGGGACACAGCTCAAGCCTGG - Intergenic
985696839 5:1345489-1345511 CTGGGGAAAAAACCCACACACGG - Intergenic
988560939 5:32280688-32280710 CTGGGGCCACAGTCCAAATATGG + Intronic
988804644 5:34728626-34728648 CTGGGGAGACATCACAATCATGG - Intronic
990664293 5:58054525-58054547 GTGGGGACACAGCCAAATCAGGG - Intergenic
994798928 5:104344949-104344971 CTGAGGACATATGCCAAACAAGG + Intergenic
995914738 5:117230800-117230822 GTGGGGACAGAGCCAAACCATGG + Intergenic
997289214 5:132713615-132713637 CTGGGTACATACCCCAAAAATGG + Intronic
997974225 5:138429972-138429994 CTGGGAGCACAGCCCACCCAGGG - Intronic
998376309 5:141693087-141693109 CTTGGCACACAGCCCGAGCATGG + Intergenic
1002520948 5:179793070-179793092 CTGAGGACAGAGCCCACGCAGGG - Intronic
1003240372 6:4340347-4340369 CTGGGGACACAGAATAAACTGGG + Intergenic
1006974622 6:38087828-38087850 CTGGGTACATAGCCAAAATAAGG + Intronic
1007204278 6:40135875-40135897 GTGGGCACACAGCCAAACCAAGG - Intergenic
1007761346 6:44135305-44135327 CTGGGGACAGAGAACAGACAGGG - Intronic
1009927403 6:70136048-70136070 CTGTGGAACCAGCCCAAACAGGG - Intronic
1010764910 6:79767738-79767760 CTGGGGACACCTCACAATCATGG - Intergenic
1012488724 6:99753131-99753153 CTGGGAACACAGTCCACAGAGGG + Intergenic
1013173189 6:107655807-107655829 CTTTGGACAAAGACCAAACACGG - Intronic
1013482055 6:110561407-110561429 CTGGGAACACAGCATGAACAAGG + Intergenic
1016771571 6:147857936-147857958 CTGGGGACAGAACCCAAGGAAGG - Intergenic
1016932677 6:149425961-149425983 AGGGGGACAGAGCCCAAACTTGG - Intergenic
1018527893 6:164734476-164734498 CTGGGGACACCTCACAATCATGG - Intergenic
1019003565 6:168777522-168777544 CTGGGCTCACAGGCCCAACAGGG - Intergenic
1019012322 6:168851632-168851654 CTGGGGACGCAGCCAAGATAGGG + Intergenic
1019625777 7:2014970-2014992 CTGTGGACACAGCACACACAAGG + Intronic
1019709003 7:2509894-2509916 CTGGAGACACAGCCAGGACAGGG + Intergenic
1020124098 7:5523212-5523234 CTGGGGACACAGGCCCAAAGAGG - Intergenic
1020260025 7:6526070-6526092 CTGGGGACACGGTCTACACAAGG + Intronic
1021986238 7:26100986-26101008 CTGGGGCCACATCCCACACAGGG + Intergenic
1022728343 7:33000515-33000537 CTGGGGACACCTCCCACACATGG - Intronic
1022835877 7:34114205-34114227 CTGGGGACTCGGCCCCCACAGGG - Intronic
1023274558 7:38503825-38503847 ATGTGGACACAGACTAAACAAGG + Intronic
1023364212 7:39446856-39446878 CTGGGCTCACAGCTCAAAAAAGG + Intronic
1024042436 7:45565681-45565703 CTGTGGACACAGCCCAATGGAGG - Intergenic
1025045309 7:55687504-55687526 CTGGGGACACCTCCCACACATGG + Intergenic
1029664487 7:101986309-101986331 CTTGGGTCACAGCCCAAAAAAGG - Intronic
1029978723 7:104858423-104858445 CTGGAGAAAGACCCCAAACATGG + Intronic
1030513080 7:110508875-110508897 GTGGGGACACAGCCAAGCCATGG + Intergenic
1031564293 7:123276156-123276178 CTGGAGACAGTGTCCAAACACGG - Intergenic
1032459018 7:132095616-132095638 ATGGGGAAACAGCCAAAACATGG - Intergenic
1032784414 7:135188916-135188938 CTGGGGACAGAGCCCAACCTGGG + Intronic
1033243819 7:139702383-139702405 CTTGGGCCACAGCCCAGTCACGG + Intronic
1034356288 7:150453010-150453032 CTGGGGACACAGAACAAAACAGG + Intronic
1034432060 7:151045996-151046018 CAAGGGACACAGGCCTAACAGGG + Intronic
1034481096 7:151320918-151320940 CTGGGTCCACAGCCCCAACTTGG - Intergenic
1034491819 7:151396845-151396867 CTGAGGTCACAGCCTCAACAGGG + Intronic
1034980387 7:155472128-155472150 GGGGTGACACAGCCCAAAGAGGG - Intergenic
1035351363 7:158248366-158248388 GTGGGGACACAGCCCTCCCAAGG + Intronic
1035967915 8:4215142-4215164 GAGGGGACGCATCCCAAACAGGG + Intronic
1038425636 8:27462234-27462256 TTGGGCTCACAGCCCAGACAAGG + Intronic
1042566505 8:70117235-70117257 CTGGTGACCCAGACCAATCAAGG - Intronic
1042859649 8:73299285-73299307 CTGGGGACCCAGCCACAGCAAGG - Intronic
1043939955 8:86186239-86186261 ATAGGGAGACAGGCCAAACACGG + Intergenic
1045591237 8:103600690-103600712 ATGGTTACACAGCCAAAACAAGG - Intronic
1049420008 8:142512242-142512264 CTGAGGGGACAGCCCAAGCAGGG - Intronic
1049697862 8:143992386-143992408 CTGCGGCCACAGCCCAGCCACGG - Intronic
1049985937 9:951351-951373 CTGGAAACACAGACCAGACATGG + Intronic
1050561324 9:6836892-6836914 CTGTGAACACATCCCATACATGG + Intronic
1053024685 9:34719918-34719940 ATGGGGGCCCAGCCCATACATGG - Intergenic
1053142656 9:35690901-35690923 ATGGGGAAACATCCCAAAAAAGG - Exonic
1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG + Intronic
1055770369 9:79710509-79710531 CTGGGGAGGCAGCACATACACGG - Intronic
1055772956 9:79736877-79736899 CTGGTGACACAGCTCAATCCTGG - Intergenic
1056789744 9:89617812-89617834 CTGGGGACTCAGCCGAAAGCAGG - Intergenic
1056855734 9:90128137-90128159 CTGGTGACACAGGCCATACCCGG - Intergenic
1057278141 9:93687083-93687105 CTGGGTGCTCAGCCCAAACTCGG + Intergenic
1057521512 9:95764137-95764159 CCATGGACACAGCCCAAACCTGG - Intergenic
1057718227 9:97512409-97512431 CTGGGTACACACCCAAAAGAAGG + Intronic
1060279522 9:122206538-122206560 TTGGGGACACAGCCCAGCAAGGG + Intronic
1060542363 9:124439599-124439621 CTGGAGGAACAGCCGAAACATGG + Intergenic
1060789655 9:126477505-126477527 CTGGGGACACCTCACAATCATGG + Intronic
1060880387 9:127113884-127113906 GTGGTGCCACAGCCCAAGCAAGG + Intronic
1060961410 9:127683394-127683416 CTGAGGACAGAGCCCAGCCAGGG - Intronic
1061212606 9:129202590-129202612 CTGAGCACACAGCCCAGGCAGGG - Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1062085468 9:134645853-134645875 CTGGGGGCCCAGTCCAAACAGGG + Intronic
1203740599 Un_GL000216v2:174129-174151 CTGTGGGCACAGCCTAGACAAGG + Intergenic
1186421881 X:9433095-9433117 ATGGGGACACAGCCCAAGGATGG - Intergenic
1187038127 X:15564138-15564160 CTGGGGATACAGCCAACACTTGG - Exonic
1188785213 X:34337103-34337125 CTGGGGAGACTGCACAATCATGG + Intergenic
1189256289 X:39642327-39642349 CTGGGGCCAGAGGCCAAACTTGG + Intergenic
1190152634 X:47960630-47960652 ATGGGGCCACTGCCCAAAAAGGG + Intronic
1190779561 X:53580259-53580281 CTGGATCCACAGCCCAACCAAGG + Intronic
1191594319 X:62924991-62925013 CTGGGGAGACATCCAAATCATGG - Intergenic
1193460153 X:81781409-81781431 CTGGGGAGACCTCACAAACATGG + Intergenic
1193460646 X:81787479-81787501 CTGGGGAAACATCACAATCATGG + Intergenic
1193533057 X:82679439-82679461 CTGAGGACACAGCAAAAAGATGG + Intergenic
1193810844 X:86048791-86048813 GTAGGGAAACAGCCCACACACGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196664677 X:118304155-118304177 CTGGGGACACATCACAATCATGG + Intergenic
1197155657 X:123267224-123267246 CTGAGGACACAGCCTACTCAAGG - Intronic
1199458835 X:148060304-148060326 CTGGGGAGACCGCACAATCATGG + Intergenic
1201178595 Y:11324757-11324779 CTGTAGACAGAGCCTAAACAAGG + Intergenic