ID: 946147068

View in Genome Browser
Species Human (GRCh38)
Location 2:217739053-217739075
Sequence AACCATTTATTGGTGGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946147068_946147073 1 Left 946147068 2:217739053-217739075 CCATTGGCCACCAATAAATGGTT 0: 1
1: 0
2: 1
3: 7
4: 124
Right 946147073 2:217739077-217739099 AGTATGCTGGGTAAGAGCACAGG 0: 1
1: 0
2: 3
3: 31
4: 237
946147068_946147074 24 Left 946147068 2:217739053-217739075 CCATTGGCCACCAATAAATGGTT 0: 1
1: 0
2: 1
3: 7
4: 124
Right 946147074 2:217739100-217739122 CTTTGAAGCCAGACAAATCTAGG 0: 1
1: 2
2: 31
3: 138
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946147068 Original CRISPR AACCATTTATTGGTGGCCAA TGG (reversed) Intronic
907379751 1:54076613-54076635 AACCATTTAATGGTAGCTATAGG + Intronic
907835510 1:58104860-58104882 ACCCATTTCTTGGTGTCGAATGG + Intronic
907931841 1:59008029-59008051 AAGCATGTGTTGGTTGCCAAGGG + Intergenic
909785398 1:79605287-79605309 AACCATCTAATGGTGGACATTGG + Intergenic
911924349 1:103809292-103809314 AACAAATTAGTGGTTGCCAATGG + Intergenic
916464529 1:165061025-165061047 AAGCATTTATGGGTGGCAAGGGG + Intergenic
924291989 1:242546053-242546075 CACCCTTCATTGGTGGGCAATGG - Intergenic
1066357354 10:34697947-34697969 AACCATTTACTGATGGTAAATGG + Intronic
1066434580 10:35385330-35385352 AATCCTTTATTGCTGGCAAACGG - Intronic
1071241894 10:83716231-83716253 AACAATTTATTGGTTGCTATGGG + Intergenic
1071787133 10:88913837-88913859 AAACATTTATTGCTGAGCAAAGG - Intronic
1074143287 10:110695798-110695820 ATCCATTTTCTGGTGACCAAGGG + Intronic
1076436680 10:130451005-130451027 AAGCATTGTTTGGTGGGCAATGG - Intergenic
1076822844 10:132949373-132949395 AACCAAATATGAGTGGCCAATGG + Intergenic
1086651494 11:89296372-89296394 AACCACTTATTATTGTCCAAAGG - Intergenic
1087858180 11:103119159-103119181 AACATTTCATTGGTTGCCAATGG - Intronic
1088672936 11:112161390-112161412 AACCATTGATATGTGGCAAACGG + Intronic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1089588598 11:119525598-119525620 TACAATTTATAGGAGGCCAATGG - Intergenic
1089942686 11:122435986-122436008 AATCATTTATTGGTGGGGGAAGG - Intergenic
1093497325 12:19773226-19773248 AACAAATTATTAGTGGCCTAAGG + Intergenic
1093784088 12:23172745-23172767 AACTATTGATTTGTGGGCAATGG - Intergenic
1097633282 12:62090553-62090575 AACGATTTCTTGATTGCCAAAGG - Intronic
1102997738 12:117362675-117362697 AAGCATTTATTAGTGACAAAGGG - Intronic
1108803279 13:54126550-54126572 AACCATTTAATGGTGCCCTGTGG + Intergenic
1109140134 13:58704305-58704327 AACCTTCTATTTGTGGCCAAAGG - Intergenic
1111469798 13:88664377-88664399 AACCAAATATTGGTGGCCAATGG + Intergenic
1119228619 14:72962812-72962834 TTCAGTTTATTGGTGGCCAAGGG + Intergenic
1120745058 14:88145141-88145163 AATCCTATATTGTTGGCCAAAGG - Intergenic
1126311793 15:47325639-47325661 AGGAATGTATTGGTGGCCAAGGG - Intronic
1126477881 15:49085476-49085498 AAACATGTATTGTTGGCTAAAGG + Intergenic
1127304612 15:57692626-57692648 AAACATTCATTTGTGCCCAAGGG + Intronic
1128882097 15:71253217-71253239 AATGACTTATTGGTGACCAAGGG + Intronic
1131864776 15:96696009-96696031 AACCATTTATTTGTGGAGATGGG - Intergenic
1135802481 16:25510825-25510847 AAGAATATATTTGTGGCCAAAGG - Intergenic
1136993178 16:35169617-35169639 AAATATTTATTGGGGGCCATCGG - Intergenic
1138961179 16:62032083-62032105 AACAATTTTTTGATGGACAAAGG - Intronic
1141015938 16:80449397-80449419 AACCCATTGTTGGTGGGCAAAGG - Intergenic
1144155544 17:12497009-12497031 AGCCAATTATTGGTTGCCAGTGG - Intergenic
1146401336 17:32502376-32502398 AACCAGTTAGTGGCTGCCAAGGG + Intronic
1147205404 17:38833928-38833950 TTCAGTTTATTGGTGGCCAAGGG - Intergenic
1147767375 17:42845845-42845867 ATCCATATATTAGTGGGCAAAGG + Exonic
1149852618 17:60048906-60048928 AAGCATTTATTGGGTGCCTAAGG + Intronic
1152302741 17:79504953-79504975 AACCATTTTCTTGTGGCAAATGG - Intronic
1156534245 18:37847566-37847588 AACCGTTTATTGGTCCACAATGG + Intergenic
1158804725 18:60957040-60957062 AACCATTTAATTCTGGCCAGAGG + Intergenic
1168721240 19:58556015-58556037 AAATATTTATTGGGGGCCATGGG - Exonic
926045744 2:9708384-9708406 AAACATTTATTAGTGCCCACTGG - Intergenic
927000242 2:18787388-18787410 AGCTATTTAATGGTGGCAAAAGG - Intergenic
927428281 2:23005221-23005243 AACCATTTTTTTCTGGGCAAGGG + Intergenic
933232732 2:79827700-79827722 AACCATATATTTGTGCCCAATGG - Intronic
933290438 2:80432554-80432576 AACTATATTTTGGTGGCCACCGG - Intronic
933738537 2:85514787-85514809 CACCATATCTTGGTAGCCAATGG - Intergenic
933863953 2:86499304-86499326 AACCATTTATTCATTTCCAAGGG - Intergenic
935109384 2:100077909-100077931 ACCCATTAACTGGTGTCCAAGGG - Intronic
939934789 2:148278064-148278086 AACAAATCATTGGTTGCCAAGGG - Intronic
940050907 2:149463838-149463860 TACCATTTAGTGGTTGCCAAGGG + Intronic
941435590 2:165467250-165467272 AAGCATTCATTGATGGACAAGGG - Intergenic
942447914 2:176090766-176090788 AAGCATTTCATGGTGGCCCATGG + Intergenic
944746402 2:202660991-202661013 AACACTTTCTTTGTGGCCAATGG - Intronic
946147068 2:217739053-217739075 AACCATTTATTGGTGGCCAATGG - Intronic
947510946 2:230753770-230753792 AACCATTTTTTAATGGACAAGGG + Intronic
948054139 2:234998732-234998754 AACCAATTAGTGGTAGCCAGAGG - Intronic
1168909254 20:1433562-1433584 AAGGATTTATGGGTGGCAAATGG + Intergenic
1169580033 20:7011269-7011291 CACTGTTTATTGTTGGCCAAAGG - Intergenic
1169602003 20:7272132-7272154 TACCTTTTATTGCTGACCAAAGG - Intergenic
1170891598 20:20380785-20380807 CACCATTTTTGGGTGGCCATGGG + Intergenic
1173214283 20:41065831-41065853 AAACATGTATTTGTAGCCAAAGG - Intronic
1175099230 20:56566583-56566605 AAGAATTTATTGCTTGCCAAGGG + Intergenic
951139606 3:19146231-19146253 AAACACTTCTTGGTGGGCAAAGG + Intergenic
952854283 3:37755080-37755102 TACCATTTATTGCTGTCCCAAGG + Intronic
955380499 3:58434182-58434204 AAGCACTTCTTGGTGCCCAAAGG - Intergenic
957558217 3:81787302-81787324 AACCTTATATTGGTTGACAAAGG - Intergenic
960704313 3:120467488-120467510 AACCTTTTATTGATGGCTTAAGG - Intergenic
960951872 3:123004450-123004472 AACCTTTTCTTGGTGTCCCAAGG - Intronic
962327630 3:134449207-134449229 AAATATTTATTGATGTCCAATGG - Intergenic
963738371 3:149048081-149048103 AACCATTTATTGATAGAGAATGG - Exonic
970393742 4:15643784-15643806 ATCCAGTTAATGGTGACCAAAGG - Intronic
971797999 4:31253711-31253733 AACCATTTATTATTGCTCAAGGG + Intergenic
973942135 4:55921937-55921959 AAACATTTATTGATGGCTTATGG + Intergenic
974120210 4:57628906-57628928 AAACATTTATTTGTGGAGAAAGG + Intergenic
977411094 4:96665162-96665184 AAACATTTAGTGTTGGCTAATGG + Intergenic
977428057 4:96894241-96894263 AACTAGTTATTGGAGGCTAATGG + Intergenic
980200003 4:129644155-129644177 AAGAATTTATTGGTGGAGAATGG - Intergenic
981072501 4:140558596-140558618 TACCAGTTATTGGTGGTTAAGGG + Intergenic
983508703 4:168584854-168584876 AAACATTTATTCTAGGCCAATGG + Intronic
983662456 4:170143666-170143688 AGCCATTTAAATGTGGCCAAGGG + Intergenic
984417005 4:179474495-179474517 AACAATTTGGTGGTTGCCAAGGG + Intergenic
987203808 5:15604292-15604314 AACTTTTTATTGGTGGAGAAGGG - Intronic
987697261 5:21348437-21348459 AACCATTTCTTGGTAGCTAGTGG + Intergenic
991080975 5:62598912-62598934 AACAATTTATTGGAGGCCAGAGG + Intronic
993561341 5:89414522-89414544 AACCAATCATTAGTAGCCAAAGG - Intergenic
995027428 5:107439967-107439989 ACACATTTATTGGTGGCCTGTGG + Intronic
996222598 5:120951766-120951788 ACCCATTAAAAGGTGGCCAAAGG - Intergenic
997708812 5:135985453-135985475 AAACATTTATTGGTAGCTATAGG - Intergenic
998919687 5:147054442-147054464 AAAAATTTATTGGTGGCAAAAGG - Intronic
1004532763 6:16469092-16469114 AAGCATTTATTGGGTGCCCACGG - Intronic
1005153402 6:22777815-22777837 AACCAGCTACTGGTGGCAAATGG + Intergenic
1009913083 6:69957988-69958010 GACCATTTAATGCTGGCCACAGG + Intronic
1012178994 6:96127039-96127061 AAACATTTATTGGAGGTCCAGGG + Intronic
1012432486 6:99179154-99179176 AACCAAATATGAGTGGCCAATGG - Intergenic
1017046508 6:150351795-150351817 ATCCAATTATTGGTCACCAAGGG - Intergenic
1021329913 7:19323877-19323899 GAAAATTTATTGGTGGCTAAAGG + Intergenic
1024830165 7:53443717-53443739 AACAAATTAGTGGTGTCCAAGGG - Intergenic
1028004850 7:85552175-85552197 CACCATTTAAAAGTGGCCAAAGG + Intergenic
1031609734 7:123810841-123810863 AAAAATTTAGTGGTTGCCAAGGG - Intergenic
1032485860 7:132286983-132287005 AACCACTGCTTGGTGGCTAAAGG - Intronic
1032732563 7:134657938-134657960 TACCATTTATCTGTGGCCTAGGG + Intronic
1033966866 7:146985827-146985849 AACAATTGATAGTTGGCCAATGG - Intronic
1040782488 8:51126055-51126077 TTCCATTTAGTGGTTGCCAAAGG - Intergenic
1040849895 8:51888829-51888851 AACCATTTCTTAGTGGCTGAGGG + Intronic
1041059929 8:54025335-54025357 AGCCAATTAGTGGTTGCCAAGGG - Intergenic
1041325928 8:56664392-56664414 ATCCATTTGTTGGTCGACAAAGG - Intergenic
1041425316 8:57714151-57714173 CACCATTTATTGATGGGGAAAGG - Intergenic
1043262113 8:78214854-78214876 AACCATTTGGTGGTGGTAAAAGG + Intergenic
1045347385 8:101305201-101305223 AACCATAGATTCTTGGCCAAGGG + Intergenic
1046840543 8:118851482-118851504 ACCAAATTATTGGTTGCCAAAGG + Intergenic
1046993353 8:120486642-120486664 AACCCTTTATTGGAAGCCGAGGG + Intronic
1048175001 8:132143797-132143819 AAACCTTTATTTGTGGCCCAGGG - Intronic
1048976696 8:139677161-139677183 AACCTTTAATTGGTGGCCACAGG - Intronic
1050164713 9:2752666-2752688 AACCATGTATTTGTGTCCAATGG + Intronic
1050881057 9:10701187-10701209 ATCCATTTACTGTTTGCCAAAGG - Intergenic
1058624936 9:106925176-106925198 AACAAATTATTGGAGACCAAGGG + Exonic
1059077149 9:111205534-111205556 AACCATTAAAAGGTGGGCAAAGG + Intergenic
1059388266 9:113982188-113982210 CACCATGTATTGGTTGCCTATGG + Intronic
1060331905 9:122679848-122679870 AACCACTTCTTGATGGCAAATGG - Intergenic
1186138421 X:6545085-6545107 AAACATTTATTGGTTCCCCATGG - Intergenic
1190023745 X:46903558-46903580 AACCTGTTCTTTGTGGCCAAAGG + Intergenic
1193744049 X:85253806-85253828 AACAGATTATTGGTTGCCAAGGG - Intronic
1201794602 Y:17881489-17881511 AACCATATAGTGGTCACCAATGG - Intergenic
1201806953 Y:18024496-18024518 AACCATATAGTGGTCACCAATGG + Intergenic
1202355976 Y:24049269-24049291 AACCATATAGTGGTCACCAATGG - Intergenic
1202514802 Y:25620840-25620862 AACCATATAGTGGTCACCAATGG + Intergenic