ID: 946151138

View in Genome Browser
Species Human (GRCh38)
Location 2:217771855-217771877
Sequence ATATAGAAACTAGAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946151134_946151138 6 Left 946151134 2:217771826-217771848 CCATGAGCTACAAAATATCAGTT No data
Right 946151138 2:217771855-217771877 ATATAGAAACTAGAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946151138 Original CRISPR ATATAGAAACTAGAGAGGGA AGG Intergenic
No off target data available for this crispr