ID: 946151281

View in Genome Browser
Species Human (GRCh38)
Location 2:217773152-217773174
Sequence CTCAGGAAACTTACAAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946151281_946151290 11 Left 946151281 2:217773152-217773174 CCACCATTTGTAAGTTTCCTGAG No data
Right 946151290 2:217773186-217773208 CATGCTTTCTGTACAGCCTGTGG 0: 56
1: 644
2: 1045
3: 1122
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946151281 Original CRISPR CTCAGGAAACTTACAAATGG TGG (reversed) Intergenic
No off target data available for this crispr