ID: 946153418

View in Genome Browser
Species Human (GRCh38)
Location 2:217791293-217791315
Sequence CTGGAGAAAGAGAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946153418_946153428 29 Left 946153418 2:217791293-217791315 CCTTTCTCATTCTCTTTCTCCAG No data
Right 946153428 2:217791345-217791367 TTGAGTCACGAACTCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946153418 Original CRISPR CTGGAGAAAGAGAATGAGAA AGG (reversed) Intergenic
No off target data available for this crispr