ID: 946153804

View in Genome Browser
Species Human (GRCh38)
Location 2:217793918-217793940
Sequence CCTGACTCCCAGATCGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946153804_946153809 -1 Left 946153804 2:217793918-217793940 CCAGAACCGATCTGGGAGTCAGG No data
Right 946153809 2:217793940-217793962 GAAATGGAGCAGAGGTTAAGAGG No data
946153804_946153813 16 Left 946153804 2:217793918-217793940 CCAGAACCGATCTGGGAGTCAGG No data
Right 946153813 2:217793957-217793979 AAGAGGAGGGGCCCAGAAGATGG No data
946153804_946153808 -9 Left 946153804 2:217793918-217793940 CCAGAACCGATCTGGGAGTCAGG No data
Right 946153808 2:217793932-217793954 GGAGTCAGGAAATGGAGCAGAGG No data
946153804_946153812 4 Left 946153804 2:217793918-217793940 CCAGAACCGATCTGGGAGTCAGG No data
Right 946153812 2:217793945-217793967 GGAGCAGAGGTTAAGAGGAGGGG No data
946153804_946153811 3 Left 946153804 2:217793918-217793940 CCAGAACCGATCTGGGAGTCAGG No data
Right 946153811 2:217793944-217793966 TGGAGCAGAGGTTAAGAGGAGGG No data
946153804_946153810 2 Left 946153804 2:217793918-217793940 CCAGAACCGATCTGGGAGTCAGG No data
Right 946153810 2:217793943-217793965 ATGGAGCAGAGGTTAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946153804 Original CRISPR CCTGACTCCCAGATCGGTTC TGG (reversed) Intergenic
No off target data available for this crispr