ID: 946154986

View in Genome Browser
Species Human (GRCh38)
Location 2:217801377-217801399
Sequence CTGGGTGTCTGGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 0, 2: 2, 3: 83, 4: 606}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946154986_946154999 16 Left 946154986 2:217801377-217801399 CCCTCTTCCCTCCAGACACCCAG 0: 1
1: 0
2: 2
3: 83
4: 606
Right 946154999 2:217801416-217801438 AGCACGGGACTGAACCTGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 63
946154986_946154996 0 Left 946154986 2:217801377-217801399 CCCTCTTCCCTCCAGACACCCAG 0: 1
1: 0
2: 2
3: 83
4: 606
Right 946154996 2:217801400-217801422 CTGGACAGCTGGTGGCAGCACGG 0: 1
1: 0
2: 1
3: 33
4: 336
946154986_946154997 1 Left 946154986 2:217801377-217801399 CCCTCTTCCCTCCAGACACCCAG 0: 1
1: 0
2: 2
3: 83
4: 606
Right 946154997 2:217801401-217801423 TGGACAGCTGGTGGCAGCACGGG 0: 1
1: 0
2: 5
3: 39
4: 288
946154986_946154998 15 Left 946154986 2:217801377-217801399 CCCTCTTCCCTCCAGACACCCAG 0: 1
1: 0
2: 2
3: 83
4: 606
Right 946154998 2:217801415-217801437 CAGCACGGGACTGAACCTGCTGG 0: 1
1: 0
2: 2
3: 12
4: 113
946154986_946154993 -8 Left 946154986 2:217801377-217801399 CCCTCTTCCCTCCAGACACCCAG 0: 1
1: 0
2: 2
3: 83
4: 606
Right 946154993 2:217801392-217801414 ACACCCAGCTGGACAGCTGGTGG 0: 1
1: 0
2: 2
3: 18
4: 212
946154986_946155000 17 Left 946154986 2:217801377-217801399 CCCTCTTCCCTCCAGACACCCAG 0: 1
1: 0
2: 2
3: 83
4: 606
Right 946155000 2:217801417-217801439 GCACGGGACTGAACCTGCTGGGG 0: 1
1: 0
2: 2
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946154986 Original CRISPR CTGGGTGTCTGGAGGGAAGA GGG (reversed) Exonic
900012846 1:131538-131560 CTGGGTGTCAGGAGACATGATGG - Intergenic
900042911 1:487525-487547 CTGGGTGTCAGGAGACATGATGG - Intergenic
900064348 1:722522-722544 CTGGGTGTCAGGAGACATGATGG - Intergenic
900160855 1:1222790-1222812 GTGGCTGTCAGGAGGGAAGTGGG - Intronic
900326641 1:2111455-2111477 CTGGGTGTCTCCAGAGAAGCTGG + Intronic
900416051 1:2535153-2535175 CTGGGGGGCTGGGGGCAAGAGGG + Intergenic
900509540 1:3051982-3052004 GTGGGTGAGTGGATGGAAGATGG - Intergenic
900740925 1:4330279-4330301 CTGGGTCTAGGGAGGGAAAAAGG + Intergenic
900763768 1:4489706-4489728 CTGGGTGGCTGGAAGGCAGGGGG + Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901573323 1:10179719-10179741 CTGGATGTCTGCAGGGAAAAAGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
902545345 1:17186317-17186339 CTGGGTGTCTGGGAGAAAGGAGG + Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
904128374 1:28258714-28258736 GAGAGTGTCTGGAGGGAAGAGGG + Intergenic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904616153 1:31751012-31751034 CTGGGCGTCTTGGGGGAAGCAGG - Intronic
904621073 1:31775672-31775694 TTGGGTGTTGAGAGGGAAGATGG - Intergenic
904678380 1:32212373-32212395 CTGGGTGCCTAGAGGCCAGAGGG + Intronic
904764400 1:32832524-32832546 CTGGGTTCCTGGAAGGCAGAAGG - Intronic
904801951 1:33099283-33099305 CTGGGTACCTGGAGGAAGGAGGG - Intronic
904832912 1:33316726-33316748 CTGGTTGTCTGGTTGGAGGAAGG + Intronic
905527263 1:38648504-38648526 GTGAGTGTCTGGAGTGCAGATGG - Intergenic
905649004 1:39644205-39644227 CTGGGTGACTGAATGGATGAAGG + Intergenic
906299264 1:44670333-44670355 GTGAGTGGCTGGAGGGAACAGGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906683636 1:47748460-47748482 CTGGGAGGCTGGAGAGATGAGGG + Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908775042 1:67631700-67631722 CTGGGCGTGTAGAGGGAAGCTGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912594585 1:110861349-110861371 GTGGTTGTTTGGAGGTAAGAAGG - Intergenic
912840143 1:113032294-113032316 CTGGCTGTCTTAAGGGAAAAGGG - Intergenic
913367212 1:118052992-118053014 AAGGGTGTCTGGTGGGAGGAGGG - Intronic
914703815 1:150155599-150155621 CGGGGTGTCTGGAGGGAACGAGG - Intronic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
915515337 1:156409413-156409435 CTGGGTCTCTGGTTGGATGATGG + Intronic
915564811 1:156707388-156707410 CTGGGCTTCTGCAAGGAAGAGGG + Intergenic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915943753 1:160135419-160135441 ATGGCTCCCTGGAGGGAAGACGG - Exonic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916446926 1:164881150-164881172 CCGGGAGTCTGGAGAGAAGTGGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
918139103 1:181705231-181705253 ATGTGTGCCTGGAGGGATGAGGG - Intronic
920190323 1:204189722-204189744 CTGGCTCCCTGGAGGGAAGGGGG + Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920983615 1:210862902-210862924 CAGGGAATCTGTAGGGAAGAAGG - Intronic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
922099247 1:222468534-222468556 CTGGGTGTCAGGAGACATGATGG - Intergenic
922222398 1:223618609-223618631 CTGGGTGTGGGGAGGGGAGTGGG + Intronic
922261285 1:223948028-223948050 CTGGGTGTCAGGAGACATGATGG - Intergenic
922339126 1:224641412-224641434 CTGGGTGCCTGGGATGAAGAGGG - Intronic
922735787 1:227977712-227977734 CTGGGTGTCAGGAGACATGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923855423 1:237839976-237839998 GTGGTTGTCTGGAAGAAAGAAGG - Intergenic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
924342446 1:243050208-243050230 CTGGGTGTCAGGAGACATGATGG - Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1065738068 10:28771968-28771990 CTGGGCGGCTGCAGGGCAGAGGG - Intergenic
1066242208 10:33549222-33549244 CGGGATGTCTGGAGGTCAGATGG + Intergenic
1066734026 10:38455347-38455369 CTGGGTGTCAGGAGACATGATGG + Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067055486 10:43047463-43047485 CTGGGTGTTTGGTGGGCACATGG - Intergenic
1067077476 10:43196434-43196456 ATGGGAGTCTGTAAGGAAGAGGG - Intronic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067786586 10:49254737-49254759 CTGGGTGGGAGGAAGGAAGAGGG + Intergenic
1068665817 10:59674848-59674870 CTGGGAGTGTGGGGGCAAGATGG + Intronic
1069242913 10:66164541-66164563 CTATGTGTCTGAGGGGAAGAGGG - Intronic
1069707155 10:70466030-70466052 CGGGGAGGCTGGAGGGGAGAGGG + Intergenic
1069855906 10:71440876-71440898 CTGGCTCCCTGGAGGGGAGAAGG - Intronic
1070749983 10:78958384-78958406 CTGGGTGTTTGGGGGAATGAAGG - Intergenic
1072273606 10:93801266-93801288 CTGAGTGTCAGGATGGAAGATGG - Intergenic
1072414593 10:95236682-95236704 CTCAGTGTCTGGAGGGATGGGGG + Intergenic
1073214090 10:101827105-101827127 CTGGGTGTCAGGCAGGAAGGGGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1074094532 10:110298651-110298673 ATGGCAGTCTGGAGTGAAGATGG - Exonic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1076142334 10:128089587-128089609 CTTGGTGTCTGGAGAGGAGGAGG - Intergenic
1076969184 11:123742-123764 CTGGGTGTCAGGAGACATGATGG - Intergenic
1077332813 11:1990790-1990812 CTGGCTGCCTGGCTGGAAGATGG - Intergenic
1077610192 11:3639217-3639239 CTGGGTCTTGGGTGGGAAGAGGG - Intronic
1077745838 11:4904088-4904110 CTTGATGTCTGGAAGGAAAATGG + Intronic
1078465335 11:11546055-11546077 CTGAGTGGCTGGGGAGAAGAGGG - Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1079031717 11:16991138-16991160 CTGGGAGTCTCGGGGGCAGAGGG - Intronic
1079437925 11:20476488-20476510 CTGGGTTTCTGGAGGAAAAATGG + Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1083243162 11:61404577-61404599 CTGGGTGTCTGGAGGGAGTTAGG + Exonic
1083314553 11:61806393-61806415 CTGGGTGTTTGGGGTGTAGAGGG - Intronic
1083380610 11:62265312-62265334 CTGGGGGTCAGGTAGGAAGAAGG - Intergenic
1083486018 11:62983496-62983518 CTGGGTGGCCGGAGGGGAGTGGG + Intronic
1083698009 11:64455546-64455568 CGGGGTGTCTGTAGTGGAGAGGG + Intergenic
1083705564 11:64511966-64511988 CTGGGTGGCAGGTGGGGAGAAGG + Intergenic
1083736776 11:64686009-64686031 CTGCGTTGCTGGAGGGGAGAGGG - Intronic
1083805919 11:65073886-65073908 ATGGGTGTGAGGAGGGATGAAGG - Intronic
1083853006 11:65378807-65378829 AGGGGTGGATGGAGGGAAGAGGG - Intronic
1083950195 11:65950318-65950340 CTGGGTTTGTGGGGAGAAGAAGG - Intronic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1084482028 11:69427560-69427582 CTGGGTGTCAGGCAGGAAAAGGG - Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1085022545 11:73218439-73218461 TGGGGCGTCTGGAGGGAACAAGG + Intronic
1085278362 11:75314269-75314291 CTGGGAGGCTGGAGTCAAGAGGG + Intronic
1085309728 11:75509080-75509102 CTGGGTGGCTGGTGGGCATAGGG - Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087007969 11:93487434-93487456 GTGGGTGTATGGAGGGGAGGAGG + Intronic
1088806419 11:113357477-113357499 ATGGTTGTTTGGAGGAAAGAAGG + Intronic
1089556719 11:119319293-119319315 CTGGGTCCCTGCAGGGTAGACGG - Intronic
1202815796 11_KI270721v1_random:45966-45988 CTGGCTGCCTGGCTGGAAGATGG - Intergenic
1091799098 12:3313572-3313594 CAGGGTGTCAGGAGGGGTGAGGG + Intergenic
1091823016 12:3490773-3490795 GTGGGTGTCTGGATGGGGGAGGG - Intronic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1091991743 12:4961156-4961178 CTGCCTGTCTGGAGGCAAGGTGG - Intergenic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092895072 12:13002518-13002540 CTGGCTGTCAGGAGGAAAAAGGG - Intergenic
1092913718 12:13171164-13171186 GTGGGTGGGTGGGGGGAAGAGGG + Intergenic
1092954543 12:13537700-13537722 CTGGGTGGCTGGAGGGGTTAGGG - Exonic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094592508 12:31834915-31834937 CTGGGTATCTGGATGAAATAAGG + Intergenic
1094734705 12:33222103-33222125 GTGGTTGTTTGGAGGAAAGAAGG + Intergenic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096364587 12:51017863-51017885 GTGGGTGCCTTGAGGGAACACGG - Intronic
1096693625 12:53335594-53335616 CTGGTTTCCTGGGGGGAAGAGGG + Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1096846825 12:54412012-54412034 ATTGGTGTCTGGAGGCAGGAAGG + Intronic
1097025856 12:56054965-56054987 ATGGGTGACTGGAGGGCAAATGG + Intergenic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097160951 12:57046428-57046450 CTGGGAGGCTCAAGGGAAGAGGG + Intronic
1097182578 12:57179732-57179754 TTGGGTGTCTGCAGGGCAGTGGG - Intronic
1097730563 12:63123653-63123675 CTGGGTGCCTGGATGGGAGCAGG - Intergenic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1099254613 12:80300393-80300415 CTGGGTGGCTGCAGAGAAGCAGG + Intronic
1101682488 12:106983314-106983336 ACTGGTGTCTGGAGGGAAGAGGG - Intronic
1101699011 12:107154143-107154165 CTGGGTATCTAGAGGGGAAAGGG - Intergenic
1101851219 12:108403953-108403975 CTGGGTGTATGCAGGGTGGAGGG - Intergenic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1103900576 12:124301719-124301741 CTGAGTGTCTGGGGGGAAGTGGG + Intronic
1104122014 12:125808715-125808737 CCTGGTGTCTGGAGGCAAGACGG + Intergenic
1104179073 12:126360698-126360720 GTGGGTGACTGGTGGGGAGAAGG + Intergenic
1104310322 12:127648997-127649019 CCTGGTGCCTGGAGGGGAGAGGG - Intergenic
1104323581 12:127774625-127774647 CCTGGCGTGTGGAGGGAAGACGG - Intergenic
1104612430 12:130240700-130240722 CCGGGTGAAGGGAGGGAAGAGGG + Intergenic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104913024 12:132249042-132249064 CTGGGTGTCTGGAAGGTGGCGGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1106553222 13:30789010-30789032 CTGGGTGGCAGCAGGGATGAGGG + Intergenic
1106563858 13:30869043-30869065 CTGGGTGACTGGGTGGATGAGGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108637305 13:52348357-52348379 CTGTGTTTCTGCAGGGATGAAGG - Intergenic
1108900469 13:55399348-55399370 CTGGGTGTCAGTATTGAAGAAGG - Intergenic
1110590530 13:77251875-77251897 CAGGGTGTTTGGAGAGCAGAGGG - Intronic
1112265573 13:97920359-97920381 CTGGGGGTCGGGGGAGAAGAGGG - Intergenic
1112998598 13:105604539-105604561 CTTGGTGTCTGGAGAGGAGAGGG + Intergenic
1113231826 13:108219792-108219814 ATGGGTGGCAGGAGGGAATAGGG + Intronic
1113377860 13:109782002-109782024 CTTGGCGTCTGGCGGGAAGGAGG - Intronic
1113578801 13:111413880-111413902 CTGGGTGTGTGGTGGGCATATGG + Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1113959877 13:114120323-114120345 CTGGCTGGCTGGAGAGAGGAGGG - Intronic
1114542275 14:23469936-23469958 CTGGGTGTCTGACGGAGAGAGGG + Intronic
1114674420 14:24430947-24430969 CTTGGTGCCTGGAGGGATGGGGG - Intronic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1117435972 14:55715582-55715604 TTGGACGTCTGGAGGGAAGTGGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118982601 14:70728859-70728881 CAGAGAGTCTTGAGGGAAGAGGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119521144 14:75286421-75286443 CAGAGTGCCTGTAGGGAAGAAGG - Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1121566117 14:94910445-94910467 CTGGGAGCCTGAAGGGGAGAGGG - Intergenic
1121604862 14:95233316-95233338 ATGGGTGGATGGAGGGATGATGG - Intronic
1122587329 14:102818013-102818035 CGGGGTGTCTGGAGGCAGTATGG + Intronic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122787130 14:104168939-104168961 CTGGGGGTCTGCGGGGAACAAGG + Intronic
1123131821 14:105993602-105993624 GTGGTTGTTTGGAGGAAAGAGGG + Intergenic
1123810034 15:23915572-23915594 CTGGGTGTCAACAGGGAAGTTGG - Intergenic
1124621772 15:31278104-31278126 CTGGCTGCCTGGAGGGATGGTGG + Intergenic
1124631847 15:31342393-31342415 CTGGGTCTCAGGAGGGAAGGCGG - Intronic
1124707014 15:31974609-31974631 CTGGGTGCTTGGAGAGGAGACGG + Intergenic
1128087964 15:64898691-64898713 CTGGGGATCTGGAGGGCAAATGG + Intronic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128543188 15:68551062-68551084 CTGACTCTCTGGGGGGAAGAGGG + Intergenic
1128617383 15:69120921-69120943 CTTATTATCTGGAGGGAAGATGG + Intergenic
1128793522 15:70449539-70449561 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
1128793748 15:70450360-70450382 ATGGGTGGATGGAGGGATGAAGG + Intergenic
1128968478 15:72085671-72085693 GTGGTTGTCTGGAGAAAAGAAGG + Intronic
1129872914 15:78952425-78952447 CAGGGTTTCTGGAGAGAAGAGGG - Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130379904 15:83362654-83362676 TGGGGTGACTGGAGGGCAGAGGG - Intergenic
1130895117 15:88164066-88164088 CTGGGTGTATGGGGTGAACAAGG + Intronic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1131841554 15:96442653-96442675 CTGGGTGTTAGGCGGGAAGAAGG - Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132146577 15:99433071-99433093 CTGGGCAGCTGGAGGGCAGAAGG - Intergenic
1132243196 15:100276228-100276250 GTGGGTGCCTGGTGGGAAGGTGG + Intronic
1132655886 16:1041501-1041523 CTGAGAGTCTCAAGGGAAGAAGG - Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133024002 16:2979933-2979955 CGGGCTGTCACGAGGGAAGAGGG + Intronic
1133328862 16:4958838-4958860 CAGGGTGTCTGGGAGGAAAATGG + Intronic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133983890 16:10653261-10653283 CTGGAACTCTGGTGGGAAGAGGG + Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134488442 16:14677779-14677801 GTGGGTGGATGGATGGAAGATGG + Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135548107 16:23379104-23379126 CTGGGTGTGTGGGTGGATGATGG - Intronic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136593020 16:31229074-31229096 CATGGTGTCTGGAGGGATGGTGG + Intergenic
1136618988 16:31415516-31415538 CTGGGTGTGTGGATGGAGGTGGG - Intronic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1137513776 16:49124823-49124845 CTAGGTGAATTGAGGGAAGAGGG - Intergenic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1138249934 16:55494078-55494100 CTGGCTGGCTGGATGGATGATGG - Intronic
1138782683 16:59808137-59808159 ATGGGTGTCTGCAGGGATGTTGG - Intergenic
1141025229 16:80540807-80540829 GTGGGTCCCGGGAGGGAAGAGGG - Intronic
1141421570 16:83921172-83921194 ATGGGTGGATGGAAGGAAGATGG + Exonic
1141421640 16:83921462-83921484 CAGGGTATATGGAAGGAAGATGG + Exonic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142451491 16:90175380-90175402 CTGGGTGTCAGGAGACATGATGG + Intergenic
1142621300 17:1167213-1167235 CTGGGTGTTAGGAGGGCAGAAGG - Intronic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143301459 17:5913692-5913714 ATGGGTGGATGGATGGAAGATGG - Intronic
1143383724 17:6512399-6512421 CTCAGTGACTGAAGGGAAGAGGG + Intronic
1143771490 17:9171795-9171817 CTTGGTGTCTGGAGAGGAGTTGG + Intronic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144699124 17:17325311-17325333 CTGAGTGTCTGGAGCTCAGAGGG - Intronic
1145178329 17:20721507-20721529 CTGGCTGGCTGGAGGGAGGGCGG + Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1146196007 17:30813748-30813770 CTGGGTGTGGGGAGGGGGGAGGG - Intronic
1146261945 17:31427701-31427723 ATGGGAGGCTGGAGGGTAGAGGG + Intronic
1146297657 17:31662205-31662227 CTGAGTGTCTGGAGCTCAGATGG + Intergenic
1146565649 17:33910735-33910757 CTGCCTCTCTGGAGGGAAGTAGG + Intronic
1146974096 17:37096317-37096339 CTGGGTGCCTGGTAGGAAGAAGG - Intronic
1147308281 17:39578562-39578584 CTGGGTCTCTGCAGGGACCATGG - Intergenic
1147444236 17:40465101-40465123 CTGGGTGGCTGCAGGGCTGAAGG + Intergenic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1148050944 17:44769695-44769717 CTGGGTGGGGGGAGGGCAGAGGG - Intronic
1148105181 17:45115056-45115078 CTGGGTGTCTGGGGGCGAGAGGG - Intronic
1148177469 17:45579779-45579801 CGGGGTGTCAGGAGTGAAAAAGG + Intergenic
1148346110 17:46904498-46904520 ATGGGTGGCTGGACGGATGATGG + Intergenic
1148627204 17:49078776-49078798 CTGGGAGGCTAGAGGTAAGATGG - Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148871672 17:50662118-50662140 CAGGGTGGCTGGATGGAAGTGGG + Intronic
1148895092 17:50834964-50834986 CTCGGTGTGTCGATGGAAGAGGG + Intronic
1149938677 17:60838412-60838434 GTGGGTGTGGGGAGTGAAGAGGG + Intronic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150212194 17:63447286-63447308 CTCGGTGCCTGGAGGGCAGGTGG - Intergenic
1150220675 17:63494126-63494148 CTGGGTGTCTGGATGGGCCAGGG + Intronic
1150321325 17:64216868-64216890 CTGGGTGTCAGGTGGCCAGATGG + Intronic
1150593720 17:66585258-66585280 CTGGTTGACAGAAGGGAAGATGG + Intronic
1151104188 17:71593292-71593314 GTGTGTGTGTGGAGGGAATAGGG + Intergenic
1151201016 17:72468082-72468104 GTGCGTGTCTGGAGGGCGGAGGG - Intergenic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1151920388 17:77150382-77150404 CAGGGTATCTGGAAGGGAGAGGG - Intronic
1152271596 17:79328177-79328199 CTGTGTGTCTGGAACGGAGATGG + Intronic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1152473753 17:80504248-80504270 ATGGGTGGATGGAGGGATGATGG + Intergenic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152595282 17:81234782-81234804 CTGGGCTCCTGCAGGGAAGATGG - Intronic
1152609973 17:81310578-81310600 CTGGGTGTCTGGATGGGAACTGG - Intergenic
1152626627 17:81390645-81390667 CCTGGTGCCTGGAGGGAACAGGG - Intergenic
1152693856 17:81734188-81734210 CAGGCTGTCTGCAGGGGAGATGG + Intergenic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153250643 18:3118262-3118284 CAGGGTGTCAGGAGGGTGGAGGG + Intronic
1153968507 18:10203420-10203442 CTGATTATCTGGATGGAAGAAGG - Intergenic
1156310561 18:35918489-35918511 CTGGGGGTCAGGAGTGCAGAGGG + Intergenic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1156388633 18:36629500-36629522 CTGGGTTTCTTGAGGGAGGTTGG + Intronic
1156479717 18:37428410-37428432 CTGGGTCTCTGTAAGGAAGGAGG + Intronic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157190322 18:45576237-45576259 CTGGGTGTTTGGAGAGAAGGTGG + Intronic
1157580985 18:48774040-48774062 GTGGCTGTCTGGAGGGGAGCTGG - Intronic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1160179715 18:76623756-76623778 CTGTGTGCTTGGAGCGAAGAGGG + Intergenic
1160645989 19:193668-193690 CTGGGTGTCAGGAGACATGATGG - Intergenic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161070455 19:2257306-2257328 CTGGGAGTCCTGAGGGAAGAGGG + Intronic
1161307350 19:3575406-3575428 CTGTCTGCCTGGAGGGAATAGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161821522 19:6533508-6533530 AGGGGTCTCTGGAGGGGAGAGGG - Intronic
1161881576 19:6958140-6958162 CTGGTTGGCTGGGGGGAAAATGG - Intergenic
1161977591 19:7615104-7615126 CAGGCTGGGTGGAGGGAAGATGG + Intronic
1162580727 19:11528773-11528795 CTGGGTCTCTTGGGGGAAAAAGG + Intronic
1162755783 19:12858750-12858772 CTGCGGGGCTGCAGGGAAGATGG + Intronic
1162807218 19:13144294-13144316 CTGGGTAGCTGGAGAGTAGAGGG - Exonic
1163108577 19:15142580-15142602 TTTGGTGTGTGGAAGGAAGATGG + Intergenic
1163221211 19:15922518-15922540 TTGGGTTTCTGGAAGGAGGATGG - Intronic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1164621103 19:29696580-29696602 CTGGGTGTCTGGATGTCAGGTGG - Intergenic
1164621172 19:29696868-29696890 CAGGGTGTCTGGGTGGCAGAGGG + Intergenic
1164621330 19:29697554-29697576 CAGGGTGTCTGGGTGGCAGAGGG - Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165472260 19:36010406-36010428 TTGGGTGTCTGGGAGGAAGTGGG + Intronic
1165926311 19:39328229-39328251 CTGGGTCCCGGGAGGGAAGGAGG - Intergenic
1165929157 19:39344845-39344867 CTTGATCTCTGAAGGGAAGAGGG - Intronic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166191609 19:41180304-41180326 CTGGGTGGCTGCCGGGCAGAGGG - Intergenic
1166198335 19:41220621-41220643 CTGCGTGCCTGGAGGGGAGATGG - Exonic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166437278 19:42778170-42778192 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166446988 19:42866615-42866637 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166453917 19:42924284-42924306 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166456389 19:42943566-42943588 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166466181 19:43032837-43032859 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166472325 19:43088905-43088927 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166483456 19:43192854-43192876 CTGTGTGTTTGCAGAGAAGATGG - Exonic
1166485926 19:43211941-43211963 CTGTGTGTTTGCAGAGAAGATGG - Intronic
1166493082 19:43275894-43275916 CTGTGTGTTTGCAGAGAAGATGG - Intergenic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1167166150 19:47801967-47801989 CTGGGTGTCTGGCAAGAAGTCGG + Exonic
1167175545 19:47861346-47861368 CTGGGTGTCTGGCGACAAGTTGG - Intergenic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167429459 19:49446253-49446275 GTGGGTGTTGGGAGGGAAGAGGG - Intergenic
1167512531 19:49903349-49903371 GATGGTGTCTGGAGGGGAGACGG + Intronic
1167565678 19:50255176-50255198 GTGGGTGGGTGGAGGGGAGATGG - Intronic
1167607017 19:50486881-50486903 CTGGGTGGAAGGAGGGGAGAGGG - Exonic
1167743958 19:51340292-51340314 CGGGCCGTCTGGAGGGAGGAGGG + Exonic
1167793002 19:51692337-51692359 CTGGGTCTCTGGGGAGAAGGAGG + Intergenic
1168355412 19:55696917-55696939 CAGGGTGTCTGGAGGGTTGTCGG + Intronic
1168468813 19:56624903-56624925 CTGGTTCTCTGGATGGGAGAGGG - Exonic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
926707603 2:15847593-15847615 CGGGGTTTCTGTAGTGAAGATGG + Intergenic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927685859 2:25169854-25169876 CTGGATGGCTGGAGAGAGGAAGG - Intergenic
927715235 2:25347598-25347620 CTGGAAGTCAGGAGGGAGGATGG - Intergenic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
930612270 2:53555640-53555662 CCGGGTGTCTGCAGGGCAGAGGG + Intronic
932337083 2:70937656-70937678 CCGGGTGCCTGCAGGGAGGAGGG - Intronic
932405647 2:71511223-71511245 CTGGGGGGCAGGAAGGAAGAGGG + Intronic
932416085 2:71574671-71574693 CTGGCTGGCTGGTGTGAAGATGG + Intronic
932418584 2:71588217-71588239 CTGGGGGTCTGAATGGGAGAAGG + Intronic
932688104 2:73890796-73890818 TGGGGATTCTGGAGGGAAGAGGG - Intergenic
932697372 2:73968234-73968256 CTGGGTGGCTGGAAGGATGATGG - Intergenic
933374979 2:81467459-81467481 CGGGGCGTCTGCAGGGCAGAGGG + Intergenic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937437331 2:121891223-121891245 TTTGGTATCTGAAGGGAAGAGGG + Intergenic
937694192 2:124789546-124789568 GAGGGTGTCGGGTGGGAAGAGGG - Intronic
939409397 2:141804696-141804718 CTGGGCATCTGGAAGGCAGATGG + Intronic
939875044 2:147568279-147568301 ATGGGTGGATGGAGGGAAGGAGG + Intergenic
941870948 2:170385104-170385126 CAGGGTGTATGGGGGGAGGAAGG + Intronic
943725270 2:191245851-191245873 GGGGGTGGCGGGAGGGAAGAAGG + Intronic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944580259 2:201125966-201125988 CTGGCAGTCAGGAGGGAAAAAGG + Intronic
945805372 2:214483959-214483981 TAGAGTTTCTGGAGGGAAGATGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946353212 2:219169006-219169028 GTGGGTATCTGGAGGTGAGAAGG - Intronic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
946723127 2:222632514-222632536 TTGCGTTTCTGGAGGTAAGAAGG - Intronic
947275672 2:228389465-228389487 TTGGGAATCGGGAGGGAAGAAGG - Intergenic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
947614738 2:231548549-231548571 GTGGGTGTCTCCAGGGGAGACGG + Intergenic
947755501 2:232561063-232561085 CTTGGAGTTTGGAGGAAAGAAGG + Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948301168 2:236908613-236908635 CTGTGTGGCTGGAGGGAAGGCGG - Intergenic
1168862185 20:1053570-1053592 CTGTCTGGCTGGAGGGAGGAGGG - Intergenic
1168869826 20:1118738-1118760 TTCGGCGTCTGGAGGAAAGAAGG - Exonic
1168998814 20:2151878-2151900 TTGGGTGCCTGCAGGGTAGAGGG + Intronic
1169118546 20:3082518-3082540 CTCAGTCTCTGGCGGGAAGAGGG - Intergenic
1169214502 20:3785518-3785540 CACGGTGCCGGGAGGGAAGAAGG + Exonic
1169549480 20:6687609-6687631 CTGGGTACTTGGAGGAAAGAGGG - Intergenic
1169826111 20:9770544-9770566 CTGGGTGAGTGTAGGCAAGATGG + Intronic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1171145315 20:22776283-22776305 CTGGGAGTCTGGAGGCATGGTGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172188153 20:33044327-33044349 CTTGGGATCTGGAGGGAAGCTGG + Intergenic
1172865118 20:38089968-38089990 CTGGGGGGCTGGGCGGAAGAAGG - Exonic
1173894614 20:46541557-46541579 CTGGGTGTGGGGACGCAAGAAGG + Exonic
1174205965 20:48839324-48839346 GTGGGTGTCTGTGGGGGAGAGGG - Intergenic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1174752167 20:53122567-53122589 CAAGGTGTTTGGAGGGAAGAGGG + Intronic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175428754 20:58888805-58888827 GTGGGTGGCTGGAGGTAAGGAGG + Intronic
1175683451 20:61008671-61008693 CTGGGAGGGTGGAGAGAAGATGG - Intergenic
1175779220 20:61671756-61671778 GTGGGTGTGTGGATGGATGATGG + Intronic
1175807613 20:61838473-61838495 ATGGGAGCCTTGAGGGAAGAAGG - Intronic
1176279517 20:64292548-64292570 CTGGGTGTCAGGAGACATGATGG + Intergenic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178430016 21:32510630-32510652 CCAGGTGCCTGCAGGGAAGATGG + Intronic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1179934787 21:44595570-44595592 CTGGGTGTCCGGAGCTCAGAAGG - Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1180712278 22:17847465-17847487 CAGGGTGTCTGGCTGGAAGCAGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180958368 22:19751127-19751149 CTGGGTCTCAGGAGGGAACCGGG + Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181866139 22:25857004-25857026 CTGGGTGTCTAGAGGAGACAGGG - Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182320331 22:29474858-29474880 CTGGTTGTCTTGAGGGAAGGAGG - Intergenic
1182623760 22:31631405-31631427 TTGCGTGCCTGGAGGGCAGAAGG - Intronic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1183208405 22:36434778-36434800 CCGGCTGTGTGGAGGGAAGGGGG + Intergenic
1183258301 22:36777267-36777289 CTAGGTGTCTGGAGGGAATGTGG - Intergenic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183662651 22:39230572-39230594 ATGGTTGTCTGGAAGGAAGTGGG + Intronic
1183724835 22:39582754-39582776 GTGGGTGTATGGGGGAAAGATGG - Intronic
1183741205 22:39669593-39669615 CTGGCTGGCTGGTGGGTAGATGG + Intronic
1184744623 22:46449129-46449151 CTGGGTGAGTGGATGGAAGCTGG - Intronic
1184924195 22:47625930-47625952 GTGGGAGTATGGAGGGCAGAGGG - Intergenic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949627490 3:5883506-5883528 TAGGGTGATTGGAGGGAAGAGGG + Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
950707112 3:14789723-14789745 CTGTCTGTCTGGGGGCAAGACGG + Intergenic
950894853 3:16439676-16439698 GTGGGTGGCTGGAGTGAGGAAGG + Intronic
952083997 3:29795711-29795733 CTGGGAGGAAGGAGGGAAGAGGG + Intronic
952175609 3:30859224-30859246 CTGGGAGGCTGGGGGGAAGCAGG + Intronic
952210597 3:31225796-31225818 CTGTGTGGCAGCAGGGAAGAGGG - Intergenic
953201276 3:40780564-40780586 CTGGATGTTTGGGAGGAAGAAGG + Intergenic
954576977 3:51681727-51681749 CTGAGTGTCTGCATGGCAGAGGG - Intronic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
956189592 3:66596045-66596067 ATGGGTGCCTGGAGGGGAGGTGG + Intergenic
956780820 3:72601736-72601758 CTTGCTATCTGGATGGAAGAAGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957916420 3:86693449-86693471 CTGGGTCTCTGTGGGGATGATGG + Intergenic
960366836 3:116783105-116783127 TTGGCTGACTGAAGGGAAGAAGG - Intronic
960815319 3:121665946-121665968 CTGGCTCTCAGGAGGGAAGCAGG - Intronic
961945647 3:130684241-130684263 CTGGGTGATTGCAGGTAAGATGG - Exonic
962203439 3:133417327-133417349 CGGGGTGAGTGGAGGGGAGATGG - Intronic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962810008 3:138951584-138951606 ACGGGTCTTTGGAGGGAAGAGGG - Exonic
962960781 3:140309430-140309452 CTGGGTGTCTGTAGAGGAAAAGG + Intronic
963135718 3:141901991-141902013 CTAGGTGTCTGCAGGAACGAAGG - Intronic
963206512 3:142641764-142641786 CTGGGTTTCTTTAGGGGAGATGG + Intronic
963247310 3:143075065-143075087 CTGGGTCTCTGGAGGAAAACCGG + Intergenic
963364159 3:144313344-144313366 CTGGGTGTCTACAGGAAAGAAGG - Intergenic
964198048 3:154087384-154087406 CTAGGTGTATGGAAGGATGATGG - Intergenic
965874548 3:173300416-173300438 ATGGGTGGATGGAGGTAAGAGGG + Intergenic
966113711 3:176434769-176434791 CTGGGTGTTGGGAGTTAAGATGG - Intergenic
967042408 3:185705753-185705775 CTGTGTCTCTGGATGGAGGAAGG + Intronic
967252873 3:187561124-187561146 CTGGCTATCTGGAGAGGAGAGGG + Intergenic
967438390 3:189477849-189477871 CTGGGCTTCTGGAGGGGAGGGGG - Intergenic
967493117 3:190115843-190115865 TTAGGTATTTGGAGGGAAGATGG + Intronic
968371692 3:198225858-198225880 CTGGGTGTCAGGAGACATGATGG + Intergenic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
969088555 4:4675117-4675139 GTAGGTGTTTGGAAGGAAGAAGG - Intergenic
969421860 4:7102209-7102231 CTAGGCGTCTGGAGAGAGGAAGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
974175202 4:58313767-58313789 CTGGATCTCTGGAGGCAACATGG - Intergenic
975683028 4:76895881-76895903 CTTGGTGTCTGGAGCAAAGAAGG - Exonic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
978349000 4:107801671-107801693 CTGAGTGGCTGCATGGAAGAGGG - Intergenic
978549526 4:109910461-109910483 CTGGGTGTCAGGAAAGAAGGAGG - Intergenic
979346915 4:119598836-119598858 CTGGGGGGTTGGAAGGAAGATGG + Intronic
979381430 4:120011249-120011271 CTGTGTGTCTGGTGAGAATATGG - Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
982090600 4:151876816-151876838 CAGAGTTTCTGGAGGAAAGATGG - Intergenic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
983976220 4:173937233-173937255 TTGTGTGTCAGGAGGTAAGAAGG - Intergenic
984615918 4:181897112-181897134 CTGGCAGGCTGAAGGGAAGAAGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985524403 5:394769-394791 CTGGTTGCGTGGAGGGCAGAGGG + Intronic
986056472 5:4142201-4142223 GTGGGTGACTGGAGGTAAGAGGG + Intergenic
986428037 5:7654233-7654255 CAGGGTTTCAGGAAGGAAGAAGG + Intronic
986555630 5:9007863-9007885 CTGGGTGTGAGGAGGGGAGGTGG + Intergenic
986773292 5:10992855-10992877 CAGGCTCTCTGGAGGGAAGGAGG - Intronic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987494592 5:18627452-18627474 TTGGGTGTGGGGAGGGGAGAGGG + Intergenic
988627082 5:32888782-32888804 CTGTGTGTCTGGAAGGAGAAAGG + Intergenic
989427482 5:41313504-41313526 CTGAGTCTCTGAAGGGAATAGGG - Exonic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
991512580 5:67396196-67396218 CTGGGTGTGGGGATGGGAGATGG + Intergenic
991577849 5:68123150-68123172 GTGGTTGTTTGGAGGAAAGAAGG - Intergenic
991643392 5:68776489-68776511 CAAGTTCTCTGGAGGGAAGAGGG + Intergenic
991925479 5:71701573-71701595 CTGGGTGGCAGGAGGGCAGGAGG + Intergenic
992025066 5:72662159-72662181 CTGGGTCTGTGGAGGGCAGTGGG - Intergenic
992987307 5:82245250-82245272 CTGGCTGTCTGAAGGAAAAACGG + Intronic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
993149996 5:84149127-84149149 CTGGGAGTCTGGAGAGTCGACGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995550473 5:113276177-113276199 CAGGGTGTCTGGAGGGAGTCAGG - Intronic
996290263 5:121844402-121844424 TTGGGTCTTTGGAAGGAAGACGG - Intergenic
996695133 5:126385963-126385985 CTGGGTCTCTGGAGCAGAGAGGG + Intronic
996831269 5:127743160-127743182 CTTGGTGGTTGGAGGGAAGCGGG - Intergenic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1001429068 5:171645357-171645379 TTGGGTGGCTGGTGGGGAGAAGG - Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002698712 5:181107672-181107694 GTGGGTGTCTCCCGGGAAGACGG + Intergenic
1002730932 5:181331404-181331426 CTGGGTGTCAGGAGACATGATGG + Intergenic
1002753601 6:142700-142722 CTGGGTGTCAGGAGACATGATGG - Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003683211 6:8276142-8276164 ATGGGTATATGGCGGGAAGAGGG + Intergenic
1004111109 6:12720014-12720036 CTGGGTGTATGGAGTCAACATGG + Intronic
1004962664 6:20808679-20808701 CTGGGTTTCAGGAGAGAAGATGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006058861 6:31404683-31404705 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006071346 6:31499568-31499590 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1007246947 6:40469863-40469885 CAGGGTGTGTGCAGGGTAGAGGG - Intronic
1007801852 6:44401246-44401268 CTGAGTGTTTGGTGGGAAGTAGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008688197 6:53946891-53946913 GTGGTTGTTTGGAGGAAAGAAGG - Intronic
1009998308 6:70921639-70921661 GGGGTTGTCTGGAGGTAAGAAGG + Intronic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1012515048 6:100049512-100049534 ATGGATGGATGGAGGGAAGAGGG + Intergenic
1014132236 6:117847299-117847321 GTGGTTGTTTGGAGGAAAGAAGG - Intergenic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1015234632 6:130956446-130956468 CTCTGTGTCTGAAGTGAAGAAGG - Exonic
1015678983 6:135782293-135782315 GTGGTTGTTTGGAGGAAAGAAGG - Intergenic
1016501639 6:144726989-144727011 AGGGGTGTGGGGAGGGAAGAGGG - Intronic
1016683132 6:146853373-146853395 CTGGGGGTCTGGAGGAAATGAGG - Intergenic
1019017642 6:168891417-168891439 CTTGGTGTCAGAAGAGAAGAGGG + Intergenic
1019256820 7:57580-57602 CTGGGTTTCAGAAGGGAGGATGG + Intergenic
1019528820 7:1493689-1493711 CGGGGTTTCTGCAGGGACGAGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019913558 7:4116314-4116336 CTGGCTGTCTCGAGGGTGGAGGG - Intronic
1020168098 7:5823652-5823674 CTGGGTCTCTAGGGGGAAGAAGG + Intergenic
1021043220 7:15889635-15889657 CTGGGAATCTGGAGGTCAGAAGG - Intergenic
1022030606 7:26488460-26488482 CTGGGTGGGTTGGGGGAAGAAGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1023063207 7:36349514-36349536 GTGGGTGTGTGGAGGCAAGGAGG - Intronic
1023177763 7:37449669-37449691 CTAGCTGGCAGGAGGGAAGAGGG + Intergenic
1023542616 7:41282615-41282637 CTGAGTATCTCGAGGGAACAAGG + Intergenic
1023637628 7:42228263-42228285 CTGGGTGTCTGGGGGCAGAAGGG + Intronic
1023745436 7:43318747-43318769 CAGGGTGTCAGGAGAGAAAAGGG + Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024229738 7:47354943-47354965 CCCAGTGTCTGGAGGGAAGGAGG - Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024292110 7:47812260-47812282 CTGGGCTGCTGCAGGGAAGAGGG - Intronic
1024647526 7:51382723-51382745 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025060130 7:55798474-55798496 CTGGGTGTCAGGAGACATGACGG - Intronic
1025128328 7:56362886-56362908 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025176711 7:56805767-56805789 CTGGGTGTCAGGAGACATGACGG - Intergenic
1025695083 7:63770619-63770641 CTGGGTGTCAGGAGACATGACGG + Intergenic
1025875516 7:65477142-65477164 CTGGGTGGTTGGAGAGAGGAGGG - Intergenic
1025943972 7:66092534-66092556 CTGGGTGCCAGGGAGGAAGATGG - Intronic
1026897791 7:74020292-74020314 CTGGGAGTCTGGAGGGCTTATGG + Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1029158670 7:98535409-98535431 TTGGGTGGCTGTAGGGAAGTGGG + Intergenic
1029441936 7:100591652-100591674 CTTCGTGTCTGGAGGAAGGAAGG - Exonic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1032052610 7:128658329-128658351 CTGGGTGTCAGGAGACATGATGG + Intergenic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1033142518 7:138840271-138840293 CTGGGAGCCTGGAAGGAACATGG + Exonic
1033235705 7:139636327-139636349 CTGGGTGGAAGGAGAGAAGACGG - Intronic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033511595 7:142065214-142065236 CTGCGTGACTGGAGGGAACATGG - Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1034103345 7:148470221-148470243 CTTGGTTTCTGGAGGGGAAATGG - Intergenic
1034242738 7:149622843-149622865 CTGGCTGTTTGGAGGGAAACAGG + Intergenic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1035121313 7:156570244-156570266 GTGGGTGGCTGCAGGGAAGGTGG - Intergenic
1035348637 7:158226925-158226947 CAGGCTGTTTGGAGGGAGGAGGG + Intronic
1035436492 7:158863737-158863759 CCGGGTGTGTGGGGGGAAGGGGG + Intronic
1035436516 7:158863811-158863833 CTGGGTGTTTGGTGGGGAGCCGG + Intronic
1036048797 8:5172969-5172991 ATGAGTGTCTGGAGGGAGAAGGG - Intergenic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1037166160 8:15831394-15831416 ATGGTTGTTTGGAGGAAAGAAGG - Intergenic
1038007401 8:23444403-23444425 GTGGGTTCCTGGAGGGGAGAGGG - Intronic
1039455261 8:37701732-37701754 GTGGGTCTCTGAAGGAAAGAGGG - Intergenic
1040007815 8:42635649-42635671 CTGGGTGTCTGTGGGACAGAAGG - Intergenic
1041354447 8:56985458-56985480 CTGGGTGTCGGGAGGGGGCAGGG - Intronic
1042374852 8:68038642-68038664 CTGGGATTCTTGAAGGAAGAGGG - Intronic
1042868982 8:73380455-73380477 CTGGCTTGCTGGAGGGAAGAAGG - Intergenic
1043276613 8:78404231-78404253 CTAGGTATCTGGAAGAAAGAAGG - Intergenic
1043837654 8:85064677-85064699 CTGGGTGTGAGGAGGGGAGGTGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1045035490 8:98173445-98173467 ATGGCTGACTGGAGGGAGGAAGG + Intergenic
1045506512 8:102782411-102782433 CTGGGTGTGTGGAGGGACAGAGG + Intergenic
1046360494 8:113147660-113147682 GTAGGTGTGTGGAGGGGAGAGGG + Intronic
1047749200 8:127867214-127867236 CAGGCTGTCAGGAAGGAAGAAGG + Intergenic
1047874160 8:129116709-129116731 CTGGGTCTCTAAATGGAAGATGG + Intergenic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048528892 8:135229494-135229516 CTGAGTGTCAGGAGGGATTACGG + Intergenic
1048998628 8:139810072-139810094 GTGGGTTTCAGGAGGGAACAGGG - Intronic
1049199226 8:141331727-141331749 CGGGGTGTGTGGAGGAAGGAAGG + Intergenic
1049363224 8:142224198-142224220 CGGGGTGGCTGGTGGGAAAAGGG + Intronic
1049529487 8:143147252-143147274 ATGGGTGTTTGGAGAGAAGGGGG + Intergenic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1051351643 9:16203382-16203404 TGGGCTGTCTGGAGGGAAGGGGG + Intergenic
1051543131 9:18243733-18243755 CTGGGTCTGTGGACAGAAGATGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054891881 9:70259828-70259850 CTAGTTGTCTGAAGGGGAGAGGG - Intronic
1055368011 9:75566646-75566668 GTGGTTGTTTGGAGGAAAGAAGG + Intergenic
1056628444 9:88273307-88273329 CTGGTTCACTGTAGGGAAGAGGG + Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057515415 9:95716355-95716377 ATGGCTGGCTGGAGTGAAGATGG - Intergenic
1057691599 9:97291268-97291290 CAGGGTGTCTGGCGGGAGGAGGG + Intergenic
1057910077 9:99013309-99013331 CTGGGTGACTGGAGGGCAAGTGG - Intronic
1058090672 9:100802214-100802236 GTGAGTATCTGGAGGGATGAAGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059901899 9:118936804-118936826 CAGGGTGGATGGTGGGAAGAGGG - Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060336719 9:122730639-122730661 ATGGTTGTTTGGAGGGAAGAAGG - Intergenic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061218515 9:129235697-129235719 CTGGGACGCTGGAGGGATGAGGG - Intergenic
1061275971 9:129569433-129569455 CTGGCTGGCTGGTGGGAGGAAGG + Intergenic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061487651 9:130928516-130928538 CTGGGTGACTGATGGGAAGGTGG - Intronic
1062186628 9:135221900-135221922 CAGTGTGTCTGGAGGGAGCAAGG - Intergenic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1062367534 9:136218389-136218411 CTGGCTGCCTGGAGAGTAGATGG - Intronic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1062755338 9:138283911-138283933 CTGGGTGTCAGGAGACATGATGG + Intergenic
1203579251 Un_KI270745v1:28083-28105 CTGGGTGTCAGGAGACATGATGG + Intergenic
1185495289 X:549972-549994 GTGGGTGGATGGATGGAAGAAGG - Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1185772955 X:2779551-2779573 TTTGGTGTCTGCGGGGAAGAAGG - Intronic
1185943509 X:4347953-4347975 CTGGCTCTCTGGAAGGCAGATGG + Intergenic
1186467750 X:9797252-9797274 CTGGCTGCCTGGAATGAAGATGG + Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1186894296 X:13990569-13990591 CTGGGGGTCAGGAGTGAAGGAGG - Intergenic
1187122756 X:16425208-16425230 TTGGGTGGTTGGAGGGAAGGAGG - Intergenic
1187391359 X:18888436-18888458 CTGTGTGTCAGGAGTGAAGAGGG - Intergenic
1190118224 X:47639393-47639415 CAGGGTGTCAGGGGGGAGGAGGG + Intronic
1190228440 X:48563169-48563191 CCGGGTGTCTGGAGGGAGACAGG - Intergenic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1192261455 X:69508147-69508169 CTGGGTCTTTTGTGGGAAGAAGG + Intronic
1192366074 X:70474457-70474479 CTGGTTGTATGCAGGGAAAAGGG + Intronic
1192919835 X:75694946-75694968 CTTGTTGTTTGGAGGTAAGAAGG - Intergenic
1193736273 X:85160277-85160299 GTGGTTGTTTGGAGGAAAGAAGG - Intergenic
1193790092 X:85807381-85807403 GTGGTTGTTTGGAGGAAAGAAGG + Intergenic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1194255205 X:91626598-91626620 ATGGAAGTCTGGAGGGGAGAGGG + Intergenic
1194518857 X:94893652-94893674 ATTGGTGGCTGGAAGGAAGAAGG - Intergenic
1195301378 X:103533503-103533525 CTGGAAGTCTGGATGGAAAATGG - Intergenic
1195750535 X:108159046-108159068 CTGGGAGGGTGGAGAGAAGAGGG + Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1197404118 X:126029103-126029125 GTGGTTGTATGGAGGAAAGAAGG + Intergenic
1197720090 X:129739171-129739193 CTGGGTGGATGGAGGGACAAGGG - Exonic
1198505412 X:137296296-137296318 CTTGGTGTCTTGTGGGAAAATGG + Intergenic
1199590354 X:149462165-149462187 TGGGGTGTCTGGAGGAAGGAAGG - Intergenic
1199677350 X:150199559-150199581 ATGGGTATCTCCAGGGAAGAAGG - Intergenic
1199983447 X:152933827-152933849 CTGGGTGTGCTGAGGGAAGTAGG - Intronic
1200397326 X:155998941-155998963 CTGGGAGTCTGGAGGTGAGACGG - Intronic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1200573932 Y:4865859-4865881 ATGGAAGTCTGGAGGGGAGAGGG + Intergenic
1202381859 Y:24280705-24280727 CTGGGTGTCAGGAGACATGATGG + Intergenic
1202488925 Y:25389420-25389442 CTGGGTGTCAGGAGACATGATGG - Intergenic