ID: 946155064

View in Genome Browser
Species Human (GRCh38)
Location 2:217801842-217801864
Sequence CCTTCCGCAGGGATGCTGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 241}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946155056_946155064 19 Left 946155056 2:217801800-217801822 CCCATCATTCGCCTTGAAAAGTC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 241
946155055_946155064 20 Left 946155055 2:217801799-217801821 CCCCATCATTCGCCTTGAAAAGT 0: 1
1: 0
2: 0
3: 6
4: 89
Right 946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 241
946155057_946155064 18 Left 946155057 2:217801801-217801823 CCATCATTCGCCTTGAAAAGTCA 0: 1
1: 0
2: 1
3: 3
4: 107
Right 946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 241
946155058_946155064 8 Left 946155058 2:217801811-217801833 CCTTGAAAAGTCACACTCTCAGA 0: 1
1: 0
2: 1
3: 34
4: 291
Right 946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 241
946155053_946155064 25 Left 946155053 2:217801794-217801816 CCCTTCCCCATCATTCGCCTTGA 0: 1
1: 0
2: 0
3: 6
4: 149
Right 946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 241
946155054_946155064 24 Left 946155054 2:217801795-217801817 CCTTCCCCATCATTCGCCTTGAA 0: 1
1: 0
2: 0
3: 6
4: 141
Right 946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG 0: 1
1: 0
2: 1
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946155064 Original CRISPR CCTTCCGCAGGGATGCTGGG AGG Exonic
900153946 1:1196581-1196603 GCTTCTGCAGGGAGGCAGGGAGG - Exonic
900427806 1:2588408-2588430 GCTTCCCCAGAGCTGCTGGGAGG - Exonic
900685437 1:3945093-3945115 CAGTCCCCAGGGGTGCTGGGTGG + Intergenic
900799455 1:4728312-4728334 CCTTCCGATGGCATGCTGGAGGG + Intronic
900879661 1:5371708-5371730 CCTTCCTCAGTGCTGCTGTGAGG - Intergenic
901528988 1:9842101-9842123 CCCTCCTCTGAGATGCTGGGAGG - Intergenic
901571692 1:10166068-10166090 GATTCTGCAGGGATACTGGGGGG - Intronic
902659716 1:17892633-17892655 TCTTCCCCAAGGAGGCTGGGTGG + Intergenic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902776085 1:18675936-18675958 CCTGGTGCAGGGATGCTGGTGGG - Intronic
902890743 1:19441629-19441651 CTTTCCCAAGTGATGCTGGGTGG + Intronic
904094447 1:27966400-27966422 CCTACCCCAGGGTTGCTGGGAGG + Intronic
904534185 1:31188323-31188345 ACTACCAAAGGGATGCTGGGGGG + Intronic
905502291 1:38449330-38449352 CCCTCTGAAGGGCTGCTGGGTGG - Intergenic
905945492 1:41898110-41898132 CCTGCCCCCAGGATGCTGGGAGG - Intronic
906684680 1:47755820-47755842 CTTTCCTCAGTGATGGTGGGTGG - Intergenic
907526747 1:55058188-55058210 CCTGCCCCATGGGTGCTGGGGGG - Exonic
915633748 1:157172259-157172281 TCCTCTGCAGGGTTGCTGGGAGG - Intergenic
915637573 1:157197213-157197235 TCCTCTGCAGGGTTGCTGGGAGG - Intergenic
915658012 1:157377562-157377584 TCCTCTGCAGGGTTGCTGGGAGG - Intergenic
915671002 1:157489087-157489109 TCCTCTGCAGGGTTGCTGGGAGG + Intergenic
919515039 1:198511762-198511784 CCCTCCGGAGGGATGGTGAGGGG + Intergenic
919929063 1:202209296-202209318 CCATCCCCAGGGATCCTGGAGGG + Intronic
921147831 1:212376529-212376551 CCTTCCTCAGAGCTGCTGTGGGG + Intronic
921182679 1:212644197-212644219 CCCGCCTCAGCGATGCTGGGAGG - Intergenic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
922182300 1:223244753-223244775 CCTTCAGCAGGGAATATGGGTGG + Intronic
922344102 1:224681686-224681708 GCTTCTGAATGGATGCTGGGTGG + Intronic
923519821 1:234726715-234726737 CATCACGCAGCGATGCTGGGAGG - Intergenic
923604040 1:235427297-235427319 CTTTCCACAGAGATGCTGTGAGG - Intronic
923713120 1:236402856-236402878 CCTTCCTCAGGGTTACTGGAAGG + Intronic
1063313746 10:4982314-4982336 CTTGGCGGAGGGATGCTGGGGGG + Exonic
1063968230 10:11363272-11363294 GCTTCCCCAGGGCTGCTGCGGGG - Intergenic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1065183044 10:23145909-23145931 CCTTTCGCCGGGCGGCTGGGTGG + Intergenic
1067658900 10:48218845-48218867 CTTGTCACAGGGATGCTGGGAGG + Intronic
1067947125 10:50696631-50696653 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1069572166 10:69500885-69500907 CCTGGTGCAGGGATGCTGTGGGG - Intronic
1069874215 10:71551830-71551852 CCTGCCGCAGGGGTTGTGGGAGG - Intronic
1070286078 10:75084945-75084967 CCTTGCGCAGCTCTGCTGGGAGG - Intergenic
1070439527 10:76429789-76429811 CCTACAGCAGGGAAGCTGGGTGG - Intronic
1070882436 10:79861621-79861643 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1071649006 10:87377932-87377954 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1073273105 10:102283540-102283562 CCTTCTGCTAGGAGGCTGGGAGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1075338609 10:121627350-121627372 CATTCAGCAGGGATGTTTGGGGG - Intergenic
1075664558 10:124221303-124221325 CATCCCACAGGGCTGCTGGGAGG + Intergenic
1075879911 10:125842198-125842220 CCTACTGCAGGGAGGCTGGCAGG - Intronic
1076633841 10:131870018-131870040 CCTTCGGCAGGGAGGTGGGGAGG + Intergenic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077195400 11:1277341-1277363 CCTTCCTCAGGGAGGCCGGTGGG - Intronic
1077545241 11:3166336-3166358 CCCTCCGCAGCCCTGCTGGGAGG - Intronic
1078436375 11:11328991-11329013 CCTGCCTAAGGGATGGTGGGGGG - Intronic
1078572723 11:12473507-12473529 CTTTCCTCAGGGAAGCAGGGAGG - Intronic
1080605866 11:33864554-33864576 CCCTCGGAAGGGAGGCTGGGTGG - Intronic
1081649832 11:44816527-44816549 CCTCTCCCAGGGTTGCTGGGAGG - Intronic
1083841769 11:65308860-65308882 CCCTCTGCTGGGATGCAGGGTGG - Intergenic
1084312767 11:68326424-68326446 CCTTCAGCAGTGAAGCTGAGTGG - Intronic
1085290436 11:75395353-75395375 CCTTCCCCAGGGATGCCAGGAGG - Intergenic
1085447593 11:76611000-76611022 CCTCCTGCAGGGATGCTGGTGGG + Intergenic
1085958145 11:81426594-81426616 CCTTCCTCAGAGATTTTGGGAGG - Intergenic
1089066891 11:115668937-115668959 CCTTCAGCTGGAATGCGGGGAGG + Intergenic
1090909347 11:131104961-131104983 CCTTCCTCAGAGATGAGGGGAGG + Intergenic
1091318528 11:134632992-134633014 TCTCTAGCAGGGATGCTGGGTGG + Intergenic
1091692375 12:2605826-2605848 CCTTCCCCAGGAATGCTGATGGG - Intronic
1093619856 12:21276494-21276516 CCTTCAGGAGGGATGATTGGTGG - Intronic
1093925309 12:24903155-24903177 CCTCCCCAAGGGATGCTGGAGGG - Intronic
1095795057 12:46210136-46210158 CCTTCAACAGGTGTGCTGGGAGG - Intronic
1096605206 12:52760201-52760223 CATTCTGCAGGGATTCTGGAGGG - Intergenic
1098088850 12:66879372-66879394 CCTTCCACAGGGTTGTTGTGTGG - Intergenic
1098164303 12:67677826-67677848 CCTGCCTCAGGGATGTTGTGAGG + Intergenic
1104033057 12:125079092-125079114 ACTTCCGCAGAGGTGCGGGGAGG - Intronic
1107717688 13:43216875-43216897 CCAGCTGCAGGGCTGCTGGGTGG - Intronic
1113443449 13:110347365-110347387 CCTTGCACAGGGCTGCTGTGAGG - Intronic
1117347333 14:54846083-54846105 CTTCCCGCAGTGATGCTGGAGGG - Intronic
1117920330 14:60721859-60721881 CCTTCCGCAGATATGCGGAGAGG - Intronic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1119174165 14:72557042-72557064 CCTTCCGCAGTGAGGAGGGGCGG - Intronic
1124003689 15:25779941-25779963 CCTGCCGCAGGCAGGCCGGGCGG + Intronic
1125600368 15:40912363-40912385 TCTGCCCCAGGGCTGCTGGGCGG - Intergenic
1128327555 15:66734990-66735012 CCTTCTGCTGGGACCCTGGGCGG - Intronic
1128665185 15:69532458-69532480 CCTTCCAAAGGCATGCTGTGGGG + Intergenic
1130228948 15:82081941-82081963 CTTCACGCAGGGATGCTGTGAGG + Intergenic
1132517848 16:374187-374209 CCTCCTGCAGGGATGTGGGGTGG - Intronic
1133223350 16:4328526-4328548 CCTGGAACAGGGATGCTGGGAGG + Intronic
1135415687 16:22266606-22266628 CCTCCCGCAGGCTGGCTGGGCGG + Intronic
1137382158 16:48009480-48009502 CTTTCAGAAGGGATGATGGGAGG + Intergenic
1140897370 16:79336452-79336474 GCTTCTTCAGGGATGCTGGGAGG + Intergenic
1141566587 16:84906519-84906541 CCTCCTGCAGGGACTCTGGGTGG - Intronic
1141944970 16:87303566-87303588 CCCTCCCCTGGGATGCTGGTTGG + Intronic
1142018472 16:87765462-87765484 CCCTCTGAAGGGAGGCTGGGTGG - Intronic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142811232 17:2396569-2396591 CTTTCAGCAGGGATGCTGAGCGG - Intronic
1143345427 17:6245468-6245490 CCTTCCCCTAGGATGCTGGAAGG + Intergenic
1145908840 17:28531199-28531221 CCGACCGCTGGGATGCTGTGGGG + Intronic
1146568987 17:33937023-33937045 CCTTCCTCAGTGACTCTGGGAGG + Intronic
1147185857 17:38712803-38712825 CCTTCAGGAGGGATGGTGTGTGG + Intronic
1147262020 17:39214306-39214328 CCTTCCGCAGGGTGGCTTTGGGG + Exonic
1148347358 17:46912357-46912379 CCCTCCTCAGGGCTGCTGGTAGG + Intergenic
1148465960 17:47865484-47865506 CCTTCCCCAGGGTGGCTTGGAGG - Intergenic
1148645420 17:49217442-49217464 ACATCCCTAGGGATGCTGGGAGG - Intronic
1148837998 17:50476386-50476408 CCTTGGGCAGGCACGCTGGGAGG - Intergenic
1150633532 17:66897236-66897258 CCATTCCCAGGGAGGCTGGGAGG + Intergenic
1151086797 17:71389544-71389566 CCTACCACAGTGATGCTGCGTGG + Intergenic
1151658847 17:75508193-75508215 CCCTCTGCAGAGCTGCTGGGTGG - Intronic
1151898147 17:76994226-76994248 CCTTGCTCAGAGATGATGGGAGG + Intergenic
1152303425 17:79508281-79508303 CCTTCCGGAGGGAGGCTTAGTGG + Intronic
1152461662 17:80445150-80445172 CCTTCCCCAGGGAGTCAGGGAGG + Intergenic
1152699827 17:81813305-81813327 CTTTCCGTGGCGATGCTGGGTGG + Intronic
1152788666 17:82266099-82266121 CCTTGGGCAGGGCTGATGGGAGG - Intronic
1154201324 18:12302556-12302578 CCTGCTGCAGGGAGGCTGGTGGG - Intergenic
1154345972 18:13543868-13543890 CCTCCAACAGGGCTGCTGGGAGG + Intronic
1157200350 18:45654121-45654143 CTTTTGGCAGGAATGCTGGGGGG + Intronic
1157695173 18:49716679-49716701 CCTTCCCAAGGGAAGCTGTGAGG - Intergenic
1160754474 19:750540-750562 GCTCCCTCAGGGCTGCTGGGAGG - Intergenic
1160865849 19:1255639-1255661 CCTGCAGCAGGGAGGCTGAGGGG - Exonic
1161857470 19:6773837-6773859 GGTTCCCCAGGGCTGCTGGGTGG + Intronic
1162086910 19:8254784-8254806 CGTTTCCCAGGGAGGCTGGGGGG - Intronic
1162086925 19:8254817-8254839 CATGTCCCAGGGATGCTGGGAGG - Intronic
1162844647 19:13382847-13382869 CCAACCGCTGGGATGCAGGGAGG - Intronic
1163440900 19:17322175-17322197 CGCTCTGCAGGGCTGCTGGGCGG + Exonic
1163584601 19:18156985-18157007 CCTTTTGCTGGGCTGCTGGGAGG - Intronic
1164660121 19:29956880-29956902 CCTTCCGCAGGGTTCCTCTGGGG + Intronic
1165055905 19:33176290-33176312 CATGCTGCAGGGATGCTGGGTGG + Intergenic
1165479597 19:36054817-36054839 CCAATCGCAGGGATGCCGGGCGG - Intergenic
1167149945 19:47702572-47702594 GCTTCAGCTGGGTTGCTGGGGGG + Exonic
1167247307 19:48381365-48381387 CCCTCTGTAGGGATGCTGTGAGG + Intergenic
1168277519 19:55285718-55285740 CCTGCCGGATGGATGGTGGGTGG + Intronic
925337045 2:3106323-3106345 GCTTCTGCAGGGATATTGGGTGG - Intergenic
927156263 2:20223532-20223554 CCATCCCCAGGGATGCAGAGGGG - Intronic
927667603 2:25042888-25042910 CCCTCCGCAGTGATGAAGGGAGG + Intronic
928452492 2:31388902-31388924 CTTTTCCCAGAGATGCTGGGTGG - Intronic
928917032 2:36483446-36483468 CATACCGAAGGGATGCTGTGAGG - Intronic
929552885 2:42905596-42905618 CGTTCAGCAGGGCTGCTGGGTGG + Intergenic
935765132 2:106359286-106359308 CCTTCCCCAGGGATCCTTGAGGG + Intergenic
936076463 2:109404681-109404703 CCTTCCGCAAAGGTGCTGGGAGG - Intronic
937863238 2:126729760-126729782 CCTTCCCCAGGGATTCTGCCTGG - Intergenic
938319409 2:130353213-130353235 CCTTCCTCTGGGATGCTTGCGGG - Intergenic
939670172 2:145001435-145001457 AGTTCAGCAGGGATGCTGTGAGG + Intergenic
942905389 2:181174154-181174176 CCTTCCCTAGTGATGCTGGTAGG - Intergenic
943873381 2:193031201-193031223 CCTTCAGCTGTGATGCTAGGTGG - Intergenic
944594321 2:201247372-201247394 CCTTCAGCATGGATGCTATGGGG - Intronic
946044533 2:216810395-216810417 CTTTCTGCAGGGAAGCTGGAAGG + Intergenic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
946732746 2:222724826-222724848 CCTTTGGCAGGGATGGTAGGGGG + Intergenic
948511140 2:238466131-238466153 CCCTTCCCAGGGATGCTGGATGG - Intergenic
948892415 2:240913974-240913996 CCCCGCCCAGGGATGCTGGGAGG + Intergenic
1170141634 20:13130743-13130765 CCATCCTAATGGATGCTGGGTGG + Intronic
1171313533 20:24166215-24166237 CCTTCAGCAGGAATCCTGTGAGG + Intergenic
1173476557 20:43363982-43364004 TCTTCGGCAAGGTTGCTGGGAGG - Intergenic
1173907066 20:46637158-46637180 CCTGCCCCAGGCATCCTGGGAGG + Intronic
1173923724 20:46765090-46765112 CCTTTCCCTGGGATGCTGGCAGG + Intergenic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1174483041 20:50844716-50844738 CCTGCAGCAGGAGTGCTGGGGGG - Intronic
1174597142 20:51693169-51693191 CCACCCGCAGGGATGCTGCCTGG + Intronic
1176359551 21:5983261-5983283 CCATCTGCAGGGATGGTGTGGGG + Intergenic
1178706957 21:34883988-34884010 CCTTCAGCAGGGAAGTTCGGAGG - Intronic
1178839610 21:36128350-36128372 CCTCCCTCAGGGATTCTGGAAGG - Intergenic
1179763967 21:43555289-43555311 CCATCTGCAGGGATGGTGTGGGG - Intronic
1179840644 21:44070806-44070828 TCTGCTGCAGGGATGCTGGTGGG + Intronic
1181045325 22:20211572-20211594 ACTTCCCCAGGCATCCTGGGAGG + Intergenic
1181435555 22:22908374-22908396 CCTTCACCAGAGCTGCTGGGTGG + Intergenic
1181742307 22:24931097-24931119 CCATCCTCAGTGATGCTGAGGGG - Intergenic
1182313598 22:29427140-29427162 CCTTCACCAGAGCTGCTGGGTGG - Intergenic
1183298625 22:37046933-37046955 CCTGCCGCAAGGGTGCTGTGGGG + Intergenic
1183368136 22:37417916-37417938 CCTTCTGCAGGGAGGCGAGGGGG + Exonic
1183454025 22:37911815-37911837 ACCTCAGCAGGGTTGCTGGGGGG - Intronic
1183618738 22:38960446-38960468 CCATCAGCAGTGATGCAGGGTGG - Intronic
1184310139 22:43635960-43635982 CCCACAGAAGGGATGCTGGGTGG + Intronic
1184880476 22:47301072-47301094 CCTTCCTCAGTGGCGCTGGGAGG + Intergenic
949369046 3:3314941-3314963 CCTACCTCATTGATGCTGGGAGG - Intergenic
950134525 3:10571319-10571341 CCTTCAGCAGGGATGCCAGAGGG + Intronic
950145728 3:10648396-10648418 CCTCCCACATTGATGCTGGGAGG - Intronic
950236608 3:11327044-11327066 TCTTGAGCAGGGATCCTGGGAGG - Intronic
950482825 3:13255186-13255208 CCTTGGGCTGGGGTGCTGGGGGG - Intergenic
950566508 3:13772643-13772665 CCTGCTGCAGGGGTGCTGGAAGG + Intergenic
950597531 3:13997516-13997538 CCTACCCAAGGGAAGCTGGGAGG - Intronic
956952054 3:74294146-74294168 GCTTCCTCAGGGAAGCTTGGAGG + Intronic
957084001 3:75663671-75663693 CCTTCCTCAGTCATCCTGGGAGG - Intergenic
961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG + Intergenic
961450951 3:127002081-127002103 CCACCGGCAGGGGTGCTGGGCGG + Intronic
964509843 3:157438286-157438308 CCTAACGGAGGGAAGCTGGGCGG - Intronic
965839416 3:172886284-172886306 CCTGCACCAGGGATGCTTGGTGG + Intergenic
965882009 3:173397675-173397697 CCCTCCGCGGGGAGGCGGGGAGG - Intronic
966734520 3:183178811-183178833 ACGCTCGCAGGGATGCTGGGAGG + Exonic
967946030 3:194804963-194804985 CTTGCCCCAGGGATGCTGAGTGG - Intergenic
968912883 4:3484882-3484904 CCTTCCCCCGGGCTGTTGGGAGG - Intronic
969441252 4:7218012-7218034 GCTTCCCCAGGTATGCTGGCGGG + Intronic
969928913 4:10611531-10611553 CAGTCTGCAGGGAAGCTGGGAGG + Intronic
970168249 4:13262604-13262626 CCTACCACAGGGATTCTGTGAGG + Intergenic
970345431 4:15148247-15148269 CCTTCGGCACAGATGCTGCGGGG - Intergenic
972414425 4:38824404-38824426 CTTTCCACTGGGATGCAGGGAGG + Exonic
973264531 4:48198186-48198208 GCTTTCCCAGGGATCCTGGGGGG + Intronic
974490487 4:62557887-62557909 TCTTCACCAGGGATGGTGGGAGG - Intergenic
976290689 4:83414352-83414374 CCATCCACAGGGGTGCTGTGGGG + Intronic
985774203 5:1832164-1832186 CCAGCCGCAGGGATTCCGGGAGG + Intergenic
986737837 5:10681247-10681269 CCTTCCGCAGGGACGCTGGTGGG - Intronic
986737988 5:10681895-10681917 CTTCCTGCAGGGATGCTGGTGGG - Intronic
988594810 5:32581748-32581770 CCTTCCCCAGGGCTGGTGTGGGG + Intronic
995686918 5:114781794-114781816 CCCCAGGCAGGGATGCTGGGAGG + Intergenic
997584033 5:135034264-135034286 CCTGCGCCAGGGGTGCTGGGTGG + Exonic
997856010 5:137373457-137373479 CCTTCTACAGGGATGCTGCAGGG - Intronic
1000280985 5:159781940-159781962 CCAACCACAGGGATGCTGGCTGG + Intergenic
1001093727 5:168760553-168760575 CCTACCCCAGGGCTGGTGGGTGG - Intronic
1001535901 5:172497641-172497663 CCTTCTGCAGGGATTTGGGGAGG + Intergenic
1001602024 5:172935093-172935115 CTTTCTGGAGGGTTGCTGGGGGG + Intronic
1002699046 5:181109757-181109779 CCCACCCCAGGGCTGCTGGGAGG + Intergenic
1003075753 6:2982577-2982599 CCTTCCGCAAGAATTCTGTGAGG + Intergenic
1003977127 6:11354866-11354888 CCGTCAGCTGGGTTGCTGGGAGG + Intronic
1008920911 6:56843616-56843638 CCTTCACCGGGGATGCTGCGCGG + Intronic
1010085137 6:71908416-71908438 TCTGCCTCAGGGATACTGGGAGG + Intronic
1017597596 6:156045761-156045783 CCGTCCGCAGGGATTTTTGGAGG - Intergenic
1017841138 6:158224016-158224038 CCTTCTGCAGAGCTGCTGGGTGG - Intergenic
1019117023 6:169773456-169773478 TCTTCTGCAGAGATGCTGGAAGG + Intronic
1020006338 7:4785407-4785429 CCTTCCTCAGGGCTCCTGGAAGG - Exonic
1020040306 7:4996507-4996529 CCTACCCCAGGGTTGCTGGGAGG + Intronic
1020756653 7:12211459-12211481 CCTTCCGGAGCGAGGCTGAGCGG + Intronic
1023819086 7:43970449-43970471 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1023819135 7:43970713-43970735 CCTCCCCTAGGGCTGCTGGGAGG + Intergenic
1027190325 7:75992636-75992658 GCTCCCCCAGGGCTGCTGGGAGG + Intronic
1027229290 7:76262949-76262971 CCTTCCTCTGGGCTGCTGGAAGG - Intronic
1029744139 7:102507408-102507430 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029744186 7:102507676-102507698 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762130 7:102606571-102606593 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1029762177 7:102606838-102606860 CCTCCCCTAGGGCTGCTGGGAGG + Intronic
1031971182 7:128066191-128066213 CCTACCTCAGGGATGAGGGGTGG - Intronic
1032475957 7:132211616-132211638 ACTGCCGCAGGGAGGCTGGGAGG + Intronic
1034438653 7:151075781-151075803 CCTTCCGGTGGGGAGCTGGGGGG - Intronic
1036307973 8:7615897-7615919 CCTCCCCCAGGGCTGCTGTGAGG + Intergenic
1037567695 8:20131268-20131290 CCTTCCCCAGGGTTGCTGCAAGG - Intergenic
1038481687 8:27906270-27906292 TCTTCCGCAGTGATGCTACGAGG + Intronic
1039012886 8:33114528-33114550 CCTTCTGCTGGGATGCTGGCAGG + Intergenic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1039885672 8:41652879-41652901 CCTTCCTAGGGAATGCTGGGGGG + Intergenic
1041777246 8:61536902-61536924 CCTTCAGCAAGGATGATGAGAGG - Intronic
1042118147 8:65455095-65455117 CCTTCCGCAGTAATGCTAGTCGG + Intergenic
1044536196 8:93358865-93358887 CCTTTCACAGGCATGTTGGGAGG - Intergenic
1047417969 8:124681252-124681274 TCTGCCGCTGGGATGCTGAGTGG - Intronic
1048514240 8:135091363-135091385 CCTCCAGCAAGGAGGCTGGGAGG - Intergenic
1048856403 8:138689997-138690019 CCTCCAGCAGGGTTGCTGTGTGG + Intronic
1049195883 8:141315414-141315436 CCTGCCGCAGGGGTCCTGGGTGG - Intergenic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049580615 8:143408939-143408961 CCTTGGGCAGGGATGCTGAGGGG + Intergenic
1051353846 9:16223296-16223318 CCTACCGGAGGGAAGCTGTGAGG + Intronic
1053886433 9:42647500-42647522 TCTTCCGCAGGGAAACTAGGTGG - Intergenic
1054225452 9:62454949-62454971 TCTTCCGCAGGGAAACTAGGTGG - Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056506850 9:87265722-87265744 CCTTCAGCAGGGAGCCTGGAAGG - Intergenic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1057754401 9:97820333-97820355 CCATCTGCAGGGTTGCTGGGAGG - Intergenic
1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG + Intergenic
1059423938 9:114209304-114209326 CCACCCCCAGGGATGCTGGTAGG - Intronic
1059821429 9:117977716-117977738 CCTCACTCAGGGTTGCTGGGAGG + Intergenic
1061396937 9:130348547-130348569 CCGTCCTCCCGGATGCTGGGGGG - Intronic
1062277866 9:135739206-135739228 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062280269 9:135748816-135748838 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062344406 9:136108290-136108312 CCAGGCACAGGGATGCTGGGTGG - Intergenic
1062732854 9:138119327-138119349 CCTTCCACAAGGACACTGGGAGG + Intronic
1190731765 X:53231279-53231301 CCTTCATCAGGGATGTTGGGGGG + Intergenic
1197715697 X:129704719-129704741 CCTTCAGCCAGGATCCTGGGGGG - Intergenic
1200034966 X:153321089-153321111 CTGGCCGCAGGGATTCTGGGTGG - Intergenic