ID: 946155254

View in Genome Browser
Species Human (GRCh38)
Location 2:217802875-217802897
Sequence TATGCGAGTCCCCTAGAGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946155254_946155257 -2 Left 946155254 2:217802875-217802897 CCTCTCTCTAGGGGACTCGCATA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 946155257 2:217802896-217802918 TAGGCTTAAGAATGGAGTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 145
946155254_946155256 -10 Left 946155254 2:217802875-217802897 CCTCTCTCTAGGGGACTCGCATA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 946155256 2:217802888-217802910 GACTCGCATAGGCTTAAGAATGG 0: 1
1: 0
2: 0
3: 1
4: 49
946155254_946155258 15 Left 946155254 2:217802875-217802897 CCTCTCTCTAGGGGACTCGCATA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 946155258 2:217802913-217802935 TCCTGGTGAATTTTCCATTCTGG 0: 1
1: 0
2: 0
3: 26
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946155254 Original CRISPR TATGCGAGTCCCCTAGAGAG AGG (reversed) Exonic
905374239 1:37507736-37507758 TTTGGGAGGCCCCTAGAAAGCGG + Intronic
911728672 1:101269007-101269029 TCTGTAAGCCCCCTAGAGAGTGG - Intergenic
912759793 1:112356771-112356793 TTTGAGAGTCCCCCAGAAAGGGG - Intergenic
916555924 1:165894329-165894351 TAGGGGAGTTGCCTAGAGAGTGG + Intronic
1069940798 10:71953981-71954003 TTTGAGAGTCTCTTAGAGAGAGG + Intergenic
1070648851 10:78220611-78220633 AATCCGTGTCCCCTGGAGAGTGG - Intergenic
1074213375 10:111359970-111359992 TAGGCGAAGCCTCTAGAGAGAGG + Intergenic
1083974861 11:66110023-66110045 TATGTGTGTCCCGTTGAGAGGGG - Intronic
1097232490 12:57521044-57521066 TATGGGAGTCCCTTATAGTGGGG - Intronic
1115532152 14:34337378-34337400 TATGCTAGTCCACTAGAGAAAGG - Intronic
1116073376 14:40078585-40078607 TATGCGTGTGCCCTTGAGGGTGG + Intergenic
1122506877 14:102237257-102237279 TTTGAGAGTCTTCTAGAGAGGGG - Intronic
1134286745 16:12868368-12868390 AATGGGAGTCACCTAGAGGGAGG + Intergenic
1141763787 16:86045725-86045747 TAGGCGTGTCCCCTACAGACAGG - Intergenic
1145098470 17:20052922-20052944 TATGCGTTTGCCCTAGAGACAGG + Intronic
1148558735 17:48593958-48593980 AATGCGAGCCTCCGAGAGAGGGG + Exonic
1148589459 17:48804980-48805002 AATACCAGGCCCCTAGAGAGAGG + Exonic
1157086360 18:44584204-44584226 CATGGGAGTCCCATAGAGGGAGG + Intergenic
925218954 2:2122310-2122332 CATGAGAGTCCCCAGGAGAGAGG - Intronic
946155254 2:217802875-217802897 TATGCGAGTCCCCTAGAGAGAGG - Exonic
948304334 2:236935535-236935557 TCTGGGAGTCCCATGGAGAGAGG + Intergenic
950880846 3:16321590-16321612 GATGGGAGTCCTCCAGAGAGGGG - Intronic
965080017 3:164022657-164022679 TTTGGGAGTCCTCTAGGGAGGGG + Intergenic
984311681 4:178068437-178068459 TATGTGAGTCCCCTAGAACAGGG - Intergenic
987507632 5:18793714-18793736 TATGCAAGTCCACCACAGAGTGG - Intergenic
990036227 5:51323727-51323749 TATACGAGGCCCCTAGATAAAGG + Intergenic
995936712 5:117524953-117524975 TATGCCAGTCCCAAGGAGAGGGG + Intergenic
997109142 5:131055320-131055342 TATGGGAGTCCTAAAGAGAGAGG + Intergenic
1004620028 6:17323904-17323926 TTTGAGAGTCCTCTAGGGAGGGG + Intergenic
1009022604 6:57960940-57960962 TATGAGAGTCCTGGAGAGAGAGG - Intergenic
1027678227 7:81186082-81186104 TATGCGATTCTGCTAGAAAGTGG + Intronic
1032302365 7:130699496-130699518 TATGCTGGTCCACTACAGAGAGG + Intergenic
1034571621 7:151960703-151960725 AATGCGAGATCCCCAGAGAGGGG + Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1040499673 8:47995652-47995674 TTTGAGAGTCTTCTAGAGAGGGG + Intergenic
1045546146 8:103130478-103130500 TCTGCCAGTCCTCTAAAGAGGGG + Intergenic
1046621936 8:116537413-116537435 TAGGCGAGTCCCTTGGAAAGTGG - Intergenic
1047423829 8:124728154-124728176 TAGGCGAATACCCTACAGAGCGG - Exonic
1050758092 9:9032933-9032955 TCTGAGAGTCCCGTACAGAGAGG - Intronic
1194750755 X:97681704-97681726 TATGCCAGTATCCTAGAAAGAGG + Intergenic
1194820143 X:98495833-98495855 GATGGGAGTGACCTAGAGAGAGG - Intergenic
1199529773 X:148833237-148833259 CATGCGAATCACCTTGAGAGGGG - Intronic