ID: 946155980

View in Genome Browser
Species Human (GRCh38)
Location 2:217806875-217806897
Sequence CTTGCAGGCTGGTGGCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 286}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946155964_946155980 18 Left 946155964 2:217806834-217806856 CCACCTCCCCATGTGTCAGACAT 0: 1
1: 0
2: 3
3: 17
4: 180
Right 946155980 2:217806875-217806897 CTTGCAGGCTGGTGGCCATGAGG 0: 1
1: 0
2: 2
3: 28
4: 286
946155969_946155980 10 Left 946155969 2:217806842-217806864 CCATGTGTCAGACATGGCCCTTC 0: 1
1: 0
2: 0
3: 19
4: 175
Right 946155980 2:217806875-217806897 CTTGCAGGCTGGTGGCCATGAGG 0: 1
1: 0
2: 2
3: 28
4: 286
946155967_946155980 12 Left 946155967 2:217806840-217806862 CCCCATGTGTCAGACATGGCCCT 0: 1
1: 0
2: 1
3: 10
4: 161
Right 946155980 2:217806875-217806897 CTTGCAGGCTGGTGGCCATGAGG 0: 1
1: 0
2: 2
3: 28
4: 286
946155974_946155980 -8 Left 946155974 2:217806860-217806882 CCTTCCCTTGGGGAGCTTGCAGG 0: 1
1: 2
2: 2
3: 36
4: 381
Right 946155980 2:217806875-217806897 CTTGCAGGCTGGTGGCCATGAGG 0: 1
1: 0
2: 2
3: 28
4: 286
946155966_946155980 15 Left 946155966 2:217806837-217806859 CCTCCCCATGTGTCAGACATGGC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 946155980 2:217806875-217806897 CTTGCAGGCTGGTGGCCATGAGG 0: 1
1: 0
2: 2
3: 28
4: 286
946155973_946155980 -7 Left 946155973 2:217806859-217806881 CCCTTCCCTTGGGGAGCTTGCAG 0: 1
1: 0
2: 9
3: 79
4: 516
Right 946155980 2:217806875-217806897 CTTGCAGGCTGGTGGCCATGAGG 0: 1
1: 0
2: 2
3: 28
4: 286
946155968_946155980 11 Left 946155968 2:217806841-217806863 CCCATGTGTCAGACATGGCCCTT 0: 1
1: 0
2: 0
3: 15
4: 159
Right 946155980 2:217806875-217806897 CTTGCAGGCTGGTGGCCATGAGG 0: 1
1: 0
2: 2
3: 28
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946155980 Original CRISPR CTTGCAGGCTGGTGGCCATG AGG Intronic