ID: 946158194

View in Genome Browser
Species Human (GRCh38)
Location 2:217820608-217820630
Sequence ACGGCGAAGAAGGGATGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 75}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946158189_946158194 0 Left 946158189 2:217820585-217820607 CCAGGCTAGGGAGGGCAGTGGGC 0: 1
1: 0
2: 6
3: 51
4: 403
Right 946158194 2:217820608-217820630 ACGGCGAAGAAGGGATGGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 75
946158187_946158194 1 Left 946158187 2:217820584-217820606 CCCAGGCTAGGGAGGGCAGTGGG 0: 1
1: 1
2: 8
3: 98
4: 837
Right 946158194 2:217820608-217820630 ACGGCGAAGAAGGGATGGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946158194 Original CRISPR ACGGCGAAGAAGGGATGGTC AGG Intronic
900111549 1:1008263-1008285 ACAGCGGAGAAGGGAAGGTAAGG + Intergenic
901535944 1:9883116-9883138 ACGGCGCAGGAGGGTAGGTCAGG + Intronic
920664395 1:207950764-207950786 AGGATGGAGAAGGGATGGTCAGG + Intergenic
1076488592 10:130840495-130840517 GTGGGGAAGAAGGGATGGTAGGG - Intergenic
1076932886 10:133545539-133545561 ACTGCCAAGAAGGGGTTGTCTGG + Intronic
1077172784 11:1175430-1175452 AGGGGGAAGAAGGGAGGGTGTGG + Intronic
1085023905 11:73225541-73225563 GGGGCCAAAAAGGGATGGTCAGG + Intronic
1091355085 11:134931409-134931431 ATGGAGTAGAAGGGATGGTGGGG + Intergenic
1091621919 12:2095491-2095513 AGGGAGAAGAAGGGGAGGTCAGG - Intronic
1091669159 12:2440004-2440026 ACTGGGAAGAAGGGCTGGGCAGG - Intronic
1096792603 12:54054286-54054308 GCGGCGCTGGAGGGATGGTCGGG - Exonic
1097262746 12:57728684-57728706 TGGGAGAAGAAGGGAGGGTCAGG + Intronic
1101518013 12:105454973-105454995 ACGTGGAAGAAGGGATGGAAGGG - Intergenic
1102469027 12:113149262-113149284 CCAGCTTAGAAGGGATGGTCTGG - Intergenic
1105927325 13:25019209-25019231 ATGGAGAATCAGGGATGGTCTGG + Intergenic
1110506374 13:76292423-76292445 ACAGTGAAGAAGGGATGGAAAGG + Intergenic
1121298146 14:92846970-92846992 AAAGCCAAGAAGGGAAGGTCTGG - Intergenic
1121790097 14:96692774-96692796 AGGGAGAAGAAAGGATGGCCAGG + Intergenic
1122243678 14:100385681-100385703 AAGGGGAGGAAGGGATCGTCAGG - Intronic
1122341101 14:101029054-101029076 ACGGCTAGGGAGGGAGGGTCGGG - Intergenic
1129664727 15:77573212-77573234 ACGGTGGAGAAGGGAAGGGCAGG + Intergenic
1132778035 16:1607172-1607194 ACTGCCAAGAATGGATGGACAGG + Exonic
1133046759 16:3092427-3092449 GAGGTGAAGAAGGAATGGTCAGG + Intronic
1142871410 17:2823485-2823507 TGGGCTAAGAATGGATGGTCAGG - Intronic
1144695911 17:17303734-17303756 AGCGCGATGAAGGGCTGGTCGGG - Exonic
1147242776 17:39101484-39101506 ACGGAGAAGAAGGGAAGGGAGGG + Intronic
1149478274 17:56981879-56981901 ATGGAGAGGAAGGGAGGGTCAGG - Intronic
1152045244 17:77930836-77930858 AAGGCAAAGTAGGGATGGGCGGG - Intergenic
1153460921 18:5332321-5332343 ACGGAGGAGAAGGGAGGGCCAGG + Intergenic
1153819872 18:8824105-8824127 AGGGCAAAGAAGTGGTGGTCAGG - Intronic
1161698484 19:5783060-5783082 ACGGCCAAGAAGGGAAAGCCGGG - Exonic
1162178669 19:8851337-8851359 ACAGCCCAGAAGGGAAGGTCTGG + Exonic
1164634146 19:29780369-29780391 AGGGAGAGGAAGGGCTGGTCTGG - Intergenic
1165952396 19:39481578-39481600 ACGGAGAATAAGGGATGGGAGGG - Intronic
1166706507 19:44910983-44911005 ATGGAGAATGAGGGATGGTCCGG - Intergenic
1168070120 19:53944768-53944790 AAGGCAAAGAAGGGAAGATCTGG - Intergenic
926341367 2:11907359-11907381 ACAGGGAAGAAGGTATGGACAGG - Intergenic
928087145 2:28352942-28352964 AGGGAGAAGAAGGGGTGTTCTGG + Intergenic
928912927 2:36441038-36441060 ACGGAGAAGAAGGGAATTTCAGG + Intronic
929820598 2:45270580-45270602 ACGGCTAAGAAAGAAGGGTCTGG - Intergenic
934085149 2:88503365-88503387 ACGGCGGAGAGGGGAGGCTCAGG - Intergenic
935598245 2:104896652-104896674 ACTGAGCAGAGGGGATGGTCTGG - Intergenic
945198449 2:207258642-207258664 ACTGCCAAGAAGGGAAGGTGTGG + Intergenic
945811252 2:214553065-214553087 ATGGAGAAGAGGGGATGGGCTGG - Intronic
946158194 2:217820608-217820630 ACGGCGAAGAAGGGATGGTCAGG + Intronic
1171400786 20:24871985-24872007 AAGGAGAAGAAGGGAGGGACAGG + Intergenic
1172444684 20:34986853-34986875 AGGGCAGAGAAGGGAGGGTCAGG - Intronic
1176936813 21:14876855-14876877 AGGAAGAAGAAGGGATGATCAGG - Intergenic
1184522616 22:45004335-45004357 AGGGCGATGAAGGGATGGAGGGG + Intronic
1184746341 22:46458365-46458387 TCCGTGAAGAAGGGATCGTCAGG + Intronic
953243574 3:41170645-41170667 AGGTCAAAGAAGGAATGGTCAGG - Intergenic
957048958 3:75396869-75396891 ATGGAGAATCAGGGATGGTCTGG + Intergenic
962386312 3:134935301-134935323 CAGGCGAAGAAGGGAGGGTCAGG + Intronic
966914021 3:184575159-184575181 ACTGGGGAGAAGGGATGCTCAGG + Intronic
968880297 4:3295076-3295098 TCGGGGAAGAAGGGGTGGCCAGG + Intronic
970909669 4:21260080-21260102 ACGGAGAAGGTGAGATGGTCAGG + Intronic
978850834 4:113334149-113334171 ATGGTAAAGAAGCGATGGTCAGG - Intronic
981043279 4:140242869-140242891 ATGGGGAAGAAGGGAAGGGCAGG + Intergenic
981625334 4:146748181-146748203 CCAGGGAAGAAGGGATGCTCTGG - Intronic
987347412 5:16991071-16991093 ACGGAGGAGAAGGGAGGCTCAGG + Intergenic
988264293 5:28928756-28928778 ATGGAGAATCAGGGATGGTCTGG + Intergenic
995412871 5:111878390-111878412 AGGGTGAAGGAGGAATGGTCAGG + Intronic
1007208581 6:40172723-40172745 AATGAGTAGAAGGGATGGTCAGG + Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1018443587 6:163834844-163834866 ACGGCCTAGCAGGGAGGGTCGGG - Intergenic
1020410521 7:7886991-7887013 TGGGTGAAGAAGGGAAGGTCAGG - Intronic
1023372931 7:39530089-39530111 AGGACGGAGAAGGGATGGGCAGG + Intergenic
1043937279 8:86156089-86156111 AGGGTGGAGAAGGGATGGTGAGG - Intergenic
1045829023 8:106435725-106435747 GTGGCGAAGAAGGAATGTTCTGG - Intronic
1049091044 8:140513672-140513694 ACGGCGGACCAAGGATGGTCAGG - Intronic
1049359931 8:142207580-142207602 ATGGGGAAGAATGGATGGACAGG + Intergenic
1053064579 9:35058870-35058892 AAGGCCGAGAAGAGATGGTCAGG - Intronic
1053715723 9:40885307-40885329 ATGGAGAATCAGGGATGGTCTGG + Intergenic
1054076825 9:60545431-60545453 ATGGAGAATCAGGGATGGTCTGG - Intergenic
1186068012 X:5787428-5787450 AAGGCAAAGAAGTGATGGTGAGG - Intergenic
1186813145 X:13209576-13209598 ACAGTAAAGAAGGGGTGGTCTGG - Intergenic
1190508808 X:51156420-51156442 AGGGTGAAGAAGGGATGAGCAGG - Intergenic