ID: 946163556

View in Genome Browser
Species Human (GRCh38)
Location 2:217850108-217850130
Sequence CAGGAAAGGGACGCGGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 182}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946163542_946163556 17 Left 946163542 2:217850068-217850090 CCCCTCCACCAGCAAGCTCAGCC 0: 1
1: 0
2: 1
3: 40
4: 374
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163543_946163556 16 Left 946163543 2:217850069-217850091 CCCTCCACCAGCAAGCTCAGCCC 0: 1
1: 0
2: 1
3: 31
4: 348
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163541_946163556 21 Left 946163541 2:217850064-217850086 CCTACCCCTCCACCAGCAAGCTC 0: 1
1: 0
2: 1
3: 42
4: 480
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163544_946163556 15 Left 946163544 2:217850070-217850092 CCTCCACCAGCAAGCTCAGCCCA 0: 1
1: 1
2: 2
3: 37
4: 452
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163539_946163556 23 Left 946163539 2:217850062-217850084 CCCCTACCCCTCCACCAGCAAGC 0: 1
1: 0
2: 1
3: 33
4: 419
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163540_946163556 22 Left 946163540 2:217850063-217850085 CCCTACCCCTCCACCAGCAAGCT 0: 1
1: 0
2: 0
3: 27
4: 292
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163545_946163556 12 Left 946163545 2:217850073-217850095 CCACCAGCAAGCTCAGCCCATAC 0: 1
1: 0
2: 3
3: 22
4: 184
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163549_946163556 -5 Left 946163549 2:217850090-217850112 CCATACCACTCAAGACTCCAGGA 0: 1
1: 0
2: 1
3: 12
4: 123
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163547_946163556 -4 Left 946163547 2:217850089-217850111 CCCATACCACTCAAGACTCCAGG 0: 1
1: 0
2: 2
3: 5
4: 119
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163551_946163556 -10 Left 946163551 2:217850095-217850117 CCACTCAAGACTCCAGGAAAGGG 0: 1
1: 0
2: 6
3: 36
4: 332
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182
946163546_946163556 9 Left 946163546 2:217850076-217850098 CCAGCAAGCTCAGCCCATACCAC 0: 1
1: 0
2: 2
3: 8
4: 223
Right 946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG 0: 1
1: 0
2: 1
3: 7
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946163556 Original CRISPR CAGGAAAGGGACGCGGGTCC TGG Intronic
900030654 1:370107-370129 CAGGAAAGGGTCACAGGTGCAGG - Intergenic
900051260 1:598778-598800 CAGGAAAGGGTCACAGGTGCAGG - Intergenic
900589558 1:3453667-3453689 CAGGCCAGGGAGGCAGGTCCTGG + Intergenic
900822799 1:4902122-4902144 CAGCAGAGGGACGCTGGGCCTGG + Intergenic
901646412 1:10719211-10719233 CAAGAAAGGGGCACGGGGCCGGG - Intronic
903329639 1:22590677-22590699 CAGGAAAGAGAGGAGGGCCCAGG - Intronic
904612124 1:31731519-31731541 CAGGAAAGGAAACTGGGTCCTGG + Intronic
910553344 1:88501262-88501284 CAGGGAAGGAACTGGGGTCCTGG + Intergenic
914397363 1:147282941-147282963 TAGGATAGAGACGCGGGTCTAGG + Intronic
915936950 1:160095227-160095249 CAGGAATGGGATGCTGGGCCCGG - Exonic
916674591 1:167054786-167054808 CAGGACTGGGAGGCAGGTCCTGG + Intronic
917925597 1:179786862-179786884 CGGGAAAGGGCCTCGGCTCCTGG - Intronic
922182240 1:223244394-223244416 CAGGAAAAGGGCCCGGGTCTAGG + Intronic
922958485 1:229625605-229625627 CAGGAACGCGACGCCAGTCCAGG + Intronic
923089405 1:230728125-230728147 CAGGTAGGGGTCGTGGGTCCAGG + Intergenic
1067175315 10:43941846-43941868 CAGGAAAGGCAGGCTGGGCCTGG + Intergenic
1069659747 10:70115952-70115974 CAGGAAAAGGAAGCCAGTCCAGG - Intronic
1069662564 10:70133021-70133043 CAGGACTGGGGCGCGGGTGCTGG - Intergenic
1069912167 10:71766272-71766294 CAGGAAAATGACCCGGGGCCTGG + Intronic
1069993794 10:72330500-72330522 CAGAAAAGGAACTGGGGTCCAGG + Intergenic
1070723219 10:78770984-78771006 CAGGACAGGGACCCTGGGCCAGG - Intergenic
1071567755 10:86680476-86680498 CAGGCAGGGGACGAGCGTCCAGG + Intronic
1071570247 10:86692753-86692775 GAGGACAGAGACTCGGGTCCAGG - Intronic
1072802843 10:98405260-98405282 CAGGAAGGGGAGGCAGGCCCTGG + Intronic
1073422910 10:103438830-103438852 CAGGGAAGGCACTTGGGTCCGGG - Intronic
1076106478 10:127827515-127827537 CAGGATAGGGCCTCGGGTCTGGG - Intergenic
1076413104 10:130265707-130265729 CTGGGCAGGGCCGCGGGTCCTGG + Intergenic
1076637304 10:131890997-131891019 CAGGAAGGGGACGCAGCTGCAGG - Intergenic
1076781816 10:132728762-132728784 CAGTAAAGGGCAGCTGGTCCTGG + Intronic
1076927129 10:133497139-133497161 CAGGAAAGGGCCCCCTGTCCAGG - Intergenic
1077183807 11:1227739-1227761 CCGGCAAGGGCAGCGGGTCCGGG - Exonic
1077320080 11:1937172-1937194 CAGGAGAGGGAGGAGGCTCCGGG - Intronic
1078549591 11:12270980-12271002 CAGGAAAGGGCCTCTGGACCTGG + Intergenic
1078898640 11:15621153-15621175 CAGGAGCTGGACGTGGGTCCAGG - Intergenic
1081424125 11:42906402-42906424 CAGGACAGGGACCCTGATCCAGG + Intergenic
1081960632 11:47134050-47134072 AAGGAAAGAGAGGAGGGTCCAGG - Intronic
1082088175 11:48067183-48067205 CAGGAAAGGGACTCCTTTCCAGG - Intronic
1083676439 11:64328149-64328171 CAGGAAAGGGACAGGGAACCAGG - Intergenic
1084220369 11:67674244-67674266 CAGGAGAGGGAGGTGGGTGCTGG - Intronic
1084877434 11:72143449-72143471 CAGGAAAGGGAAGGGAGTCTCGG - Intergenic
1088480832 11:110295843-110295865 CAGGCCAGGGCCGCGGTTCCCGG - Intronic
1095971486 12:47904899-47904921 CAGGATAGGGACTCGGGGTCGGG - Exonic
1098786054 12:74757003-74757025 CAGGAAAAGGACACGGATCCAGG + Intergenic
1100830956 12:98516143-98516165 CAGGGTAAGGACGCGGGGCCGGG + Exonic
1102472617 12:113168097-113168119 CAGGAAAGGGCTGCGGGGCCTGG - Intronic
1103359748 12:120346587-120346609 TAGCAGAGGGACGCGGGTCAGGG - Intronic
1104043057 12:125143021-125143043 CAGCACAGGGATGCGGTTCCTGG - Exonic
1104567930 12:129902370-129902392 CAGGAAAGGGGCACGGGTGGGGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1106231604 13:27825228-27825250 CAGGACAGGGAGGCAGGGCCAGG + Intergenic
1107018924 13:35731728-35731750 CAGGTAAGGGATGCAGGACCAGG - Intergenic
1108028188 13:46200555-46200577 CAGTAAAGGGTCGCAGGTGCTGG + Intronic
1113530152 13:111018413-111018435 CAGGACGGGGAGGCGGGTCACGG + Intergenic
1113863538 13:113506688-113506710 CAGGAGAGGAACACAGGTCCAGG - Intronic
1115404124 14:32996514-32996536 CAGCACAGGGACCCGGGGCCCGG - Intronic
1115655449 14:35439284-35439306 GAGGAAAGGGAGGAGGGGCCAGG - Intergenic
1119779019 14:77265969-77265991 CAGGGAAGGGAAGGGGGACCTGG - Exonic
1121377803 14:93430443-93430465 AAGGAGAGGGAGGCGGATCCGGG - Intronic
1122277686 14:100603657-100603679 CAGGATAGAGAGGCGGGACCGGG - Intergenic
1122310380 14:100790570-100790592 CAGGAAATGGAAGAGGGTCTTGG + Intergenic
1123422617 15:20144606-20144628 CAGGACAGGGCCGAGAGTCCAGG + Intergenic
1123531844 15:21151146-21151168 CAGGACAGGGCCGAGAGTCCAGG + Intergenic
1124143208 15:27095912-27095934 CAGGAAGGGAAGGCGGGTCCTGG - Intronic
1124345346 15:28918418-28918440 AAGGACAGGGACTCGGGGCCTGG - Intronic
1124633907 15:31353074-31353096 CAGGGAAGGGACCCTGGGCCAGG + Intronic
1124864239 15:33473349-33473371 CAGGAAGGTGACTCGGGGCCTGG + Intronic
1129288038 15:74541328-74541350 CAGGTAAGTGGCCCGGGTCCGGG + Exonic
1132574915 16:659815-659837 CAGGGCAGGGACGCTGGTGCCGG + Intronic
1136862134 16:33710742-33710764 CAGGACAGGGCCGAGAGTCCAGG - Intergenic
1138111992 16:54331075-54331097 CAGGTAAGGGAGGAGGGACCTGG - Intergenic
1138479107 16:57290074-57290096 CGGGAAGGGGAGGCCGGTCCTGG - Intergenic
1141464992 16:84199401-84199423 CAGGAAGGGTCCGCGGGGCCGGG + Intergenic
1141786219 16:86202476-86202498 AAGGAAAGTGACGCGGCCCCTGG + Intergenic
1203123629 16_KI270728v1_random:1558925-1558947 CAGGACAGGGCCGAGAGTCCAGG - Intergenic
1143376087 17:6468493-6468515 CAGGACAGGAATGCAGGTCCCGG - Intronic
1143904144 17:10196563-10196585 CGGGAAAGGGACGATGGACCAGG - Intronic
1148791069 17:50173299-50173321 CAGGAGAGGGTCGTGGGGCCTGG - Intronic
1151764314 17:76124355-76124377 CAGGCGAGGGGCACGGGTCCTGG + Intergenic
1152663262 17:81552632-81552654 CAGGGTGGGGAAGCGGGTCCTGG + Intronic
1152797390 17:82314986-82315008 CAGGAGAGGGCCGCGTGCCCAGG + Exonic
1152948962 17:83215298-83215320 CAGGAAAGGGTCACCGGTGCAGG + Intergenic
1153093322 18:1372795-1372817 CAGGAAATGGACCCAGGGCCAGG + Intergenic
1153647063 18:7204901-7204923 CAGGAAAGGGAAGGAGGCCCTGG - Intergenic
1157485139 18:48081373-48081395 CAGGAAGGGGAGGCAGTTCCTGG + Intronic
1157818485 18:50748498-50748520 CAGGAGAGGGAGGCAGGTCTAGG - Intergenic
1160801979 19:974464-974486 CAGGCGTGGGACGGGGGTCCCGG - Exonic
1163379581 19:16956283-16956305 CAAGAAAGGGAAGGGTGTCCAGG - Intronic
1163464506 19:17459326-17459348 GAGGAAAGGGAAGGGGTTCCAGG - Intronic
1164934986 19:32203095-32203117 CAGAGAAGGGAGGCTGGTCCCGG + Intergenic
1164974340 19:32560637-32560659 GAGGAAAGGGACCTGGATCCTGG - Intergenic
1166412638 19:42566472-42566494 CAGGACAGGGACGGGGGTCCTGG + Intergenic
1167034247 19:46984393-46984415 CAGGAAAAGGGCTGGGGTCCTGG - Intronic
1168405342 19:56107671-56107693 CAGAAAAGGGAGGGGGGTCTAGG + Intronic
925226301 2:2186265-2186287 CACGAAAGGAACGCGGGACTCGG - Intronic
925854349 2:8115624-8115646 CAGGGAAGAGAAGCCGGTCCTGG + Intergenic
926052308 2:9752977-9752999 AAGGAAGGGGACACGGGCCCTGG + Intergenic
926690418 2:15729360-15729382 CAGGAAAGGGACACAGGAGCTGG + Intronic
927038204 2:19202808-19202830 CAGGACAGGGACACTGGTGCAGG - Intergenic
927100285 2:19782927-19782949 CAGCAAAGGGACCCTGGGCCCGG - Intergenic
932404380 2:71503767-71503789 GAGGAAAAGGAAGAGGGTCCTGG - Intronic
932555934 2:72825271-72825293 CAGGAGAGGGGCGCGGGTTGGGG + Intronic
932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG + Intronic
934460577 2:94212184-94212206 CAGGACAGGGCCGAGAGTCCAGG - Intergenic
937283309 2:120735394-120735416 CAGAGAAGGGACGCGGGGGCTGG - Intergenic
939959532 2:148554116-148554138 CAGGAAGGGGATGCAAGTCCAGG + Intergenic
941803631 2:169688102-169688124 CAGCACAGGGACCCTGGTCCTGG + Intronic
942419940 2:175797273-175797295 CAGCAGAGGGACGCTGGGCCCGG - Intergenic
945868658 2:215203560-215203582 CAGGAAAAGGGCAGGGGTCCTGG - Intergenic
946163556 2:217850108-217850130 CAGGAAAGGGACGCGGGTCCTGG + Intronic
946391471 2:219419136-219419158 CAGGAGAGGGTCCCGGGCCCCGG - Intronic
946601539 2:221365269-221365291 CAGGAAAGTGAAGCAGGTGCAGG + Intergenic
948328998 2:237150463-237150485 CAGGAAAGGGCTGTGAGTCCAGG + Intergenic
948467804 2:238160451-238160473 CAGGAAGTGGAAGAGGGTCCTGG + Intronic
1168949213 20:1785006-1785028 CAGAAAAGGGACACTGGGCCAGG + Intergenic
1169084057 20:2816129-2816151 CAGGAAAGGGACAGGGATCCAGG + Intergenic
1173734177 20:45348008-45348030 CAGGGAAGGGACGAGGGTGTGGG + Intronic
1175279524 20:57793872-57793894 CAGGATGGGGACACGGCTCCAGG - Intergenic
1175920890 20:62450235-62450257 CAGGAAAGAGTGGCCGGTCCCGG - Intergenic
1175927656 20:62478925-62478947 CAGGACAGGGCTGGGGGTCCGGG + Intergenic
1176370823 21:6060533-6060555 CAGGAAAGGGACTCTGGGCGGGG + Intergenic
1179752696 21:43478008-43478030 CAGGAAAGGGACTCTGGGCGGGG - Intergenic
1180151052 21:45948110-45948132 CAGGAGAGGGGCTAGGGTCCTGG - Intergenic
1181355667 22:22294571-22294593 CAGGACAGGGCCGAGAGTCCAGG + Intergenic
1182815143 22:33155842-33155864 CAGCAAAGGGACCCTGGGCCTGG - Intergenic
1183248658 22:36712800-36712822 CTGGAAAGGGAGGCGGGGCCTGG + Intergenic
1183352671 22:37342811-37342833 CAGGAAAGGGAAGCGGGGAGGGG + Intergenic
950542146 3:13619041-13619063 CAGGACAGGGCCCAGGGTCCAGG + Intronic
955035758 3:55265708-55265730 CAGGAAAAGGAGGCTGGTCTGGG + Intergenic
957674260 3:83346788-83346810 CAGTATAGGGACCCTGGTCCTGG - Intergenic
961348239 3:126278686-126278708 CAGGAGAGGAACAGGGGTCCAGG + Intergenic
961442238 3:126959949-126959971 AAGGAAAGGGGAGCGGGTTCTGG + Intronic
962637270 3:137343832-137343854 CAAGACAGGGATGAGGGTCCTGG + Intergenic
968403019 4:315062-315084 CAGCAGAGGGACGCTGGGCCTGG + Intergenic
968426742 4:528758-528780 CAGGAAAGGGAAGAGGGCCAAGG - Intronic
969539483 4:7777989-7778011 CAGGGAAGGGAAGAGGGTGCTGG + Intronic
972581684 4:40400719-40400741 CAGGAAAGTGTCGCTGTTCCTGG + Intergenic
972982830 4:44726420-44726442 CAAGAAGGGGACTCGGGTCGGGG - Intronic
974124530 4:57679492-57679514 CAGGCAAGGGAAGCCAGTCCAGG - Intergenic
976595648 4:86892484-86892506 CAGGGAGGGGACGCCGGGCCCGG + Intronic
985552807 5:541836-541858 CAGGCAAGGGACGGGGCTGCTGG + Intergenic
986169922 5:5307042-5307064 CAGGAAAGGAATGCGAGCCCTGG + Intronic
988886377 5:35563046-35563068 CAGGAAAGGGACCCTGGACCTGG - Intergenic
989350301 5:40478391-40478413 AAGGACAGGGACCCGGGTTCTGG + Intergenic
990547046 5:56833258-56833280 CAGGGAAGAGACGCGGCTTCAGG + Intronic
991435750 5:66596217-66596239 CAGGTAGGGGAGGCGGGGCCCGG - Intergenic
998130312 5:139648473-139648495 CAGGGCTGGGACGCGGGGCCCGG - Exonic
998801453 5:145873681-145873703 CAGGAGAAGGCCGAGGGTCCTGG + Intergenic
1002743167 5:181448761-181448783 CAGGAAAGGGTCACAGGTGCAGG + Intergenic
1003645008 6:7907701-7907723 CAGGAGAGGGAAGGAGGTCCTGG - Intronic
1005991808 6:30907929-30907951 CTGGAGCGGGAGGCGGGTCCGGG - Intergenic
1006240368 6:32672755-32672777 CAGCAAGGGGACGCTGGGCCTGG - Intergenic
1007129137 6:39453305-39453327 CAGTAAAGGGAAATGGGTCCAGG + Intronic
1007633186 6:43283895-43283917 CAGGACAGGGATACGGCTCCTGG - Exonic
1007713317 6:43838527-43838549 CAGGAAAGTGACCTGGGGCCAGG - Intergenic
1010769702 6:79814320-79814342 CAGGACAGGGACTAAGGTCCAGG - Intergenic
1011163613 6:84420589-84420611 TAGGAAAGGGATGTGGGTCTTGG + Intergenic
1011607220 6:89117565-89117587 GCGGAAAGCGACGCGGGCCCGGG + Intronic
1017723138 6:157258390-157258412 CAAGAAAGGCACCTGGGTCCTGG - Intergenic
1018330973 6:162727484-162727506 CAGCTCAGCGACGCGGGTCCGGG - Intronic
1019248268 6:170724174-170724196 CAGGAAAGGGTCACCGGTGCAGG + Intergenic
1019386005 7:756607-756629 CAGGAAAGGTACAAGGGTCCGGG - Intronic
1019542910 7:1559583-1559605 CAGGGGAGGGCCGCGGGACCTGG - Intronic
1019577836 7:1746074-1746096 CAGGTAAGGGATGCGCGTCACGG - Exonic
1022474546 7:30701387-30701409 CAGGAGAGGGAGGTGGGACCTGG - Intronic
1023648171 7:42340852-42340874 CAGGACGGGGACGCGGGTAGGGG + Intergenic
1024508017 7:50179454-50179476 CAGGGAAGGGACTCGGGACATGG + Intergenic
1032016084 7:128381174-128381196 CAGGAGAGGGCCGGGGGGCCAGG - Intergenic
1035499828 8:83538-83560 CAGGAAAGGGTCACAGGTGCAGG - Intergenic
1037771342 8:21801886-21801908 CATGAATGGGACTCGGGTGCTGG + Intronic
1042470585 8:69183115-69183137 CAGGAATGGGAAGAAGGTCCTGG + Intergenic
1042772984 8:72399073-72399095 CAGCAAAGGGACCCTGATCCTGG + Intergenic
1045111299 8:98940982-98941004 CAGCAAAGGGGCTCGGGCCCAGG + Intronic
1045404069 8:101847722-101847744 CAGGAAAGAGACACAGCTCCTGG + Intronic
1047998386 8:130357917-130357939 GAGGAAGGGGACGCGGGGGCCGG - Intronic
1047998520 8:130358399-130358421 GAGCAGAGGGAGGCGGGTCCCGG - Intronic
1049177867 8:141205582-141205604 CAGGAAAGGGGCGCAGCACCGGG + Intergenic
1049421127 8:142517156-142517178 CAGGAAAGGGAGGCTGGCCAGGG + Intronic
1049998302 9:1051412-1051434 CAGGAAAGGCACGTGTGGCCTGG + Intronic
1058014998 9:100021271-100021293 CAGGAAAGGGACACTGGGCTTGG - Intronic
1058539398 9:105995758-105995780 CAGGATGGGGACGCTGGGCCAGG + Intergenic
1060670784 9:125467583-125467605 CAGGGAAGGAAGGCAGGTCCAGG + Intronic
1060939547 9:127535620-127535642 CAGGCAAGGGCCAGGGGTCCAGG + Intronic
1061129934 9:128703037-128703059 CAGGGAAGGGGCGCGGGTGAGGG - Intronic
1203609050 Un_KI270748v1:79796-79818 CAGGAAAGGGTCACAGGTGCAGG + Intergenic
1189318847 X:40075090-40075112 CCGGGAAGGGCTGCGGGTCCCGG - Exonic
1191768046 X:64722237-64722259 AAGGAAGGGGACGTGGATCCTGG + Intergenic
1197823280 X:130563136-130563158 AAGGAAAGGGAAGCGGGTGGGGG + Intergenic
1200292418 X:154886119-154886141 CTGGGAAGGTACGCGGGGCCTGG - Intronic
1200339261 X:155381859-155381881 CTGGGAAGGTACGCGGGGCCTGG - Intergenic
1200347209 X:155458834-155458856 CTGGGAAGGTACGCGGGGCCTGG + Intergenic
1201904957 Y:19078074-19078096 AAGGCAGGGGACGCGGCTCCAGG - Intergenic