ID: 946166831

View in Genome Browser
Species Human (GRCh38)
Location 2:217869571-217869593
Sequence CCTGATGGAGTCTCCCCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 176}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946166825_946166831 1 Left 946166825 2:217869547-217869569 CCACCTGCGTGGGACTCTGAGTG 0: 1
1: 0
2: 1
3: 18
4: 230
Right 946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 176
946166817_946166831 24 Left 946166817 2:217869524-217869546 CCAGGGGTGGCATCAACCCACCC 0: 1
1: 0
2: 1
3: 11
4: 187
Right 946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 176
946166820_946166831 8 Left 946166820 2:217869540-217869562 CCCACCCCCACCTGCGTGGGACT 0: 1
1: 0
2: 2
3: 23
4: 172
Right 946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 176
946166822_946166831 4 Left 946166822 2:217869544-217869566 CCCCCACCTGCGTGGGACTCTGA 0: 1
1: 0
2: 0
3: 11
4: 157
Right 946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 176
946166823_946166831 3 Left 946166823 2:217869545-217869567 CCCCACCTGCGTGGGACTCTGAG 0: 1
1: 0
2: 0
3: 28
4: 465
Right 946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 176
946166827_946166831 -2 Left 946166827 2:217869550-217869572 CCTGCGTGGGACTCTGAGTGGCC 0: 1
1: 0
2: 0
3: 15
4: 140
Right 946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 176
946166824_946166831 2 Left 946166824 2:217869546-217869568 CCCACCTGCGTGGGACTCTGAGT 0: 1
1: 0
2: 0
3: 18
4: 583
Right 946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 176
946166821_946166831 7 Left 946166821 2:217869541-217869563 CCACCCCCACCTGCGTGGGACTC 0: 1
1: 0
2: 2
3: 18
4: 248
Right 946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946166831 Original CRISPR CCTGATGGAGTCTCCCCAGG CGG Intronic
900254771 1:1692455-1692477 CCTGATGCAGTCTCCGCCGCAGG + Exonic
900263522 1:1745730-1745752 CCTGATGCAGTCTCCGCCGCAGG + Exonic
901684122 1:10934362-10934384 CTTCATGGAGTCTCCCCTGCTGG - Intergenic
901769779 1:11524358-11524380 CCTGCTGGAGTCTCCCTCAGAGG + Intronic
902443856 1:16449074-16449096 CCTCATGTTCTCTCCCCAGGTGG + Exonic
902463928 1:16602924-16602946 CCTGATGGAGTCACCATAGTGGG - Intronic
903157169 1:21453750-21453772 CCTGATGGAGTCACCATAGTGGG + Intronic
903337447 1:22634661-22634683 CCTGAGGGAGGCTCTGCAGGAGG - Intergenic
903367199 1:22812319-22812341 CCTCATGGAAAATCCCCAGGTGG - Intronic
904705438 1:32386841-32386863 CCTGACGGAGTTTACCCAGGTGG - Exonic
906113536 1:43340051-43340073 CCTGATGGGATCTCCCTCGGTGG + Exonic
909852173 1:80481798-80481820 CCTTATGCAGTCTCCCCCAGTGG - Intergenic
912510791 1:110188922-110188944 CCTGAGGGAGTCCACGCAGGAGG - Intronic
912645557 1:111388546-111388568 GCTGATGTTCTCTCCCCAGGAGG - Intergenic
914386298 1:147172723-147172745 CCGGGCGCAGTCTCCCCAGGCGG - Intergenic
914913142 1:151802473-151802495 CCTGCTGGAGCCCCCACAGGCGG + Exonic
919813219 1:201422015-201422037 GCAGCTCGAGTCTCCCCAGGTGG - Intronic
920342705 1:205285353-205285375 CCTAGTGGAGTCTACCCGGGAGG - Intergenic
920375331 1:205505096-205505118 CCAGATGGAGACTCCCTAAGGGG - Intronic
921569268 1:216759349-216759371 TCTGACTTAGTCTCCCCAGGTGG + Intronic
922572533 1:226642573-226642595 CCTGTGGGGGTCTCCCGAGGAGG - Intronic
923683664 1:236139780-236139802 CCTGATGGAGTCTCACTCTGTGG + Intergenic
1062964442 10:1596532-1596554 CCTGATGGGGCCTCTCCAGGGGG - Intronic
1067656479 10:48195984-48196006 CCTGATTGACTGCCCCCAGGTGG - Intronic
1071955401 10:90752149-90752171 CCTTATGATGTCTCACCAGGTGG - Intronic
1074203003 10:111256517-111256539 CCTTATGGAGTCTCCAGAGGAGG - Intergenic
1076555906 10:131321258-131321280 CCTTGTGGACTCACCCCAGGCGG - Intergenic
1077108497 11:851964-851986 CCTCATGGAGGACCCCCAGGTGG + Intronic
1080927081 11:36768653-36768675 CCTGTTGGATACTCCCCTGGAGG + Intergenic
1081869303 11:46376124-46376146 CCTGCTGGAGTCTCTCAATGTGG - Exonic
1088648530 11:111937473-111937495 CCTGCTGGGGGCTCCCCGGGCGG - Intronic
1089336299 11:117726049-117726071 CCTGATGGATCATCCCCAGAGGG + Intronic
1090831495 11:130423842-130423864 GCTAATGGAGTCTTCCCAGGTGG + Intronic
1091120646 11:133054884-133054906 CCTCATGGAGTCTCACCACTTGG - Intronic
1091120674 11:133055069-133055091 CCTCATGGAGTCTCACCACTTGG - Intronic
1091120696 11:133055193-133055215 CCTCATGGAGTCTCACCACTTGG - Intronic
1091120763 11:133055627-133055649 CCTCATGGAGTCTCACCACTTGG - Intronic
1091120792 11:133055813-133055835 CCTCATGGAGTCTCACCACTTGG - Intronic
1091120825 11:133055999-133056021 CCTCATGGAGTCTCACCACTTGG - Intronic
1100925892 12:99547608-99547630 CCTGAAAGTGTCTCCCTAGGAGG + Intronic
1102698949 12:114822648-114822670 CCTGCCTTAGTCTCCCCAGGAGG + Intergenic
1103580213 12:121909183-121909205 CCTGATGGAGTGTGTCAAGGAGG + Intronic
1104771250 12:131366204-131366226 TGAGCTGGAGTCTCCCCAGGTGG + Intergenic
1107787490 13:43970493-43970515 CCTGCTGGAGTCTCTCAATGTGG - Intergenic
1112832226 13:103467070-103467092 CCAGATGGAGACTTCCCAGTGGG + Intergenic
1114458454 14:22872193-22872215 CCTGGTGCCGCCTCCCCAGGGGG - Exonic
1118324943 14:64774365-64774387 CCTGACCGAGTCACCACAGGGGG + Intronic
1128185114 15:65638189-65638211 CCGTATGGAGTCTGCCCAGTGGG + Intronic
1130026962 15:80278389-80278411 TCTGATGGAGTCTTTGCAGGAGG + Intergenic
1133987538 16:10679999-10680021 CCAGATGGAGTCTCCAGATGGGG + Intronic
1135589417 16:23694632-23694654 TGTCATGGAGTCTCCTCAGGAGG + Intronic
1136424760 16:30162289-30162311 CCTGCCACAGTCTCCCCAGGAGG - Intergenic
1140306559 16:73808137-73808159 CATCATGGAGTGTTCCCAGGAGG - Intergenic
1140980288 16:80102309-80102331 CCTGAGAGATTCTCCCCAGATGG - Intergenic
1141829244 16:86500499-86500521 GCTGGTGGGGCCTCCCCAGGAGG + Intergenic
1141848483 16:86627554-86627576 CATGCTGGAGACACCCCAGGAGG - Intergenic
1142052364 16:87967045-87967067 CCTGAAGGAGGTTTCCCAGGGGG + Intronic
1142467792 17:146061-146083 CCTGAGTGAGACTCCCCAGGAGG - Intergenic
1142983047 17:3682325-3682347 CCAGAGGGAGAGTCCCCAGGAGG - Intronic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1144637499 17:16919650-16919672 CCTTTTGGAGACTCCCCAAGGGG - Intergenic
1145017938 17:19411187-19411209 GCTGCTGGACTCACCCCAGGGGG - Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146910613 17:36646310-36646332 CCAGATGGAGCGGCCCCAGGTGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147303653 17:39548903-39548925 CCTGAGGGCCCCTCCCCAGGAGG + Intronic
1147604914 17:41769120-41769142 CCTGATGGGCTCGCCCCAGCTGG - Exonic
1147807290 17:43140819-43140841 TTTCATGGACTCTCCCCAGGCGG + Intergenic
1148279627 17:46337927-46337949 TTTCATGGACTCTCCCCAGGCGG - Intronic
1148301844 17:46555783-46555805 TTTCATGGACTCTCCCCAGGCGG - Exonic
1148321681 17:46759663-46759685 CCTAATGCCGTCTCCCCTGGTGG - Intergenic
1148366331 17:47058302-47058324 TTTCATGGACTCTCCCCAGGCGG - Intergenic
1148719489 17:49740689-49740711 CCTGGGGGAGTATCCCCTGGGGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150400390 17:64851548-64851570 TTTCATGGACTCTCCCCAGGCGG + Intergenic
1151374238 17:73673250-73673272 TGAGATGGAGTCTCCCAAGGTGG - Intergenic
1154231386 18:12559139-12559161 GCAGATGGAGCCTCCCCAGGGGG - Intronic
1156032151 18:32725131-32725153 CCTGATGCAGCCTCCCAAGTAGG + Intronic
1156775456 18:40782412-40782434 CCTCTTTGAGTCTTCCCAGGTGG + Intergenic
1157881887 18:51328643-51328665 CCTTCTGGAGTCTCTCGAGGAGG + Intergenic
1159891256 18:73955340-73955362 TCTGGTGGAGTGTCCCCAGAAGG - Intergenic
1161405013 19:4086558-4086580 CCTGTGGAATTCTCCCCAGGTGG - Intergenic
1162227954 19:9240054-9240076 CGAGATGGGGTCTCCCTAGGTGG + Intergenic
1162404968 19:10468033-10468055 CCAGGTAGAGACTCCCCAGGCGG - Exonic
1163697145 19:18769664-18769686 CCTGGGGGAGGCTCCCAAGGTGG + Intronic
1167269264 19:48498640-48498662 CCAGAGGGAGCCTTCCCAGGTGG - Exonic
1202679586 1_KI270711v1_random:40364-40386 CCTGATGGAGTCACCATAGTGGG - Intergenic
931771541 2:65502032-65502054 CCTGATGGAGTCTCTCAACTAGG - Intergenic
932004354 2:67913185-67913207 CCTGAGGGAAACTCTCCAGGTGG - Intergenic
936015715 2:108957476-108957498 GCTCATGGAGGCCCCCCAGGGGG + Intronic
936018149 2:108975093-108975115 CCTGCTGCACTCGCCCCAGGTGG - Intronic
942076185 2:172359098-172359120 CCTGAGGGAGACTGCACAGGTGG - Intergenic
943817717 2:192277373-192277395 CCTAATAGAGGCTCCCCATGAGG + Intergenic
946166831 2:217869571-217869593 CCTGATGGAGTCTCCCCAGGCGG + Intronic
1171436705 20:25130259-25130281 TCAGATGGATTCTCCTCAGGTGG + Intergenic
1172203080 20:33140443-33140465 CCAGATGGTGTTTCCCCAGGTGG - Intergenic
1172656697 20:36542176-36542198 CCTGATGGACTCACCCCTAGGGG + Intronic
1174094028 20:48073744-48073766 CCTGAAGGACTTTTCCCAGGAGG + Intergenic
1174368575 20:50071266-50071288 CCTGCTGGAGGCTCCCAAAGCGG - Intergenic
1175637209 20:60595841-60595863 GCTGATAAACTCTCCCCAGGTGG + Intergenic
1176078873 20:63261715-63261737 CCTGATGGAGGCCCCACATGGGG + Intronic
1176383639 21:6126431-6126453 CCTGTGGGAGGCTCCCCAAGGGG - Intergenic
1177559340 21:22730054-22730076 TCTGGTGGAGTATCCCCAGAAGG + Intergenic
1178711672 21:34922668-34922690 CCTGCTGGAGTCCCCCCTGGTGG + Intronic
1179739831 21:43411807-43411829 CCTGTGGGAGGCTCCCCAAGGGG + Intergenic
1179882143 21:44297318-44297340 CCTGAAGGAGCCACCCGAGGAGG + Intronic
1180056030 21:45359657-45359679 CCTGGAGGAATCTCCCCAGTGGG - Intergenic
1181434722 22:22904117-22904139 CCAGGGGGAGTCTCCCCAAGTGG + Intergenic
1184034953 22:41913887-41913909 CCTGCTCGAGTCTCCTCTGGAGG - Intronic
1184148443 22:42624804-42624826 CGGGGTGGACTCTCCCCAGGAGG + Intronic
950004631 3:9683908-9683930 ACTGAGGTAGTCTCCCCTGGGGG - Intronic
950809996 3:15641988-15642010 CTTCATGCCGTCTCCCCAGGTGG + Exonic
951147871 3:19251152-19251174 CCTGTGGGAGTCTCCAGAGGGGG - Intronic
953462814 3:43095197-43095219 CCAGATGGAGTCTTGCCATGAGG + Intronic
961043535 3:123693742-123693764 CCTGAGGGAACCTCCCCAAGGGG - Intronic
963001731 3:140687981-140688003 CCTGAAGGAGACTGGCCAGGTGG + Exonic
968273160 3:197420398-197420420 GCTGATGCTGTCTGCCCAGGCGG + Intergenic
968283238 3:197492861-197492883 CCAGATGGGGTCTCCTCAGAGGG - Intergenic
968474832 4:799333-799355 TCCGATGGAGTCTCCTCAAGAGG + Intronic
969177595 4:5410655-5410677 CCTGATGGAATAACCCCACGTGG - Intronic
969581303 4:8067160-8067182 GCCCATGGAGTCTTCCCAGGAGG - Intronic
972915748 4:43876786-43876808 GCAGATGGAGTCTCCAAAGGAGG + Intergenic
974664275 4:64937578-64937600 TCTGGTGGAGTGTCCCCAGAAGG + Intergenic
975696177 4:77015549-77015571 CAGGATGGAGACTCACCAGGAGG - Intronic
980784306 4:137532581-137532603 GCTGATGGAGTCACCCAAGGAGG + Intergenic
982198800 4:152939651-152939673 AGTGATGGACTCTCCCAAGGAGG - Intronic
984511710 4:180686360-180686382 CTGGATGGAGACTCCACAGGAGG + Intergenic
986801714 5:11267238-11267260 CCTGATGGATTCTCCCCACGTGG + Intronic
990868323 5:60403758-60403780 CCTGATGCTGTCTCTCCAGCAGG + Intronic
991556887 5:67905134-67905156 CCTGATGAATTCTTCCCAGTGGG + Intergenic
1000047780 5:157535755-157535777 CCTGATGGGGCCACCCCAAGGGG + Intronic
1001916102 5:175561435-175561457 TCTGGTGGAGTGTCCCCAGAAGG - Intergenic
1002468954 5:179423210-179423232 CCTGCAGGAGTCTCCTCAGCAGG + Intergenic
1002661784 5:180796244-180796266 GCTGGTGAAGTCTCCCCAGGAGG - Intronic
1004281471 6:14282939-14282961 CCTGATGTCATCTCACCAGGTGG - Intergenic
1005862503 6:29912329-29912351 CCTGGTGGGGGCTCCCCATGTGG - Intergenic
1007177681 6:39908012-39908034 CTTGATGGCATCTCCCCAGAAGG - Intronic
1007950368 6:45866831-45866853 CCTGATGGGACCTACCCAGGCGG - Intergenic
1010763475 6:79751002-79751024 ACTGATGACTTCTCCCCAGGAGG + Intergenic
1015565404 6:134564921-134564943 GCTGTTGGTGTCTCCCCAGCTGG - Intergenic
1016749781 6:147619887-147619909 CCTGATGGAGTCACTGCAGAGGG + Intronic
1017657674 6:156645595-156645617 CCTGGGGCAGTCTCCCCAGGTGG + Intergenic
1018680131 6:166257758-166257780 CCTGCTGGGGTCTCACAAGGCGG + Intergenic
1019143479 6:169962392-169962414 CCTGAGGGCGTCTCACCGGGAGG - Intergenic
1021803194 7:24328628-24328650 CTTGATGGTGTCTTCACAGGAGG + Intergenic
1025205838 7:56992957-56992979 GCTGCTGGAGCCTCCCCTGGGGG + Intergenic
1025666102 7:63583981-63584003 GCTGCTGGAGCCTCCCCTGGGGG - Intergenic
1027611327 7:80364786-80364808 CCTAATGGAGTTTACCCAGTTGG + Intergenic
1035125505 7:156605740-156605762 CGTGATGGGATCTCACCAGGAGG + Intergenic
1035288372 7:157820958-157820980 CCTGGTGGAGTCTCCCACGCTGG + Intronic
1035288384 7:157821007-157821029 CCTGGTGGAGTCTCCCATGCTGG + Intronic
1035373133 7:158391897-158391919 CCTGAGGGCGTCATCCCAGGTGG - Intronic
1036223891 8:6942582-6942604 CCTGATGTCCTGTCCCCAGGAGG - Intergenic
1042794794 8:72649838-72649860 CCTGTTGGAGTCATTCCAGGTGG - Intronic
1044927750 8:97223872-97223894 CCTGATGCAGAGTCCCCTGGAGG - Intergenic
1045847803 8:106658103-106658125 CCTGAGGGAGCCAGCCCAGGGGG + Intronic
1048374663 8:133812727-133812749 CAGGATTGAGTCTCCCAAGGTGG - Intergenic
1048454484 8:134565647-134565669 GCTCATGGGGCCTCCCCAGGTGG - Intronic
1049441276 8:142610889-142610911 CCTGATGGAGGCTGCCCTGTTGG + Intergenic
1050033893 9:1414819-1414841 GCTTTTGGAGTATCCCCAGGAGG + Intergenic
1052669571 9:31538791-31538813 TCTGGTGGAGTGTCCCCAGGAGG - Intergenic
1056201178 9:84278306-84278328 CCTGGTGAAGTCATCCCAGGAGG - Exonic
1059312914 9:113400946-113400968 ATCGATGGAGTCTGCCCAGGCGG + Intronic
1060110319 9:120902182-120902204 CAGGATGAAGTCTCCGCAGGGGG - Intergenic
1060110960 9:120905896-120905918 CAGGATGAAGTCTCCGCAGGGGG - Intronic
1060301484 9:122376953-122376975 CCTTATAGAGTTTCTCCAGGAGG + Intronic
1060816561 9:126638301-126638323 CCGGATGGAGTTTCCCTGGGAGG + Intronic
1061896800 9:133652448-133652470 CCTGAGTGAGTCTCCCCATGAGG - Intronic
1061931427 9:133834953-133834975 CCCCATGGGGTCTCCCCAGAAGG + Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1185614658 X:1413490-1413512 CCTGATTCAGGCGCCCCAGGAGG + Intronic
1186750467 X:12616472-12616494 CTTAATGGAGTCTTCCCAGATGG + Intronic
1188984072 X:36753856-36753878 CCTGCTGGATTGTCCCCAGAGGG + Intergenic
1189448946 X:41108995-41109017 GTTGATGGTATCTCCCCAGGAGG - Intronic
1190097739 X:47495490-47495512 CCTAATGGAATCTCCCCTGCTGG - Intergenic
1192215884 X:69157768-69157790 CCTGAGGTGGTCTCCCCAGCTGG - Intergenic
1194419052 X:93649842-93649864 CCTAATAGAGTTTCCCCATGAGG - Intergenic
1196862420 X:120040726-120040748 CCTGTTGGAGCCACCCCATGTGG - Intergenic
1196880682 X:120195618-120195640 CCTGTTGGAGCCACCCCATGTGG + Intergenic
1200392649 X:155959283-155959305 TCTGGTGGAGTGTCCCCAGAAGG + Intergenic