ID: 946166999

View in Genome Browser
Species Human (GRCh38)
Location 2:217870356-217870378
Sequence CTGGAAACAGAAAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2476
Summary {0: 1, 1: 1, 2: 19, 3: 237, 4: 2218}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946166992_946166999 8 Left 946166992 2:217870325-217870347 CCCACCACCTAGCAGGGGATCAG 0: 1
1: 0
2: 1
3: 18
4: 199
Right 946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG 0: 1
1: 1
2: 19
3: 237
4: 2218
946166988_946166999 25 Left 946166988 2:217870308-217870330 CCAGGGCTTACACAGTGCCCACC 0: 1
1: 0
2: 0
3: 17
4: 189
Right 946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG 0: 1
1: 1
2: 19
3: 237
4: 2218
946166993_946166999 7 Left 946166993 2:217870326-217870348 CCACCACCTAGCAGGGGATCAGT 0: 1
1: 0
2: 1
3: 16
4: 145
Right 946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG 0: 1
1: 1
2: 19
3: 237
4: 2218
946166986_946166999 27 Left 946166986 2:217870306-217870328 CCCCAGGGCTTACACAGTGCCCA 0: 1
1: 0
2: 1
3: 18
4: 294
Right 946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG 0: 1
1: 1
2: 19
3: 237
4: 2218
946166987_946166999 26 Left 946166987 2:217870307-217870329 CCCAGGGCTTACACAGTGCCCAC 0: 1
1: 0
2: 0
3: 23
4: 182
Right 946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG 0: 1
1: 1
2: 19
3: 237
4: 2218
946166994_946166999 4 Left 946166994 2:217870329-217870351 CCACCTAGCAGGGGATCAGTTAA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG 0: 1
1: 1
2: 19
3: 237
4: 2218
946166995_946166999 1 Left 946166995 2:217870332-217870354 CCTAGCAGGGGATCAGTTAAGTA 0: 1
1: 0
2: 1
3: 7
4: 63
Right 946166999 2:217870356-217870378 CTGGAAACAGAAAGGAAGGAAGG 0: 1
1: 1
2: 19
3: 237
4: 2218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946166999 Original CRISPR CTGGAAACAGAAAGGAAGGA AGG Intronic
Too many off-targets to display for this crispr