ID: 946167876

View in Genome Browser
Species Human (GRCh38)
Location 2:217876401-217876423
Sequence TGTTAGCCAGAGCACTGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946167872_946167876 16 Left 946167872 2:217876362-217876384 CCAAGTTGCTAATGGGGTTTCTG 0: 1
1: 0
2: 0
3: 11
4: 160
Right 946167876 2:217876401-217876423 TGTTAGCCAGAGCACTGAGCCGG 0: 1
1: 0
2: 1
3: 18
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946167876 Original CRISPR TGTTAGCCAGAGCACTGAGC CGG Intronic
901755417 1:11438798-11438820 TGGTAGAAAGAGCACTAAGCTGG - Intergenic
903198141 1:21709029-21709051 TGTTAGCCAGACTACTCAGGAGG - Intronic
904483131 1:30806530-30806552 TGTCAGCCACAGAACTGGGCAGG - Intergenic
906026080 1:42675301-42675323 TGTTAGCCACAGCTGTGGGCAGG - Intronic
906176236 1:43775512-43775534 TGTGAGCCACCGCACTCAGCCGG + Intronic
906929548 1:50155779-50155801 CATTACCCAGAGCCCTGAGCTGG + Intronic
908953181 1:69587511-69587533 TGTTAGCCACATCAAAGAGCTGG - Intronic
910610061 1:89131677-89131699 AGTTTGACAGGGCACTGAGCTGG - Intronic
911516942 1:98879157-98879179 TGTTAGACAGATCAATGAGACGG - Intergenic
914353356 1:146859820-146859842 TATTAGTCAGAGCCCTGGGCAGG + Intergenic
914704966 1:150162847-150162869 TGTTAGCCAGGGGCCTGAGGAGG + Intronic
914984252 1:152442557-152442579 GGGTCGCCAGTGCACTGAGCGGG - Intergenic
915199863 1:154219646-154219668 TGCTTGCCACAGCACTGAGCAGG + Intronic
915305900 1:154978111-154978133 TTTTAGCCAGTGCACTGACCTGG - Exonic
918238121 1:182599560-182599582 GGCCACCCAGAGCACTGAGCTGG + Exonic
1062776092 10:149260-149282 TGTGAGGCAGAACACTGAGGTGG + Intronic
1069831424 10:71284527-71284549 TGTTAGCCACTGCAATGTGCAGG + Intronic
1070010744 10:72471521-72471543 GGTCAACCAGAGCACTGAGCAGG - Intronic
1070687786 10:78502515-78502537 TTAAAGCCAGAGCAGTGAGCAGG - Intergenic
1072964290 10:99957552-99957574 TGTAAGCCACAGCACCTAGCTGG - Intronic
1074660684 10:115653799-115653821 TATGAGCCAGGGCACTGTGCAGG - Intronic
1074831785 10:117254654-117254676 TGGTAGGAAGAGCCCTGAGCTGG + Intronic
1075067827 10:119301532-119301554 TGTTACCCACAGCACAGAGGTGG + Intronic
1076159490 10:128232401-128232423 TGTTCCACAGAGCACAGAGCTGG - Intergenic
1077221581 11:1420381-1420403 TGTTAGCCAGAGTGCAGGGCAGG - Intronic
1078490353 11:11762515-11762537 TGTTAGGAAGAACCCTGAGCTGG - Intergenic
1079192937 11:18296809-18296831 TGTGAGCCACAACACTGATCTGG + Exonic
1081139647 11:39483040-39483062 TGTAAGACTGAGCACTGTGCTGG - Intergenic
1083680564 11:64349807-64349829 TGTTGGAGAGAGCACTGTGCTGG + Intronic
1085857012 11:80186501-80186523 AGTTCTCCAGAGCAATGAGCTGG + Intergenic
1087902905 11:103662799-103662821 TGATAGAAAGAGCACTGGGCTGG + Intergenic
1091258728 11:134216424-134216446 TGATTGTCAGAGCACTGAGGAGG - Intronic
1092513610 12:9184632-9184654 TGTCAGCCAAAGCACTTTGCAGG - Intronic
1096346328 12:50850295-50850317 TGTGAGCCAATGCACTTAGCTGG - Intronic
1102134559 12:110562510-110562532 TGTGAGCCACTGCACTGGGCCGG - Intronic
1104597592 12:130130680-130130702 TGTTAGCCAAAGCAGTCCGCTGG + Intergenic
1108878899 13:55084665-55084687 CGTGAGCCACTGCACTGAGCTGG + Intergenic
1109509005 13:63344132-63344154 TGTGACCCAAAGCACTGTGCAGG - Intergenic
1111706034 13:91750587-91750609 TGCTAGCTTGAGCATTGAGCTGG + Intronic
1112448601 13:99489670-99489692 GGTTTGACACAGCACTGAGCTGG - Intergenic
1113317589 13:109199259-109199281 TGTTACCCAGGGCACAGAGATGG - Intronic
1119014259 14:71032918-71032940 TGTCCTCCACAGCACTGAGCAGG - Intronic
1119693986 14:76698207-76698229 TGATATACAGAGCACTGCGCAGG - Intergenic
1120250487 14:82057200-82057222 TGTGAGTCAGTGGACTGAGCGGG - Intergenic
1123059362 14:105587507-105587529 TGCAAACCAGAGCACTGAGCAGG + Intergenic
1123083693 14:105707738-105707760 TGCAAACCAGAGCACTGAGCAGG + Intergenic
1123473096 15:20569191-20569213 TGTGAGCCAGAGCCCTGCTCTGG + Intergenic
1123644910 15:22431162-22431184 TGTGAGCCAGAGCCCTGCTCTGG - Intergenic
1123733397 15:23164202-23164224 TGTGAGCCAGAGCCCTGCTCTGG + Intergenic
1123751526 15:23361573-23361595 TGTGAGCCAGAGCCCTGCTCTGG + Intronic
1124283899 15:28385498-28385520 TGTGAGCCAGAGCCCTGCTCTGG + Intronic
1124298799 15:28526116-28526138 TGTGAGCCAGAGCCCTGCTCTGG - Intronic
1125753529 15:42046675-42046697 TGGGAGAGAGAGCACTGAGCAGG - Intronic
1125902879 15:43365478-43365500 TGTGAGCCACCACACTGAGCTGG - Intronic
1127906044 15:63376922-63376944 TGTGAGCCACAGCACCCAGCTGG + Intronic
1132733140 16:1372777-1372799 TGTTGGCCACAACACTGGGCTGG - Intronic
1136603332 16:31312708-31312730 TGTGAGCCACTGCACTCAGCCGG + Intronic
1139980667 16:70855698-70855720 TATTAGTCAGAGCCCTGGGCAGG - Intronic
1141725976 16:85788628-85788650 TGTTGGGCAGAGCACTGGGAAGG - Intronic
1141776266 16:86124556-86124578 TGCTAACCAAAGCACTGAACAGG + Intergenic
1143481345 17:7229224-7229246 TGTTGGCCAGAGCAATGAGCGGG - Exonic
1144797455 17:17901900-17901922 CGTGAGCCAGAGCACCCAGCTGG - Intronic
1146089624 17:29863329-29863351 TGTTAGCCTGAGTACTGGACTGG - Intronic
1146445987 17:32933366-32933388 CCTTTGCCAGAGCACTTAGCTGG + Intronic
1151962080 17:77410869-77410891 TGGGAGCCAGAACACAGAGCAGG - Intronic
1152519352 17:80846209-80846231 TTTTGGCCAGGGCACCGAGCTGG - Intronic
1158095743 18:53768493-53768515 TATTAGACAGATCACTGAGATGG + Intergenic
1158123782 18:54079924-54079946 TGAAAGCCAGAAGACTGAGCAGG + Intergenic
1160140936 18:76322311-76322333 TGTGACTCAGAGCCCTGAGCAGG - Intergenic
1160829893 19:1098923-1098945 AGTCAGCCTGAGGACTGAGCAGG + Intergenic
1163611321 19:18303399-18303421 TGTGAGCCACAGCACCCAGCCGG + Intergenic
1163921313 19:20292314-20292336 TGTGATACAGAGCACTGTGCTGG - Intergenic
1163945736 19:20531737-20531759 TGTGAGCCACAGCACCCAGCTGG + Intergenic
925264988 2:2560727-2560749 TCTTAAGGAGAGCACTGAGCAGG - Intergenic
926090757 2:10047768-10047790 TAGTGGCCAGAGCTCTGAGCGGG + Exonic
927850201 2:26494087-26494109 TGGTGGCCAGAGCCCTGGGCTGG + Intronic
929409209 2:41677712-41677734 TGTGAGCCACAGCACCTAGCCGG + Intergenic
930036392 2:47088032-47088054 TGTGAGCCACAGCACCCAGCCGG + Intronic
932565105 2:72901245-72901267 TGTGAGCAAAAGCACTGAGCGGG + Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
934097563 2:88620665-88620687 TGTGAGCAAGGGCACAGAGCAGG - Intronic
935805910 2:106747529-106747551 ATTTGGCCAAAGCACTGAGCTGG + Intergenic
936656472 2:114493848-114493870 TGGGAGACAGAGCACTGAACTGG + Intronic
939875714 2:147575069-147575091 AGGTATCCAGAGAACTGAGCTGG - Intergenic
943670686 2:190657308-190657330 TTTTATCCAGAGGACTGAGGTGG + Intronic
946167876 2:217876401-217876423 TGTTAGCCAGAGCACTGAGCCGG + Intronic
1168871920 20:1136326-1136348 TCACAGCCAGAGCACTGTGCAGG - Intronic
1170016033 20:11783256-11783278 TGTTAGGCAGATCACTCTGCTGG - Intergenic
1170968606 20:21099088-21099110 ATTTAGCCAAAGCACTGAGTTGG - Intergenic
1172151875 20:32796534-32796556 TGTCAGGCAGAACGCTGAGCAGG - Intronic
1172689576 20:36781196-36781218 TCTTAAAAAGAGCACTGAGCAGG - Exonic
1173092656 20:39988260-39988282 TGTGAGCCATAGCACCCAGCTGG + Intergenic
1174396383 20:50249608-50249630 TGCTAGACAGAGCAGTGAACAGG + Intergenic
1174673400 20:52330105-52330127 TGTTACTCCCAGCACTGAGCAGG + Intergenic
1175156976 20:56977742-56977764 GGTCATCCAGAGGACTGAGCTGG - Intergenic
1180596877 22:16982174-16982196 TCCTAGCCAGAGCAATGAGAAGG + Intronic
1181470582 22:23136908-23136930 TGTTGCCCAGATCACAGAGCAGG + Intronic
1183872501 22:40750584-40750606 TGTGAGCCACTGCACTGAGCCGG + Intergenic
1184406383 22:44303070-44303092 TGTTACACAGAGCACTTAGATGG - Intronic
1184675019 22:46036851-46036873 TGTTAGCCTGTGTGCTGAGCCGG + Intergenic
1185385154 22:50528511-50528533 TGTCATCCAGAGCCCAGAGCAGG - Exonic
949320000 3:2798790-2798812 TGTTAGCCACTGCACCCAGCTGG + Intronic
950505424 3:13391594-13391616 TGTTATGCACTGCACTGAGCTGG - Intronic
950574998 3:13827107-13827129 TGTGTCCCAGAGCACAGAGCTGG + Intronic
952841171 3:37646749-37646771 TGTTTGCCAGAGGACTTAGGAGG + Intronic
955359420 3:58260274-58260296 TTTCAGCCACGGCACTGAGCTGG - Intronic
960714813 3:120564490-120564512 TGTGAGCCACAGCACCCAGCAGG - Intergenic
962899540 3:139746978-139747000 TGATAGCCAGACCAATGAGGTGG - Intergenic
963005792 3:140725165-140725187 TGTGAGCCTGAGAACTGAGCTGG + Intergenic
968855998 4:3122454-3122476 TGTTTGCCAGAACCATGAGCAGG + Intronic
972754373 4:42029841-42029863 TGCTAGCCAGTGCACTGAACAGG - Intronic
979867273 4:125772051-125772073 TGTGAGCCACTGCACTGGGCCGG + Intergenic
980852539 4:138400467-138400489 TGGTAGCCAAAACACTGAGAAGG - Intergenic
982201526 4:152966416-152966438 TGTTACCCAGAAAACTGAGTAGG - Intronic
982685198 4:158480637-158480659 TGTGAGCCAGTGCACTCAGCCGG - Intronic
984041396 4:174739022-174739044 TGTAAGCCAGAGATCTGAGCAGG - Intronic
988624241 5:32853975-32853997 TCCTAGCCATAGCTCTGAGCAGG + Intergenic
989168790 5:38455263-38455285 TGTGAGCCAGAGCACCAAGGTGG - Intronic
989360354 5:40594828-40594850 TGTCAGCCAGAGAGATGAGCAGG + Intergenic
991273884 5:64820304-64820326 TTTCAGCCAGAGCAGTGACCTGG + Intronic
991663064 5:68969653-68969675 TGATAGCCAGAGCACTGGGTGGG + Intergenic
993564555 5:89457347-89457369 TGTTGGCTAGAACACTGAGCTGG + Intergenic
995326641 5:110897289-110897311 TGTTTTCCTGAGCACTGAGGAGG + Intergenic
997421903 5:133776148-133776170 TGCCACCCAGAGCACAGAGCAGG - Intergenic
999192575 5:149759601-149759623 AGTTAGCCTGAGCCCTGGGCTGG + Intronic
1001142264 5:169154271-169154293 TGTTACCCAGAGCTCTGAAAAGG - Intronic
1004365959 6:15012934-15012956 TGTTAGCCTGAGCTTTGAGTTGG - Intergenic
1004378946 6:15115670-15115692 TGTTACCCAAAGCACACAGCAGG - Intergenic
1006775133 6:36586620-36586642 GGTTGGCCAGGGCACAGAGCAGG - Intergenic
1010534837 6:77013728-77013750 TATTATCCAGAGCACTGGACTGG + Intergenic
1011054418 6:83191137-83191159 TGTTTGACAGAGCAATGGGCAGG + Intronic
1013193445 6:107824134-107824156 TGTTCACCAGAGCCCTGAGCAGG + Exonic
1014054393 6:116997097-116997119 TGTGAGTCAGTGGACTGAGCTGG + Intergenic
1014693914 6:124595382-124595404 TGTTAGCCCAAGGACCGAGCAGG - Intronic
1014885617 6:126777153-126777175 AGTTACCTAGAGCACTGAGAAGG + Intergenic
1015012951 6:128374511-128374533 TTTTAGCCTGAGCACTGGGAAGG - Intronic
1017444257 6:154493088-154493110 TGTAAGCCAAAGTACTGATCAGG + Intronic
1018834943 6:167475989-167476011 TGGTAGCCAGGGCAGTGAGCTGG - Intergenic
1018981257 6:168603362-168603384 TGGAAGCCAGAGAACAGAGCGGG + Intronic
1021420878 7:20443491-20443513 TGTTTCCCAGAGCACTCACCAGG - Intergenic
1023839583 7:44088790-44088812 TCTTAGCCACAGCAATGTGCAGG - Intergenic
1024107729 7:46109941-46109963 TGTTGTCCAGAGGACTGGGCGGG + Intergenic
1024266616 7:47611603-47611625 TGTGAGCCAGGGCACTGGCCTGG + Intergenic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1029455536 7:100669214-100669236 TGTGAGCCACCGCACTCAGCCGG - Intergenic
1035940524 8:3895814-3895836 TGTGAGCCACAGCTCTGACCTGG + Intronic
1036630542 8:10511170-10511192 TGCTAGCCAGGGAACTGAGTTGG - Intergenic
1036653144 8:10658676-10658698 TGGTAGCCAGAGCAGGCAGCAGG + Intronic
1036796822 8:11762197-11762219 TTTTAGCCAGAGAAGTGAGCTGG - Exonic
1039038231 8:33382856-33382878 TGTTGGTCAGAGCCCTGTGCAGG - Intronic
1039914946 8:41852801-41852823 TGATGGCCAGGGCACTCAGCGGG - Intronic
1040942341 8:52845867-52845889 TCTCACCCAAAGCACTGAGCTGG - Intergenic
1041047145 8:53898278-53898300 TGTTACCCAGACCACTGTCCTGG + Intronic
1041087167 8:54267583-54267605 TGTTAGCCTGAGTCCTGGGCTGG + Intergenic
1043369684 8:79576097-79576119 TGCAAGTCAGAGAACTGAGCAGG - Intergenic
1049380995 8:142315679-142315701 GGTGAGCCAGAGCAATGAGGCGG - Intronic
1057785345 9:98083268-98083290 TGTTGGCCAGTGCACTAAGCTGG - Intronic
1059322814 9:113482599-113482621 TGTGTGGTAGAGCACTGAGCCGG + Intronic
1061590757 9:131596192-131596214 TGGCAGCCACAGCCCTGAGCAGG - Intronic
1188145230 X:26603844-26603866 TGTTACCCAGGACACTGAGGTGG + Intergenic
1189172968 X:38926825-38926847 TGGTAAGCTGAGCACTGAGCAGG + Intergenic
1190056518 X:47184410-47184432 TGTGAGCCACTGCACTCAGCCGG + Intronic
1190248511 X:48706059-48706081 TGCTAGCCAGAGGCCTGAGGCGG + Intronic
1192551603 X:72059044-72059066 TGTGATCCAGAGCTCAGAGCTGG - Intergenic
1197653832 X:129094467-129094489 TGGTAGCCAGAGCACACAGAAGG + Intergenic
1198116908 X:133553004-133553026 TGGCAGCCAGATCACTAAGCAGG + Intronic
1199818745 X:151423879-151423901 TCTTAGCCAGAGAACTGAACTGG - Intergenic
1200790208 Y:7292823-7292845 TGTGAGCCAGGGCACCCAGCTGG + Intergenic