ID: 946168382

View in Genome Browser
Species Human (GRCh38)
Location 2:217879041-217879063
Sequence AAGCTGGCCCTCTGCCGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946168375_946168382 13 Left 946168375 2:217879005-217879027 CCTGCAAGGACAGAGGGGCCCTG 0: 1
1: 0
2: 5
3: 37
4: 339
Right 946168382 2:217879041-217879063 AAGCTGGCCCTCTGCCGAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 116
946168379_946168382 -6 Left 946168379 2:217879024-217879046 CCTGTCTGGAGGCTGAGAAGCTG 0: 1
1: 0
2: 3
3: 38
4: 324
Right 946168382 2:217879041-217879063 AAGCTGGCCCTCTGCCGAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 116
946168378_946168382 -5 Left 946168378 2:217879023-217879045 CCCTGTCTGGAGGCTGAGAAGCT 0: 1
1: 0
2: 2
3: 37
4: 306
Right 946168382 2:217879041-217879063 AAGCTGGCCCTCTGCCGAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946168382 Original CRISPR AAGCTGGCCCTCTGCCGAGA GGG Intronic
901759598 1:11462094-11462116 AAGCTGGGCCTTTGTCGAGGAGG + Intergenic
904345334 1:29864575-29864597 AGGCTGGCCCTCGTCCAAGATGG - Intergenic
904884893 1:33729091-33729113 ATGCTGGGCCTGTGCTGAGATGG - Intronic
909833776 1:80227979-80228001 AAGCTGACCCTCTGCTTACAAGG - Intergenic
914983993 1:152441002-152441024 AACTCGGCCCTCTGCCGGGATGG - Intergenic
917736435 1:177925204-177925226 TAGCTGGTCCTCAGCAGAGATGG - Intronic
923926092 1:238629077-238629099 AAGGTGGACCTCAGCAGAGAAGG - Intergenic
924319905 1:242838643-242838665 AAGATGGCTCTCAGCAGAGAGGG - Intergenic
924560807 1:245155528-245155550 AAGGGGGACCTCCGCCGAGATGG - Intronic
1064642504 10:17428855-17428877 CAGCAGGCTTTCTGCCGAGATGG - Intronic
1069038213 10:63667861-63667883 AGACTGGACCTCTGCAGAGAAGG - Intergenic
1073877130 10:107938116-107938138 GAGCTGGCAGTCAGCCGAGATGG - Intergenic
1076798716 10:132811021-132811043 CACCTGGCACTCTGCCGGGACGG + Exonic
1077411162 11:2404613-2404635 AAGCTGGCCCTGTGGCGTGACGG - Exonic
1090294935 11:125579079-125579101 AAGCTGCCCATATGCCCAGAAGG - Intronic
1091301325 11:134509950-134509972 AAGCTGGGCCTCTGTGCAGAGGG + Intergenic
1094391062 12:29950842-29950864 GAGCTGGCACTGAGCCGAGATGG - Intergenic
1095716486 12:45351666-45351688 AAGCTGCCCCTATTCCTAGAAGG - Intronic
1097722428 12:63037529-63037551 AAGCTGTCCTTCTGCAGAAAGGG - Intergenic
1099564393 12:84223043-84223065 AAGTTGGCTTTCTGCCTAGAGGG - Intergenic
1101629911 12:106483150-106483172 AAGTTGTCCCTCTGTGGAGAAGG + Intronic
1104610221 12:130221434-130221456 AAGCTGGCCTCATGCAGAGACGG - Intergenic
1105295905 13:19087783-19087805 AAGCTGGCCCATTGCTGCGAGGG - Intergenic
1112496358 13:99908247-99908269 CAGATGGGCCTCTGCCCAGAGGG - Intergenic
1113127928 13:107000734-107000756 AAGCTCGCCCACTGCCCAGAAGG + Intergenic
1115909117 14:38235984-38236006 ATGCTGCCCCTCTGCCTGGAAGG + Intergenic
1116784802 14:49275883-49275905 AAGATGGACCTCTGCAGAGAAGG + Intergenic
1119687797 14:76646581-76646603 AAGCAGGCCCTCTCCAGATATGG - Intergenic
1119971543 14:78976320-78976342 AAGGTGTCCCTCTGCCCAGATGG + Intronic
1124341778 15:28894536-28894558 AGGCTGGCCCTTTGCCTGGAGGG - Intronic
1133744450 16:8675834-8675856 CAGCTGGCCCTCTTCCAAGAGGG + Intronic
1134567241 16:15262269-15262291 ACGCTGTCTCTCTTCCGAGAGGG + Intergenic
1136573534 16:31110281-31110303 ACGTAGGCCCTCTGCCAAGAGGG - Exonic
1137626089 16:49909693-49909715 AAGGTGGCCATCTGCCAACAAGG - Intergenic
1140391751 16:74593084-74593106 AAGCTGGCCCTCACCAGATATGG + Intronic
1141135645 16:81463569-81463591 AAGCCGGCTCTCTGCCCAGCTGG + Intronic
1141776285 16:86124662-86124684 AACCTGGGCCTCTGTCAAGATGG + Intergenic
1141919425 16:87126088-87126110 CAGCTGCCCCTCTGCCGAGGAGG + Intronic
1144055102 17:11533655-11533677 GAGCTGGCAGTCAGCCGAGATGG - Intronic
1144498612 17:15766290-15766312 AAGCCAGCCCTCTGCAGACACGG - Intergenic
1145161995 17:20581328-20581350 AAGCCAGCCCTCTGCAGACACGG - Intergenic
1148663904 17:49361172-49361194 AAGCTGGACCTTTTCAGAGAAGG + Intronic
1151021507 17:70622598-70622620 AAGCAGCCCCTCTGTTGAGATGG - Intergenic
1153589081 18:6654204-6654226 AAGCAAGCCCACTGCAGAGAAGG - Intergenic
1157146487 18:45168024-45168046 AAACTGGCTCTCTGTCGAGCTGG - Intergenic
1158346902 18:56524972-56524994 AATGTTGCCCTCTGCCAAGAGGG - Intergenic
1160244443 18:77145720-77145742 AAGCTGCCCCCATGCCGGGAGGG - Intergenic
1163503011 19:17687402-17687424 AAGTAGGCTCCCTGCCGAGAAGG + Intronic
925384423 2:3452261-3452283 CAGCTGGCTCCCTGCAGAGAGGG + Intronic
927911629 2:26903925-26903947 GGGCTGGCCCTCTTCCGTGAGGG + Intronic
933803092 2:85978507-85978529 AATCTGGCCCCCTGCCCAGCTGG + Intergenic
935600765 2:104919376-104919398 AAGCTGGACAGCTGCCAAGAAGG - Intergenic
936051987 2:109230902-109230924 GAGCTGTCCCTTAGCCGAGATGG - Intronic
937200949 2:120204235-120204257 GAGCTGGCCCTCTGACCAGCAGG - Intergenic
938982216 2:136537687-136537709 AAGGTGGCCATCTGCAGACAAGG + Intergenic
940389328 2:153113262-153113284 AAGCTGTCCTCCTGCCTAGATGG - Intergenic
940911769 2:159215692-159215714 CAGATGACCCTCTCCCGAGATGG + Intronic
941718527 2:168788570-168788592 AGGCTGCCCCTCTGCAGGGATGG - Intronic
946168382 2:217879041-217879063 AAGCTGGCCCTCTGCCGAGAGGG + Intronic
948625113 2:239263886-239263908 GAGCTTCCCCTCTGCAGAGAAGG - Intronic
948632011 2:239308300-239308322 AAGCTGGCCCCCTGGTGACACGG + Intronic
948916645 2:241037712-241037734 AAGCTGGTCCTGGGCTGAGAGGG - Intronic
1172056103 20:32155315-32155337 CAGCTGGCCCTCTGCCCTCATGG - Intronic
1175167543 20:57055423-57055445 CAGCAGGCCCTCTGCAGAGGGGG + Intergenic
1175543450 20:59762698-59762720 TACCTGGCCCTCTGCAGAAAAGG + Intronic
1175876927 20:62234677-62234699 ACCCTGGCCCTCTGCTCAGAAGG + Intronic
1176785913 21:13255618-13255640 AAGATGGCCCTCTCCAGAGTGGG - Intergenic
1177983938 21:27949316-27949338 AAGATGGCCCTCTCCAGAGTGGG - Intergenic
1180066674 21:45415880-45415902 AAGCAGGCCCTCAGCCCTGAGGG + Intronic
1180876319 22:19176802-19176824 GAGCTGGCCATGTGCAGAGATGG + Intronic
1182338018 22:29598204-29598226 TAGCTGCCCCTCCGCGGAGAAGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
952933819 3:38379938-38379960 AAGCAGGCCCTCTTCAGATATGG - Intronic
953879241 3:46683180-46683202 GAGCCGGCCCTCTGCCTGGAAGG + Exonic
954426674 3:50447081-50447103 ATGCTGCTCCTCTGCCGGGAAGG - Intronic
954684821 3:52364789-52364811 CAGCTGGCCCACTGCCCTGAAGG + Intronic
955059747 3:55484764-55484786 AAGTTGATCCTCTGCCGAGAGGG - Intronic
958023942 3:88028343-88028365 AAGCTGTCCCTCTGAAGACAAGG - Intergenic
958719644 3:97827949-97827971 CAGCTGGACATCTGCCCAGATGG + Intronic
958748439 3:98165396-98165418 TAGATGGCCCTCTGCCGGGGAGG - Intergenic
961381448 3:126498665-126498687 CAGCTGGCACTCTCCGGAGAGGG - Intronic
967215878 3:187209885-187209907 GAGCTGGTCCTCTGTCAAGATGG - Intergenic
968661927 4:1802224-1802246 AGGCTGGCCCTCTGCAGACACGG - Intronic
970158317 4:13163848-13163870 AAGCTGGCCCTCACCAGACACGG + Intergenic
971697035 4:29918993-29919015 CAGCTGGCCCTCTGCAGTGTAGG + Intergenic
984981889 4:185290004-185290026 AAGATGGCCATCTGCAGACAGGG - Intronic
986241889 5:5967639-5967661 AAGCTGGCCCTCTGCAAACCAGG - Intergenic
997255890 5:132427710-132427732 GACCTGGCCCTCTGCTGAGCTGG + Intronic
998638704 5:143985688-143985710 GAGCTGCCCCTCTGGGGAGATGG - Intergenic
998985597 5:147752854-147752876 AAGAAGGCCATCTGCTGAGATGG + Intronic
1002070965 5:176678779-176678801 AAGCTGGCTGTCTGCCAAGATGG + Intergenic
1004564051 6:16779245-16779267 GAGCTGGCACTCTGAAGAGATGG - Intergenic
1007058986 6:38919334-38919356 AAGCTGGCCCTATGCCTACCAGG - Intronic
1010954373 6:82073497-82073519 AAGCTGGCACTCTGTCCTGAAGG - Intergenic
1013992844 6:116274513-116274535 AAGCTTGCCATGAGCCGAGATGG + Intronic
1015974443 6:138775002-138775024 GAGCTTGCCCTGAGCCGAGATGG - Intronic
1017821023 6:158049215-158049237 TAGCTGGCCCTTTGCCCAGAGGG + Intronic
1018498704 6:164379036-164379058 TAGCAGGCCTTCTGCCAAGAGGG + Intergenic
1018715987 6:166533057-166533079 AAGCTCGCCCACTGCACAGAGGG - Intronic
1019057741 6:169235363-169235385 AAGCTGTCCCTCTGCCATGGAGG + Intronic
1022567306 7:31416144-31416166 AAGATGGGTCTCTGCCCAGAAGG - Intergenic
1029958726 7:104667730-104667752 AAGCTTTCCCTCTGCCAACATGG + Intronic
1033157814 7:138971599-138971621 AAGCTGGCCCTCTGAGGGGCTGG + Intronic
1035464823 7:159067965-159067987 AAGAAGGACCTCTGCAGAGAGGG - Intronic
1035929206 8:3762698-3762720 AAGCTGTCCGTCTGCAAAGATGG + Intronic
1037626003 8:20607702-20607724 TAGCTGGCTCTCTGCCCAAATGG + Intergenic
1042955839 8:74249962-74249984 AGGCTGGCTCTCTCCCAAGAGGG + Intronic
1043685516 8:83080990-83081012 AAGCTGGCTCTCTGCTAAGCTGG - Intergenic
1044400028 8:91759646-91759668 AAGCTGGCCCTCAGAAGACATGG + Intergenic
1047993991 8:130315997-130316019 GAGTTGGTCCTCTGCAGAGAAGG - Intronic
1049775190 8:144400803-144400825 AAGCTGGACCTCTGCCTGGGGGG + Exonic
1050311972 9:4362474-4362496 AAACTGGCCCCATGCCGAGATGG - Intergenic
1051064942 9:13092142-13092164 AAGCTGCCCCTCTTCCCTGATGG - Intergenic
1052674924 9:31608644-31608666 ATGCTGCCACTCTGCCAAGAAGG + Intergenic
1055392801 9:75841359-75841381 AAGCTGGTCCTAGGCAGAGATGG - Intergenic
1057263895 9:93601590-93601612 AGGCTGGCCCACTGCTGCGAGGG + Intronic
1057935135 9:99231847-99231869 AATCTGTCCCTCTGTCCAGAGGG + Intergenic
1059808220 9:117827617-117827639 AAGCCGGCATTATGCCGAGAGGG + Intergenic
1062119772 9:134827977-134827999 GAGCTGGCCTTGTGCCAAGAAGG - Intronic
1062398730 9:136363270-136363292 AACCTCGCCCTCTCCCGGGAAGG + Intronic
1062444455 9:136587846-136587868 AGGCTGGCCCACTGCCCAGCAGG + Intergenic
1062454191 9:136627998-136628020 GAGCTGGCCCACCCCCGAGATGG - Intergenic
1188438022 X:30185178-30185200 AACCTGGACCTATGCAGAGAAGG + Intergenic
1189582383 X:42420497-42420519 AAGCTGGCCCTAAGGCCAGAAGG - Intergenic
1192910873 X:75602613-75602635 AAGCAGGGCCTCAGCCAAGATGG - Intergenic
1196866125 X:120072753-120072775 AGGCTGGCCCACTGCCATGAAGG + Exonic
1196876971 X:120163528-120163550 AGGCTGGCCCACTGCCATGAAGG - Exonic
1197959447 X:131988311-131988333 AAGCTGGTCCTCAGCTGACAAGG - Intergenic