ID: 946168457

View in Genome Browser
Species Human (GRCh38)
Location 2:217879480-217879502
Sequence GGGTGTCTTGGCCAATCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946168449_946168457 2 Left 946168449 2:217879455-217879477 CCTGGGGGGTCGGAGGGGCCTGG 0: 1
1: 0
2: 3
3: 52
4: 451
Right 946168457 2:217879480-217879502 GGGTGTCTTGGCCAATCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946168457 Original CRISPR GGGTGTCTTGGCCAATCTGA GGG Intronic
900353314 1:2247662-2247684 GGGTTTCTGGGACAATCTGCTGG + Intronic
901907339 1:12425236-12425258 GAATGTCTTGGTCAATATGACGG + Intronic
902292217 1:15442757-15442779 GGGAGTCTTGGCCAATGAGGGGG - Intronic
902933467 1:19747245-19747267 GGATGCCTCGGCCATTCTGAGGG + Exonic
904134376 1:28300066-28300088 GGGAGTTTTGGCCAATGAGATGG + Intergenic
904990612 1:34589749-34589771 GGATGTAATTGCCAATCTGAAGG - Intergenic
905018920 1:34795149-34795171 GGGGTTTTTGGCCATTCTGAGGG - Exonic
905300077 1:36980938-36980960 TTGTTTCTTGGCCAAGCTGATGG - Intronic
913487846 1:119350021-119350043 GGAACTCTTGGACAATCTGAGGG - Intergenic
915931807 1:160065399-160065421 AGATGCCTTTGCCAATCTGACGG + Intronic
917338140 1:173946493-173946515 GGGTCTGCTGGCTAATCTGATGG + Exonic
917679935 1:177355337-177355359 GGGGGTCTGTGCCAAGCTGAAGG + Intergenic
919819224 1:201462395-201462417 GGGAGTCTTTGCCTCTCTGATGG - Intergenic
921029314 1:211323745-211323767 GGGCGTCTGGGGCAATCTTACGG + Intergenic
923656942 1:235925275-235925297 TGGTGACTTGGCAAATCTGGGGG - Intergenic
1067164857 10:43857197-43857219 TGGTCTCTTGGCAAAGCTGAAGG - Intergenic
1075316725 10:121459173-121459195 GGGTTTCTTGGCAGAGCTGATGG - Intergenic
1077854811 11:6113152-6113174 TGGTGTTTTGACCCATCTGATGG + Intergenic
1078626891 11:12966202-12966224 GTGTGACTTAGCCCATCTGAGGG + Intergenic
1078769222 11:14332004-14332026 GGGTATTTTAGCCAATCTAATGG - Intronic
1081914053 11:46719635-46719657 GGCAGTCTTGGCCATTCTGGGGG - Intronic
1087029337 11:93686404-93686426 GGAAGTCTTGCCCAATCTAAAGG + Intronic
1089899528 11:121966237-121966259 GAGAGTTTTGGCCAATCTGTAGG - Intergenic
1091261539 11:134238458-134238480 AGGTGTCTTGGGCAGTGTGATGG + Intronic
1093781015 12:23137468-23137490 AGGTGTCTTGCCTAATCTCATGG - Intergenic
1096647006 12:53044370-53044392 GGGTGTATTGTCCAAGCTGGAGG - Intergenic
1099012931 12:77313110-77313132 GGATGTATTAGACAATCTGAGGG - Intergenic
1105261542 13:18783295-18783317 GGGGGTCTTAGCCAAGATGATGG - Intergenic
1106694027 13:32150973-32150995 GGGTCTCTGGGCCAATGGGAGGG + Intronic
1107882835 13:44848179-44848201 GGGGGTCCAGGCCCATCTGAAGG - Intergenic
1110390889 13:74972586-74972608 GGGTTTCTTGACCAATCAGATGG + Intergenic
1112616110 13:101007122-101007144 GGGTGGCTTCCCCAATGTGATGG - Intergenic
1114553815 14:23550232-23550254 GGCTGTCCTGGCCATGCTGAAGG + Intronic
1121521395 14:94588401-94588423 GGGAGTCTTGGCCTCTATGAGGG - Intronic
1125653044 15:41333029-41333051 GGGTCTCCGGGCCAACCTGAGGG + Exonic
1131977381 15:97960509-97960531 GGGAGTGTTGGCCAATCGGGAGG - Intergenic
1135068775 16:19334201-19334223 TGGTATCTTGGCCAATGAGATGG + Intergenic
1136478177 16:30526178-30526200 GGGTGTCTTGGGTCAGCTGAGGG - Intronic
1136609598 16:31358125-31358147 AGGTGTCCTGGGCATTCTGATGG - Intronic
1143759499 17:9090818-9090840 AGGAGGCTTGGCCACTCTGAGGG + Intronic
1145763655 17:27443199-27443221 ATGTGTCTTGGCCAGCCTGATGG - Intergenic
1146111092 17:30090119-30090141 CGTTGTCTTGGCTTATCTGAAGG - Intronic
1147202200 17:38810247-38810269 GGGTATCTTGGCCATGCTGCTGG - Intronic
1148124917 17:45231572-45231594 GGGTGGCTCGGCGAATCTGAGGG + Intronic
1150209533 17:63434545-63434567 GGGTGTCCTGGCCAACGTGCTGG - Exonic
1152360525 17:79831243-79831265 GGGGGTCTTGGGCACTCTGTTGG + Intergenic
1154432174 18:14316741-14316763 GGGGGTCTTAGCCAAGATGATGG + Intergenic
1157276340 18:46313600-46313622 GGGTGTCGTGGGGAACCTGAAGG + Intergenic
1157643969 18:49247734-49247756 GGGTGTCTTGGCAGACTTGATGG - Intronic
1158337019 18:56423382-56423404 AGAGGTCTTGGGCAATCTGAGGG + Intergenic
1161993134 19:7696751-7696773 GGGCGTGTTGGCAAATGTGACGG - Intronic
1163720152 19:18894919-18894941 GGGTGTCCAGGCCAAGCTAAAGG + Intronic
1167676767 19:50892068-50892090 GGGTATCTCGGCCAAACTCAGGG - Intergenic
926357871 2:12057596-12057618 GGGTGACTTGGCCAACCACAGGG + Intergenic
935499443 2:103820425-103820447 TGGTGTGTTGGCCAAGGTGATGG + Intergenic
936018673 2:108978419-108978441 GCGTGTCTTTGCTAATCTGTGGG + Intronic
941474417 2:165932097-165932119 GGGTGTCTTCGCCTATCCAAAGG - Intronic
945002845 2:205370060-205370082 GGGTCTCTAGGTCACTCTGAAGG - Intronic
946168457 2:217879480-217879502 GGGTGTCTTGGCCAATCTGAGGG + Intronic
946285269 2:218697950-218697972 AGGTGTCTTGGCCGACCTCAGGG + Exonic
948545678 2:238727058-238727080 GGGTGCCTTGGCTAATGTGAAGG + Intergenic
948614731 2:239191204-239191226 GGGTGTCTGGGCCAACAAGAGGG + Intronic
948784259 2:240343294-240343316 GGGTTTCTTGGCCAAGTTGGTGG - Intergenic
1169311863 20:4549442-4549464 GGTTGTCTGGGCCAATCACAGGG - Intergenic
1172777459 20:37415755-37415777 GGGTGTTTCGGCCTGTCTGAGGG + Intergenic
1176345269 21:5738112-5738134 GGATGTCATGGGCAAACTGAAGG - Intergenic
1176352083 21:5858696-5858718 GGATGTCATGGGCAAACTGAAGG - Intergenic
1176411813 21:6453296-6453318 GGGGGACTTGGCCATGCTGAGGG + Intergenic
1176499558 21:7586343-7586365 GGATGTCATGGGCAAACTGAAGG + Intergenic
1176539590 21:8136182-8136204 GGATGTCATGGGCAAACTGAAGG - Intergenic
1176558541 21:8319227-8319249 GGATGTCATGGGCAAACTGAAGG - Intergenic
1179202346 21:39236371-39236393 GTGTGTCTTGGGGATTCTGAAGG - Intronic
1179660465 21:42871356-42871378 GGGTTTCTTGGACAACCTGTGGG - Intronic
1179687307 21:43061618-43061640 GGGGGACTTGGCCATGCTGAGGG + Intronic
1182532854 22:30974507-30974529 GGGTGTCCAGGGCAATCTGCTGG - Intergenic
949681522 3:6519916-6519938 GAGGGTCTTGGCAAATCTGTGGG - Intergenic
949861535 3:8509717-8509739 GTGTGTCCTGGAAAATCTGAGGG - Intronic
959806533 3:110561656-110561678 GGGAGTCCTTGCCACTCTGAAGG - Intergenic
970003360 4:11386759-11386781 GGATGTCTTGGACAGTCTGGGGG + Intergenic
973908900 4:55559090-55559112 TGGTTTTTTGGTCAATCTGATGG - Intronic
981237880 4:142439232-142439254 GAAAGTCTTGGCCAAGCTGATGG - Intronic
981570837 4:146148866-146148888 TGGTGTCTAGGCCAAACTGATGG + Intergenic
983523019 4:168730628-168730650 GGGGGTCTTGCCCAATCCTAGGG - Intronic
987004155 5:13692318-13692340 GGGTGTCTTGCCACATCTGCTGG - Intronic
992842589 5:80710977-80710999 GTCTGTCTTGGCAAACCTGATGG - Intronic
998680636 5:144462895-144462917 GGGTGTTTTTCCCAATCAGAGGG + Intronic
998884795 5:146683059-146683081 GGGTGTCTTGGCCACACTCCTGG + Intronic
1000636931 5:163655133-163655155 GGGTGTCTGGTGCAATCTGTAGG + Intergenic
1002606003 5:180383073-180383095 AGGTGTCTTGGACAGCCTGAGGG + Intergenic
1003070386 6:2940850-2940872 GTGTGTCTTCCCCTATCTGAAGG - Intergenic
1006423917 6:33952025-33952047 GGATGTCTTGGGCATTCTAAAGG + Intergenic
1007392889 6:41560773-41560795 GGGTGTCATGGCAAATGTTACGG + Intronic
1011171532 6:84510074-84510096 GGGTGTAGTTACCAATCTGATGG + Intergenic
1011665319 6:89627585-89627607 GCGTGTTTTGGACAAGCTGATGG + Exonic
1012140141 6:95616433-95616455 GGATGTCTTGGACAGCCTGAGGG + Intergenic
1015672395 6:135705190-135705212 GGGTGTGTTGGCCAAGGTGGAGG + Intergenic
1015864503 6:137714129-137714151 GGGTGTCTTGGCAGAATTGAAGG + Intergenic
1018594178 6:165460589-165460611 GGTTGAATTGGCCAATCGGACGG - Intronic
1022149390 7:27585419-27585441 TTGTATCTTTGCCAATCTGAGGG + Intronic
1022956981 7:35390076-35390098 GGGGGTCATGGCCAATGAGATGG - Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024908895 7:54421968-54421990 GGGTGTCTGGACCAAGCTGGGGG + Intergenic
1026440995 7:70444051-70444073 GGGTGTCATGGCTTACCTGAAGG + Intronic
1026571759 7:71537431-71537453 GGGGGTCTTTGCAGATCTGAAGG + Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1031551910 7:123124918-123124940 AGGTGTGGTGGCCAATCTGGAGG - Intronic
1032189780 7:129757961-129757983 GGGTGTCTTGGCCACTTTCCTGG + Intergenic
1032549400 7:132770668-132770690 GGCTGTCTGGGCCAAATTGATGG + Intergenic
1033776926 7:144621357-144621379 GACAGTCTTGGCCAATCTGGTGG - Intronic
1038234775 8:25742050-25742072 TGGTGTCTTGGCCCATCTCAGGG + Intergenic
1045095822 8:98797229-98797251 TGGTTTCTTGGCCCACCTGAAGG + Intronic
1048068400 8:130996406-130996428 GGGGGTCTTGACCAACCAGAAGG + Intronic
1049693814 8:143974037-143974059 CGGGGGCTTTGCCAATCTGATGG - Intronic
1051710447 9:19925938-19925960 GTGTGTCTTGCTCAATCTGCAGG - Intergenic
1052817567 9:33113382-33113404 GTGTGTCTCTGCCAATCTGCTGG - Exonic
1054808116 9:69412420-69412442 GGGGGTCCCAGCCAATCTGATGG - Intergenic
1055680171 9:78706323-78706345 GGGTGACTATGCCAATATGATGG - Intergenic
1056844244 9:90023719-90023741 AGTTGGCTTGGCCAACCTGATGG - Intergenic
1060270036 9:122133689-122133711 GGGTGGCTTGGCTGAGCTGAAGG + Intergenic
1060985917 9:127818849-127818871 GGGAGACTTGGTCAATCTGGCGG + Intronic
1203790658 EBV:149860-149882 GGGGTTCTTGACCAATCTGATGG + Intergenic
1186139963 X:6561491-6561513 GGGTGTGAGTGCCAATCTGAAGG - Intergenic
1187217181 X:17288551-17288573 GCCTGGCCTGGCCAATCTGAAGG + Intergenic
1197056485 X:122126498-122126520 GTGTGTTTTGACCTATCTGAGGG + Intergenic
1199422844 X:147665436-147665458 GGGAATCTTGTCAAATCTGACGG - Intergenic