ID: 946170281

View in Genome Browser
Species Human (GRCh38)
Location 2:217891187-217891209
Sequence GCTTCTCGGCACAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946170281_946170287 20 Left 946170281 2:217891187-217891209 CCTGCCATCCTGTGCCGAGAAGC 0: 1
1: 0
2: 2
3: 17
4: 176
Right 946170287 2:217891230-217891252 AGCATCTCTCCAACTGTGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 139
946170281_946170286 19 Left 946170281 2:217891187-217891209 CCTGCCATCCTGTGCCGAGAAGC 0: 1
1: 0
2: 2
3: 17
4: 176
Right 946170286 2:217891229-217891251 CAGCATCTCTCCAACTGTGCAGG 0: 1
1: 0
2: 1
3: 16
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946170281 Original CRISPR GCTTCTCGGCACAGGATGGC AGG (reversed) Intronic
900644730 1:3703779-3703801 GCTTCTCAGGTCAGGATGACAGG - Intronic
900999958 1:6143983-6144005 GCTGCTAGGCACAGGCTGCCGGG - Intronic
902720758 1:18302590-18302612 GCCTGTGTGCACAGGATGGCAGG - Intronic
903816194 1:26066208-26066230 GGATCTAGGCACAGCATGGCTGG + Intronic
904294928 1:29513954-29513976 GCTTCTCGGGGATGGATGGCTGG + Intergenic
904978196 1:34474580-34474602 GCTTCAGGGCACAGCAGGGCAGG + Intergenic
905948247 1:41921760-41921782 GTTTCTCCACACAGAATGGCTGG + Intronic
906289438 1:44610342-44610364 TGTTATCGGCAGAGGATGGCGGG - Intronic
906865111 1:49409822-49409844 GCTTCTCTGCACAGGAGGATAGG + Intronic
909836437 1:80260784-80260806 GATTCTCTGCACAGGAAGGGTGG - Intergenic
910038309 1:82816205-82816227 GCCTGTTGGAACAGGATGGCAGG + Intergenic
910478542 1:87634253-87634275 GTTTATAGGCACAGGATGGAGGG + Intergenic
911672137 1:100619422-100619444 GCTTCTCGCAGCAGGATAGCTGG - Intergenic
918167487 1:181964444-181964466 GCACCTCTTCACAGGATGGCAGG + Intergenic
920455398 1:206097333-206097355 GCTTCTTGGCACTGGATGCATGG + Intronic
923794706 1:237142586-237142608 GCTCCTCATCACAGGGTGGCAGG - Intronic
1063201777 10:3791039-3791061 GCCTCTCGGTGCAGGACGGCCGG - Intergenic
1065600548 10:27363557-27363579 GAATCTGGGCACAGGTTGGCTGG + Intergenic
1066994678 10:42552725-42552747 GCTTCGGGGCAGAGGATGCCGGG - Intergenic
1069020897 10:63487329-63487351 GATTCTCAACACAGGAGGGCTGG + Intergenic
1070457230 10:76629360-76629382 TCTTCTTGGCACAGGACAGCAGG - Intergenic
1072227939 10:93387437-93387459 GCTTCCCAGCACAGGAGGGCAGG - Intronic
1073968719 10:109021798-109021820 GCTTGTGGGCAGAGGATCGCAGG - Intergenic
1076422142 10:130339064-130339086 GCTTCCCAGCACAGGATCCCAGG + Intergenic
1076509482 10:131002181-131002203 GCTACTTTGCACAGAATGGCAGG + Intergenic
1076764561 10:132625813-132625835 GCTTCTCTGCAAGGGCTGGCAGG + Intronic
1077155304 11:1088428-1088450 GCTTCTCGGCCCAGGAGCGGCGG - Intergenic
1078778895 11:14418677-14418699 GCTCCTAGGCAGAGAATGGCCGG - Intergenic
1080055003 11:27897813-27897835 GCACCTCTTCACAGGATGGCAGG + Intergenic
1081076076 11:38675476-38675498 GCATCTCTTCACAGGGTGGCAGG - Intergenic
1084087494 11:66861257-66861279 GCTTCTAGGCACTGGCTGGGGGG + Intronic
1084145672 11:67263906-67263928 ACCTCTTGGAACAGGATGGCTGG + Intergenic
1085188258 11:74594775-74594797 GCATCTCTTCACAGGGTGGCAGG + Intronic
1085893137 11:80604898-80604920 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1087602996 11:100339465-100339487 GTTTCTCTGCACAGGACGGTGGG + Intronic
1088762924 11:112949336-112949358 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1090179508 11:124684108-124684130 GCATCTCTTCACAGGGTGGCAGG - Intronic
1090409584 11:126498641-126498663 GCTTGTCGTCACAGGGTGCCAGG - Intronic
1097127345 12:56785186-56785208 GCACCTCTTCACAGGATGGCAGG + Intronic
1097339265 12:58419029-58419051 TCTTTTAGGCACAGGATGGTTGG - Intergenic
1101755294 12:107616713-107616735 GGTTCTTGGCACAGGAATGCTGG - Intronic
1108017047 13:46086759-46086781 GCTTCTCGGCACTGGCCTGCAGG - Intronic
1108638970 13:52364321-52364343 ACTTCTTGGCACAGTATGGAAGG - Intergenic
1108650972 13:52479236-52479258 ACTTCTTGGCACAGTATGGAAGG + Intergenic
1109620613 13:64900316-64900338 GGTTCTCTGCACAGGAAGGGTGG - Intergenic
1111719046 13:91918118-91918140 GCACCTCTTCACAGGATGGCAGG + Intronic
1112438404 13:99408020-99408042 TCCGCTCGGCACAGGATGGCAGG + Intergenic
1112840154 13:103565434-103565456 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1113381484 13:109809967-109809989 GCTTCTCCACAGAGGATGGCAGG - Intergenic
1113975416 13:114224487-114224509 GCTTCACGACACAGGGGGGCGGG - Intergenic
1114452964 14:22838416-22838438 GCTTCTGGGCCCAGGAAGGGAGG + Intronic
1115012979 14:28572873-28572895 TTTTATAGGCACAGGATGGCAGG + Intergenic
1115816798 14:37172292-37172314 GCTTCTCGGCAGATCGTGGCCGG - Exonic
1115963565 14:38862992-38863014 GGGTCTCTGCACAGGATGGGTGG + Intergenic
1116712296 14:48383645-48383667 CCTTATAGGCACAGGATGGGGGG + Intergenic
1117147181 14:52847042-52847064 GCTACTGAGCACATGATGGCAGG - Intergenic
1117366293 14:55031970-55031992 GTTTTTGGGCACATGATGGCAGG + Intronic
1120838393 14:89061527-89061549 ACTTCTCTGCAAAGGGTGGCTGG + Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123171955 14:106381582-106381604 GCTTCTCCCTAGAGGATGGCAGG + Intergenic
1123872947 15:24594797-24594819 ACTTCTGGGGACAGGCTGGCTGG - Intergenic
1128537400 15:68501418-68501440 GCTGCTTGGCACAGGATCACTGG - Intergenic
1130659362 15:85818053-85818075 GCTTCTCAGCACAGTCTGTCTGG - Intergenic
1132969478 16:2678761-2678783 GCTTCTCGGCACAAAGTGGAGGG + Intergenic
1134182926 16:12062033-12062055 ACTTTTCTGCACAGGGTGGCAGG - Intronic
1134843193 16:17417878-17417900 GCTTCTTGCCACATGGTGGCTGG - Intronic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135783044 16:25323186-25323208 GCTGCTTTACACAGGATGGCTGG + Intergenic
1136064439 16:27749395-27749417 GCCTCTTGGCACTGGATGGCTGG - Intronic
1137661313 16:50209308-50209330 GCTCTTCTGCACAGGTTGGCTGG - Intronic
1138154914 16:54694085-54694107 ACTTCTCAACACAGCATGGCTGG + Intergenic
1139229154 16:65265966-65265988 GATTCTCTGCAAATGATGGCTGG + Intergenic
1139853132 16:69962486-69962508 GGTTCTTGCTACAGGATGGCTGG - Intronic
1139882103 16:70185394-70185416 GGTTCTTGCTACAGGATGGCTGG - Intronic
1140306257 16:73806044-73806066 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1140370405 16:74410110-74410132 GGTTCTTGCTACAGGATGGCTGG + Intronic
1142682049 17:1555789-1555811 GCTTCCTGGCACAGGTCGGCCGG - Intronic
1144447089 17:15341421-15341443 ACTTCTCGCCTCAGGATCGCGGG - Intronic
1144621844 17:16823076-16823098 GCTTCTCAGCACAGCATGGCAGG - Intergenic
1144884580 17:18449638-18449660 GCTTCTCAGCACAGCATGGCAGG + Intergenic
1145147649 17:20494739-20494761 GGTTCTCAGCACAGCATGGCAGG - Intergenic
1146431283 17:32797394-32797416 GCTTTTGGGCACAGGCTGGGAGG + Intronic
1147573822 17:41587418-41587440 ACTTCTCAGCACAGCATGGGAGG - Intergenic
1149007053 17:51817109-51817131 TCTTATCCACACAGGATGGCTGG + Intronic
1149424245 17:56539680-56539702 GCTTCTCAGAACATGGTGGCTGG + Intergenic
1149441771 17:56680124-56680146 GCTTCCTGGCATAGGGTGGCGGG - Intergenic
1155325511 18:24660473-24660495 GCTTCCCCCAACAGGATGGCAGG + Intergenic
1155575761 18:27244929-27244951 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1156036578 18:32771971-32771993 GCATCTAGGCAGAGGAGGGCAGG + Intronic
1157195017 18:45614019-45614041 GCCTCTGGGCCCAGGATGGTAGG - Intronic
1159930630 18:74309792-74309814 GCACCTCTTCACAGGATGGCAGG + Intergenic
1161216083 19:3095588-3095610 GTTTCCCGGAACAGGAAGGCAGG - Intronic
1161968448 19:7561797-7561819 CCTTCTGTGCTCAGGATGGCTGG + Intergenic
1166232058 19:41430453-41430475 GTTTCTAAGCACAGGAAGGCTGG + Intronic
1166758809 19:45212057-45212079 GCTTCCCGGCTAAGGATGGATGG + Intronic
1168692465 19:58385421-58385443 GCTACTCTGCACAGGATGGAGGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925665643 2:6252589-6252611 GCTTCTAGGACCAGGCTGGCTGG - Intergenic
925714816 2:6774063-6774085 GCTTGTTGGCGCAGGAGGGCGGG - Intergenic
930513776 2:52380372-52380394 GCCTCCCAGCAAAGGATGGCGGG - Intergenic
931790172 2:65657984-65658006 GCTTCTGGGGACAGGCTGCCTGG - Intergenic
932128597 2:69167599-69167621 GCAGCTCACCACAGGATGGCAGG - Intronic
935133577 2:100279232-100279254 GTTTCTCGGCTCGGGGTGGCAGG - Exonic
935632374 2:105222715-105222737 GCTCGTCTGCCCAGGATGGCAGG - Intergenic
935787859 2:106565430-106565452 GCTGCCGGGCACAGGATGGGTGG + Intergenic
940375495 2:152953790-152953812 GCATCTCTTCACAGGGTGGCAGG + Intergenic
940481745 2:154241197-154241219 GGTTATAGGCACAGGATGGCAGG + Intronic
941276318 2:163495150-163495172 GCATCTCTTCACAGGGTGGCAGG - Intergenic
946170281 2:217891187-217891209 GCTTCTCGGCACAGGATGGCAGG - Intronic
946365638 2:219247365-219247387 GCATCTCTGGACAGGAAGGCTGG - Intronic
946450262 2:219773616-219773638 GCTTCTGGGCACAAGATGGAAGG - Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169515493 20:6311998-6312020 GGATCTCTGCACAGGATGGGTGG - Intergenic
1171356182 20:24547200-24547222 GCTCCTGGGCACTGGGTGGCTGG + Intronic
1173159935 20:40644917-40644939 GCTTCTTTGCCCAGGATGGATGG + Intergenic
1174688941 20:52483695-52483717 GCTTCAGGGTTCAGGATGGCAGG + Intergenic
1175802240 20:61807394-61807416 GCTTCTCGTAACAGGGTGTCTGG + Intronic
1179277360 21:39904551-39904573 GCTCCTGGGCACAGGGTGGCTGG + Intronic
1180091294 21:45534990-45535012 GCTTCTCTGAACAGGGAGGCGGG + Intronic
1181669336 22:24418890-24418912 GCGTCTGGGCACAGGACCGCAGG - Intronic
1183334508 22:37238985-37239007 GCTTCTGGGCTGAGGATGGTAGG - Intronic
1183385071 22:37509818-37509840 GCTTGTGGGCACAGGCTGGCAGG - Intronic
1183385114 22:37509937-37509959 GCTTGTGGGCACAGGCTGGCAGG - Intronic
1183385192 22:37510175-37510197 GCTTGTGGGCACAGGCTGGGGGG - Intronic
1183617512 22:38954501-38954523 GCTTCTAGGCTGAGGAGGGCGGG + Intronic
1183699724 22:39444507-39444529 ACTTCTGGGCCCAGGATGCCTGG - Intergenic
1184193113 22:42908344-42908366 GGCTCTGGGAACAGGATGGCAGG - Intronic
1184377856 22:44125794-44125816 GCTTCTGGGTGCAGGATGGATGG + Intronic
1184721812 22:46319023-46319045 GCTTCCCTGCACAGGATGCTAGG + Intronic
949451667 3:4192154-4192176 GTTTCTAGGCACAGTAAGGCAGG + Intronic
949837308 3:8283016-8283038 GCATCTTGGCACAGGCTGGCTGG - Intergenic
952333161 3:32383296-32383318 GCTTCTCAGAACATGATAGCTGG - Intergenic
954799392 3:53178494-53178516 TCTTCACGGCACAGAAGGGCTGG - Exonic
955711541 3:61784213-61784235 GCTGCTGGGAATAGGATGGCAGG - Intronic
956489149 3:69753052-69753074 GCTTCTGGGCCCATGATGGGAGG - Intronic
958857260 3:99399846-99399868 GACTCACAGCACAGGATGGCTGG + Intergenic
959068368 3:101679811-101679833 GCAACTTGGCACAGGTTGGCAGG + Intergenic
960223326 3:115142894-115142916 CCTCCACGGCACAGGATGGGAGG + Intronic
960495390 3:118367695-118367717 GCACCTCTTCACAGGATGGCAGG + Intergenic
961387383 3:126530172-126530194 GCTCCTCGGGGCAGGGTGGCAGG + Intronic
961649941 3:128412331-128412353 GCTGCTCGGCAGAGGAGGCCAGG - Intergenic
963878447 3:150502192-150502214 GCATCTCTTCACAGGGTGGCAGG + Intergenic
964229176 3:154442891-154442913 GCTTATAGGGACAGGATGGTAGG + Intergenic
964424700 3:156539760-156539782 GCTTCTGGAGACAGGATGGAAGG - Intergenic
965930962 3:174043014-174043036 GCACCTCGTCACAGGATGGCAGG + Intronic
965964772 3:174473946-174473968 GCACCTCGTCACAGGGTGGCAGG + Intronic
966628933 3:182050537-182050559 GCACCTCTTCACAGGATGGCAGG - Intergenic
966696381 3:182793832-182793854 GCCTCTCGGCCCGGGGTGGCGGG + Intronic
967633827 3:191778059-191778081 GCTTCTGGGCTCATGATGGGAGG - Intergenic
968547229 4:1205545-1205567 GCCTCTGGGGACAGGATTGCGGG - Intronic
969119390 4:4896750-4896772 GAGTCTGGGCACAGAATGGCTGG + Intergenic
969991844 4:11272482-11272504 GCATGTCTGGACAGGATGGCAGG - Intergenic
971844278 4:31898024-31898046 GCACCTCTTCACAGGATGGCAGG - Intergenic
981679606 4:147381638-147381660 GGATCTCTGCACAGGATGGGTGG - Intergenic
982803755 4:159736696-159736718 GCACCTCTTCACAGGATGGCAGG - Intergenic
985606989 5:863085-863107 GCATCCAGGGACAGGATGGCAGG + Intronic
985678871 5:1245796-1245818 GCCTCACGGCCCAGGGTGGCCGG + Intronic
986098809 5:4586481-4586503 GCGTGTCGGCACATGGTGGCTGG - Intergenic
986247022 5:6017956-6017978 GCTCCTACGCACAGGAAGGCTGG + Intergenic
987303936 5:16620404-16620426 GCATCTCTTCACAGGGTGGCAGG - Intergenic
990006374 5:50948080-50948102 GCCTCTCGGTGCAGGCTGGCTGG + Intergenic
992523360 5:77580295-77580317 GCATCTCTTCACAGGATGGCAGG + Intronic
992912292 5:81407908-81407930 GCTCCTCTTCACAGGGTGGCAGG + Intergenic
995981699 5:118112254-118112276 GCATCTCTTCACAGGGTGGCAGG - Intergenic
998965556 5:147536452-147536474 GCTTGTCTGCACAAGATAGCTGG + Intergenic
1001025144 5:168217841-168217863 GCTTCTCAGCTCCAGATGGCTGG - Intronic
1001695743 5:173668336-173668358 GCTTCTGGGAACAGGAGGGTAGG + Intergenic
1002327399 5:178418765-178418787 GCTTGTCGGCACTGGGAGGCAGG + Intronic
1002522713 5:179800431-179800453 GGTTCTCAGCACAGGCAGGCGGG + Intronic
1004123901 6:12853652-12853674 GCTCCTCTTCACAGGTTGGCAGG + Intronic
1005873200 6:29992795-29992817 GCTTTTTGGCAGGGGATGGCAGG + Intergenic
1006090846 6:31627920-31627942 GCTTCTCAGCACAGGCTGCCCGG - Exonic
1007442944 6:41879589-41879611 GCTGCTGGGCAGAGGATGGGAGG + Intronic
1007580437 6:42955969-42955991 GCAACTTGGCACAGGTTGGCAGG + Intergenic
1019635377 7:2072794-2072816 TCAGCTCAGCACAGGATGGCTGG + Intronic
1019806553 7:3130606-3130628 GCACCTCTTCACAGGATGGCAGG + Intergenic
1029111738 7:98216207-98216229 GCCTCTCGCCACAGGATGGAGGG + Exonic
1029212015 7:98916882-98916904 CCTGCACGGCACAGGAAGGCAGG - Intronic
1032090359 7:128908698-128908720 GCTTCCCGGCCCTGGATGGTGGG - Intronic
1034510532 7:151531267-151531289 GCATCTCTTCACAGGGTGGCAGG + Intergenic
1037660384 8:20921121-20921143 GCACCTCTTCACAGGATGGCAGG + Intergenic
1046136819 8:110037942-110037964 GCATCTCTTCATAGGATGGCAGG - Intergenic
1047870091 8:129072474-129072496 GCACCTCTACACAGGATGGCAGG - Intergenic
1049344630 8:142131895-142131917 GCTGCTGGGCACAGGAGGGAAGG - Intergenic
1050619129 9:7434190-7434212 GGATCTTGGCACAGGATGGGTGG + Intergenic
1052193380 9:25683638-25683660 GCTTCTGGGCCCATGATGGGAGG - Intergenic
1056126187 9:83538199-83538221 GCCTCTCGGCACACAGTGGCAGG + Exonic
1058281353 9:103119449-103119471 TCTCCTCTTCACAGGATGGCAGG + Intergenic
1059659070 9:116383253-116383275 GCTTCTCAGCCCAGGCTAGCAGG - Intronic
1060762028 9:126261660-126261682 GCATCTCTTCACAGGATGGCAGG - Intergenic
1185907974 X:3954573-3954595 GCAACTTGGCACAGGCTGGCAGG - Intergenic
1190106192 X:47562665-47562687 GCTTCACTGCACAGGGTTGCGGG - Intronic
1196196215 X:112840808-112840830 GCTCCTGGGCAAAGGATGGGAGG + Intronic
1196998169 X:121407281-121407303 TCTTATGGGCACAGGATGGGGGG - Intergenic
1197375497 X:125677246-125677268 GCACCTCTTCACAGGATGGCAGG + Intergenic
1198808389 X:140510448-140510470 GCTTCTCGGGAAAGGGTGCCTGG + Intergenic