ID: 946170610

View in Genome Browser
Species Human (GRCh38)
Location 2:217893128-217893150
Sequence AAGGGAGAACATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 925
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 862}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946170600_946170610 21 Left 946170600 2:217893084-217893106 CCTTGGTGGAAAAGAGTCAGGGC 0: 1
1: 0
2: 0
3: 11
4: 163
Right 946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG 0: 1
1: 0
2: 3
3: 59
4: 862

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946170610 Original CRISPR AAGGGAGAACATAAGGAGGA AGG Intronic
901231601 1:7644647-7644669 AGAGGAGAAAATAAGGTGGAGGG + Intronic
902202820 1:14846378-14846400 AAGAGAGAACAAAAAAAGGAAGG + Intronic
902657182 1:17877311-17877333 GAGGGAGAACAAAAGGATGGAGG - Intergenic
902675611 1:18006556-18006578 AGGGGGGAACAGAAGAAGGAAGG + Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
903331766 1:22600238-22600260 AAGGAAGGACAGAAGGAGGAAGG + Intronic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904509509 1:30992165-30992187 AAGGAAGTACATACAGAGGACGG + Intronic
904937739 1:34143686-34143708 ATGGGAGAAAAAAAGAAGGAAGG + Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905871595 1:41407535-41407557 CAGGGTGAACATGAGAAGGATGG - Intergenic
906140218 1:43530005-43530027 GAGGGTGAACATGAGGATGAAGG + Intronic
906238361 1:44225807-44225829 TAGGGAGACCCTCAGGAGGAAGG + Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906775230 1:48523260-48523282 AAGTGAGGACATCAGGAGCAGGG - Intergenic
906855699 1:49302075-49302097 AGAGGAGAAGAGAAGGAGGAAGG - Intronic
907387007 1:54132514-54132536 AAGGAAGAAAAGAAGGAGGGAGG + Intergenic
907462145 1:54611499-54611521 AAGGGATATCAGAAGGGGGAAGG - Intronic
907572150 1:55493168-55493190 AAGGGAGGAAAGCAGGAGGAGGG - Intergenic
907922846 1:58929526-58929548 AAAAGAGAGCATAAGGAGGGCGG - Intergenic
908973256 1:69864133-69864155 AAGAGAGCACATAAGAGGGATGG - Intronic
909156402 1:72083301-72083323 AAGGGAGGAGAGAGGGAGGATGG - Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
910283421 1:85526867-85526889 AAGTGAGAAGAGAAGGAGGGAGG + Intronic
910520002 1:88109760-88109782 AAGGGAGAACAAAATGGGCAAGG - Intergenic
910701941 1:90084960-90084982 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910701947 1:90084987-90085009 AAGGAAGAAAAGAGGGAGGAAGG - Intergenic
910813555 1:91263943-91263965 TAGGTAAATCATAAGGAGGAAGG - Intronic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
910964445 1:92794171-92794193 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
911857966 1:102905430-102905452 AAGGAAGAAAAGAAGGAGGGAGG + Intronic
911965893 1:104371176-104371198 AAGGAAGAAAAGAAGTAGGAAGG - Intergenic
912016100 1:105038465-105038487 AAGGAAGAAAAAAATGAGGAGGG - Intergenic
912178893 1:107193827-107193849 AAGGAAGAAAAAAAGAAGGAAGG - Intronic
912253176 1:108031904-108031926 AAGGGAGAGCATGAAAAGGATGG + Intergenic
913163890 1:116168182-116168204 AAAGGAGAAGCTAAGGAGGGAGG + Intergenic
913481313 1:119291971-119291993 AAGGAAGAACAAAGGAAGGAAGG - Intergenic
913988343 1:143585716-143585738 AAGGGAGGAGAGAAGGAGGGAGG + Intergenic
914206594 1:145536121-145536143 AAGTGAGAAGAGAAGGAGGGAGG - Intergenic
914423383 1:147550954-147550976 ATTCTAGAACATAAGGAGGAAGG + Intronic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916648417 1:166812269-166812291 AAGGGAGAACATGTGGTGGTTGG - Intergenic
917001712 1:170367930-170367952 CAAGGAGAACAAGAGGAGGATGG - Intergenic
918457003 1:184731587-184731609 GAGGGAGGGCATGAGGAGGAAGG - Intronic
918586357 1:186193255-186193277 GAGGGAGAAGGGAAGGAGGAAGG + Intergenic
918633023 1:186741699-186741721 AAGAGAGAACAAAAAGAGGGTGG + Intergenic
919153154 1:193725571-193725593 ATGAGAGAAGAGAAGGAGGAAGG - Intergenic
919161747 1:193839469-193839491 AGGGGAGTAGATAAGGAAGAAGG - Intergenic
919236391 1:194849830-194849852 AAGGAAGAAAAGAGGGAGGAGGG - Intergenic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920209814 1:204320099-204320121 AAAGGAGAGAATAAGGATGATGG - Intronic
920716760 1:208347358-208347380 AAGGGTTATCATAAGGAAGATGG - Intergenic
920976006 1:210786019-210786041 AAGAGAGAAAATAAGTATGACGG - Intronic
921466108 1:215490314-215490336 AAGGGAGAATCTAAGAAGAAAGG + Intergenic
921599110 1:217088755-217088777 AAGGGAAAAGAAAGGGAGGAGGG + Intronic
922812810 1:228427134-228427156 AAGGGAGAAGAAAAAAAGGAAGG - Intergenic
923198460 1:231689988-231690010 AAGGGAGAACATAAGAGGGAGGG + Intronic
923268504 1:232334698-232334720 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
923357634 1:233176352-233176374 ACGGGAGAAGAAAAGGAAGAAGG - Intronic
924005122 1:239600676-239600698 AAGGGAGAAGAAAGGAAGGAAGG - Intronic
924056162 1:240126406-240126428 AACGGAGAGGATAAGGAGGTGGG - Intronic
924949801 1:248872146-248872168 AAGGGAGAAGGAAAGAAGGAAGG - Intergenic
1063427088 10:5958954-5958976 AGGGGAGAACAGGAGGAAGAAGG - Intronic
1063501589 10:6560028-6560050 AGGGGAGAAGAGAAGGAGAAAGG - Intronic
1063525273 10:6778937-6778959 AAGGAAGAAGAGAGGGAGGAAGG + Intergenic
1063907041 10:10791947-10791969 AAGGAAGGAGAGAAGGAGGAAGG + Intergenic
1064844670 10:19638310-19638332 CAGGGAAAACAAAAGGAGGTGGG + Intronic
1064952856 10:20873469-20873491 GAGGAAGAACAGGAGGAGGAGGG + Intronic
1065038729 10:21668291-21668313 AAAGGAGACCAGAAGGAGGTGGG - Intronic
1065348038 10:24767723-24767745 AAGAGAAAACAAAAGAAGGAAGG - Intergenic
1065933426 10:30499738-30499760 AAGAGAGAGCAAAAGAAGGAAGG + Intergenic
1066005418 10:31142263-31142285 CAAGTAGAACATAAGGATGATGG - Intergenic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1067557795 10:47284820-47284842 AGGGGAGAAGAAAAGAAGGAAGG + Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068813623 10:61284905-61284927 AATGGAAAACATGAGTAGGATGG - Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068965427 10:62907202-62907224 AAGGTAGAACTTAAAGAGAATGG - Intronic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069725826 10:70577662-70577684 AAGGGAGAAGAAAAGGAGAAAGG - Intergenic
1070333790 10:75437033-75437055 AGGAGAGAAAATAAGGAGAAAGG - Intronic
1070628969 10:78070875-78070897 GAGGCAGAAATTAAGGAGGAAGG - Intergenic
1070694050 10:78548663-78548685 AAGGAAGAAAGGAAGGAGGAAGG + Intergenic
1070741751 10:78907831-78907853 AAGGCAGAAAATAGGGAAGAAGG + Intergenic
1071024559 10:81097465-81097487 GAGGGAAAGAATAAGGAGGAAGG - Intergenic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071369377 10:84935575-84935597 AAGAGAGAAAACATGGAGGATGG + Intergenic
1071468508 10:85962014-85962036 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1071792635 10:88971758-88971780 TAGGGAGAAAATATGCAGGAAGG - Intronic
1071881408 10:89902676-89902698 ACAGGAGAAAATAAGCAGGATGG - Intergenic
1072815784 10:98507739-98507761 AAGGAGGAACAAAGGGAGGAAGG - Intronic
1073698725 10:105900596-105900618 AAGAAAGACGATAAGGAGGATGG + Intergenic
1074575237 10:114662708-114662730 AATGGAGAAGATATGGAAGAGGG - Intronic
1074731722 10:116385293-116385315 AAGGAAGAATACAAGGAGAAAGG - Intergenic
1074869656 10:117566796-117566818 AAGGGAGAAAATAAAGGGAAAGG + Intergenic
1075065673 10:119287409-119287431 AAGGGAGAAGGTAAGGAGGGAGG + Intronic
1075212405 10:120502345-120502367 AAGGGGGAAGAGAAGGAGGGAGG + Intronic
1076210206 10:128634588-128634610 AAGGGAGAAGCTGAGGTGGAGGG - Intergenic
1076493610 10:130881783-130881805 AAGGGTGAAGACAAGCAGGAAGG - Intergenic
1076558721 10:131347062-131347084 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1076558757 10:131347227-131347249 AAGGAAGGAGATAAGGAAGAAGG - Intergenic
1077359041 11:2132464-2132486 AAGGGAGAAGAGAAAGAGGGGGG + Intronic
1078123595 11:8536095-8536117 AAGGGTGAACGTGGGGAGGAGGG + Intronic
1078987936 11:16613063-16613085 AAGGGAGGAAAAAAGGAGGGGGG + Intronic
1079300675 11:19276387-19276409 TAGGGCAAACATAATGAGGATGG + Intergenic
1079305885 11:19321516-19321538 AAGACAGAACAAAAGGAGGGGGG - Intergenic
1079339833 11:19602746-19602768 AGGGGAGAAGATACAGAGGAGGG - Intronic
1079364910 11:19800650-19800672 AAGAGAGAAAAAAAGGAGAATGG + Intronic
1079697081 11:23495355-23495377 AAGAAAGAAGAGAAGGAGGAAGG + Intergenic
1079902365 11:26203375-26203397 AAGGTAGAGCAACAGGAGGAAGG + Intergenic
1080169760 11:29286005-29286027 AAAGGAGAAGATGAGGGGGATGG - Intergenic
1080219081 11:29879511-29879533 AGGGGAGAGAACAAGGAGGAAGG - Intergenic
1080297044 11:30742181-30742203 AAGAAAGAAGAAAAGGAGGAAGG + Intergenic
1080308355 11:30861342-30861364 ATGGTAGAAAATAAGGGGGAAGG + Intronic
1080466692 11:32504094-32504116 AAGGAAGGAAAGAAGGAGGAAGG + Intergenic
1080604678 11:33855164-33855186 GAGGAAGAACGGAAGGAGGAAGG + Intergenic
1081045184 11:38265107-38265129 AAAGAAGAAGATAAAGAGGAGGG - Intergenic
1081409130 11:42735022-42735044 GAGGGAGGAGAGAAGGAGGAGGG + Intergenic
1081460002 11:43263791-43263813 CAGGGAGAAGCTGAGGAGGATGG - Intergenic
1081678982 11:44988664-44988686 AAGGAAGAAAAAAAGAAGGAAGG + Intergenic
1081684751 11:45034455-45034477 AAGGGAGAAAGCAAGGGGGAAGG + Intergenic
1082022455 11:47546181-47546203 AAGGGAGAAAAATAGGAGAAAGG + Intronic
1082132438 11:48506529-48506551 AAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083041009 11:59687439-59687461 AAGGGAGAAAAAGAGTAGGAAGG + Intergenic
1084406544 11:68977153-68977175 AAGGGGGAAGAAAAGAAGGAAGG + Intergenic
1084528901 11:69715180-69715202 AAGGGAGGAAAGAAAGAGGAAGG + Intergenic
1084756203 11:71240434-71240456 AAGGAAGCACATCAGCAGGAAGG + Intronic
1085235659 11:75013342-75013364 AATGGAGATCAAAGGGAGGATGG - Intronic
1085604004 11:77881087-77881109 AAGAGAGAAAACAAGAAGGAGGG + Intronic
1086092070 11:83014845-83014867 AAGGAAGAAAAGAAAGAGGAAGG + Intronic
1086747948 11:90453787-90453809 AGGTGTGAACATAAAGAGGAAGG - Intergenic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1086847476 11:91769345-91769367 AGAGGATATCATAAGGAGGATGG + Intergenic
1086926747 11:92648940-92648962 AAGGGAGAGCAGAAGGAGAGGGG - Intronic
1086974112 11:93113520-93113542 AAGGGAGAAAATAAGGGGCAGGG - Intergenic
1087053393 11:93908289-93908311 GAGGGAGAAGATCAGGAGGCTGG + Intergenic
1087487160 11:98770763-98770785 AAGGGAGACCATGGGGAAGAGGG + Intergenic
1087726678 11:101725989-101726011 AAGGAAGAGAATAAGGAGGAAGG + Intronic
1088297260 11:108313315-108313337 AAAAGAGAACATAGGGAAGAGGG - Intronic
1088381259 11:109195031-109195053 AAGGGAGAAAGAAAGAAGGAGGG - Intergenic
1088696038 11:112366641-112366663 AAGGAAGAAAAGAAGGAAGAAGG - Intergenic
1088904289 11:114142719-114142741 AAGGGAGGATGTAGGGAGGATGG + Intronic
1089743797 11:120603049-120603071 AAGGTAGGAGAGAAGGAGGAAGG + Intronic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1089965888 11:122655079-122655101 AAGGGAAAAAGAAAGGAGGAAGG - Intergenic
1090568435 11:128021201-128021223 AAGAAAAAACATAAGGAGGAGGG + Intergenic
1090609080 11:128454027-128454049 AAGGGAAACCATAAGGAAGAAGG - Intergenic
1091240261 11:134047328-134047350 GTGGGATAACAAAAGGAGGATGG + Intergenic
1091607939 12:1972854-1972876 AAGAGAGAAAAGAAAGAGGAAGG + Intronic
1091700186 12:2653978-2654000 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1091999206 12:5018908-5018930 AAGATAGAAGACAAGGAGGAGGG - Intergenic
1092180537 12:6443735-6443757 AATGGAGAAAATGAGGAGAAAGG + Intergenic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092671579 12:10867802-10867824 AAGAGACAAAATAGGGAGGAGGG - Intronic
1092745596 12:11669410-11669432 AAGGAAGAAAGGAAGGAGGAAGG - Intronic
1092830807 12:12442734-12442756 GAGGCAGAACATAAGTAGTATGG - Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093087737 12:14885634-14885656 AAGGGGGAAGAAGAGGAGGAGGG + Intronic
1093946025 12:25110489-25110511 AAGGGAGAAGAAAAAGAGGTCGG - Intronic
1094088228 12:26617741-26617763 AAGGAAGGACAGAAGGAGGGAGG + Intronic
1094388176 12:29918164-29918186 AAGGAAGAAAGCAAGGAGGAAGG + Intergenic
1094672703 12:32586599-32586621 AAGGGAAAACAGATGGAGCAGGG + Intronic
1095288680 12:40448686-40448708 AAGGAAGGAAAGAAGGAGGAAGG - Intronic
1095314232 12:40740316-40740338 AAGTAAAAAGATAAGGAGGATGG - Intronic
1095315268 12:40753197-40753219 AAGGAAGGAGATGAGGAGGAGGG - Intronic
1095448264 12:42303445-42303467 AAGGGAGGAAGGAAGGAGGAAGG + Intronic
1096267726 12:50137328-50137350 AAGGGAGAACAGAGAGAGCAAGG + Intronic
1096875241 12:54624893-54624915 AAGGAAGGACAGAAGGAGAAGGG - Intergenic
1098507505 12:71271076-71271098 AAGTGAGAACATAAGGTGTTTGG - Intronic
1098959324 12:76722434-76722456 AAGGAAGAAGAAAAGAAGGAAGG + Intergenic
1098986926 12:77022624-77022646 AAGGAAGAAAAGAAGTAGGAAGG + Exonic
1099051093 12:77782314-77782336 AGGGGAGAAGAAAAGAAGGAAGG - Intergenic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100550756 12:95644438-95644460 AAGGCAGAAAATAAGGGGAAGGG - Intergenic
1100552797 12:95662205-95662227 AAGGAAGAACAGAAGGAGAGGGG - Intronic
1100751528 12:97703435-97703457 AAGGGAGAACATACACATGATGG - Intergenic
1100850149 12:98701795-98701817 AAGAAAGAACAGGAGGAGGAAGG - Intronic
1101377484 12:104183759-104183781 AAGGGAGCACATGAGCAGGATGG + Intergenic
1101383276 12:104232997-104233019 AATGGAGAACAAAGGAAGGAAGG + Intronic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102078601 12:110080012-110080034 AAGGGAGAAGACAGGGAGAAAGG + Intergenic
1102737864 12:115179170-115179192 AAGGGAGAAGGGAAGGAGGAGGG + Intergenic
1102764721 12:115422918-115422940 AAGGGAGGAGAGAAGGAGGAAGG + Intergenic
1102863099 12:116353461-116353483 AAAGAAGAACATAATTAGGAAGG - Intergenic
1103041943 12:117702963-117702985 AAGGGGGAAAATAGTGAGGAAGG + Intronic
1103219497 12:119231993-119232015 AAGGAGGAAGATGAGGAGGATGG - Intergenic
1103608608 12:122107050-122107072 AGAGGAGAACACAAGGAGGAGGG - Intronic
1103698217 12:122834298-122834320 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
1104062407 12:125279611-125279633 AAGAGAGAATATAAGGAAGCTGG + Intronic
1104301726 12:127570603-127570625 AAGAGAGGAAAGAAGGAGGAAGG + Intergenic
1104463197 12:128971387-128971409 AAGGGAGAAAGGAAGGAGGGAGG - Intronic
1105886879 13:24649884-24649906 AAGGGAGGAGGTAGGGAGGAAGG - Intergenic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106099136 13:26679339-26679361 AAGGGTGCCCATCAGGAGGACGG - Intronic
1106125029 13:26894237-26894259 AAGGGAGGAGGGAAGGAGGATGG + Intergenic
1106243082 13:27925456-27925478 GAGGGAGAAGAAGAGGAGGAGGG - Exonic
1106299408 13:28450506-28450528 AAGGGAGAAGGGAAGGAGGGAGG + Intronic
1106502829 13:30345859-30345881 AAGGGTGAACACCAGGAGGTGGG + Intergenic
1106869165 13:34000378-34000400 AAAGGAAATCATGAGGAGGAAGG - Intergenic
1107387796 13:39931396-39931418 AAGTGAGAAGAGAAGAAGGAAGG + Intergenic
1107741734 13:43457481-43457503 AAGGAAGACTATAAGGAGGAGGG + Intronic
1107976446 13:45693108-45693130 AAGGGAGATCACAAAGAGAAGGG + Intergenic
1108166560 13:47699416-47699438 AAGGGAGAGGAAGAGGAGGAGGG - Intergenic
1108179176 13:47823940-47823962 AAGGCAGAACACAAGGCCGAAGG + Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108698944 13:52927307-52927329 AAGGAGGAAGAAAAGGAGGAAGG - Intergenic
1108928808 13:55788907-55788929 AAGGAAGAAGAGAAGGAGAAAGG - Intergenic
1109554630 13:63955820-63955842 AAGGGAGAGCAAAGGGAGTATGG - Intergenic
1109585407 13:64395703-64395725 AAGGGAGAATATTAGGCTGAAGG - Intergenic
1109620884 13:64903064-64903086 AGGGGAAAACATAAGGAAAAAGG + Intergenic
1109750189 13:66681788-66681810 AATAGAGAACAGAAGGTGGATGG - Intronic
1110106131 13:71678620-71678642 AAGGAAGAAAAAAAGAAGGAAGG - Intronic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1110725416 13:78817033-78817055 AAGGCAGAACATGATGAAGAGGG + Intergenic
1111119774 13:83831554-83831576 AGGGAAGAAAAGAAGGAGGAAGG + Intergenic
1111231422 13:85348676-85348698 AAGTGAGAGCAAAAGAAGGAAGG - Intergenic
1111306116 13:86414868-86414890 AGGGGAGAGCATGAGGAGGGAGG - Intergenic
1111317201 13:86578169-86578191 AAGGAAGAAAAAATGGAGGAAGG - Intergenic
1112064573 13:95779567-95779589 AAGGGAGAAGATAAAAATGAAGG - Intronic
1112293030 13:98161769-98161791 AAGGGAGAAAGAAAGAAGGAAGG - Intronic
1113178327 13:107594427-107594449 AAGAGAGAAGATAAGAGGGAAGG - Intronic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114590871 14:23863698-23863720 AAGGCAGAACATATTAAGGAAGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115275627 14:31605928-31605950 AAGAGAGGACAAGAGGAGGAGGG - Intronic
1115275639 14:31605975-31605997 AAGGGAGGACGAGAGGAGGAGGG - Intronic
1115700994 14:35952855-35952877 AAAGGAGACCACAGGGAGGAGGG + Intergenic
1116102087 14:40451541-40451563 AAGGAAGAAAATAAGGAAGAAGG + Intergenic
1116300716 14:43178536-43178558 AAGGGAGAGCATAGGCAAGAAGG - Intergenic
1116659614 14:47692222-47692244 GAGGGAGAACACAAGAAAGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117049998 14:51850374-51850396 AAGGAAGAAGATTAGGAGGGAGG - Intronic
1117819729 14:59635511-59635533 AAAACAGAACATAAGGTGGAAGG + Intronic
1118533905 14:66737210-66737232 AAGGGAGAACAGGAAGAGGAAGG - Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1119180384 14:72601044-72601066 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1119569725 14:75660043-75660065 GAGTGAGAAAATAAAGAGGATGG - Intronic
1119724922 14:76916347-76916369 AAGGGAGAAGATAAGGTCCAAGG + Intergenic
1120127363 14:80761571-80761593 AGAGGAGCACTTAAGGAGGATGG - Exonic
1120356895 14:83445512-83445534 AGGGGAGAACACCATGAGGAAGG - Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120414869 14:84206705-84206727 GAAAGAGAACATAAAGAGGAAGG + Intergenic
1120568163 14:86085187-86085209 AAAGCAGAACATCAGGTGGAAGG - Intergenic
1120895422 14:89527072-89527094 AAGGGAGGAGAGGAGGAGGAAGG + Intronic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121401725 14:93684989-93685011 AAAGTAGAAAAAAAGGAGGAGGG + Intronic
1121471403 14:94157181-94157203 AACTGAGAGCATATGGAGGAAGG - Intronic
1121657092 14:95605080-95605102 AAGGGAGAAAAAAAGGGGCAGGG - Intergenic
1122573003 14:102720786-102720808 AAGGTACAACCCAAGGAGGAGGG - Intronic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123107064 14:105846596-105846618 AAGGGAGAAGGGAAGGAGGATGG - Intergenic
1123470490 15:20548366-20548388 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123647569 15:22452334-22452356 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1123730789 15:23143344-23143366 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1123748928 15:23340770-23340792 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124281300 15:28364653-28364675 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1124301402 15:28546968-28546990 AAGGAAGAAGAAAGGGAGGAAGG - Intergenic
1124717887 15:32083566-32083588 AAGGGATGAGATAAGGAGGGTGG + Intronic
1125037962 15:35149065-35149087 AAGGGAGGAGAGAAGGGGGATGG - Intergenic
1125103428 15:35942628-35942650 AATCAAGAACATGAGGAGGAAGG + Intergenic
1125825695 15:42674441-42674463 AAGGGACAACAAAAATAGGAAGG + Exonic
1126370179 15:47937881-47937903 AAGGAAGAAAGAAAGGAGGAAGG + Intergenic
1126598525 15:50405606-50405628 AAGGGAGAAAAAAAGAGGGAAGG + Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1128705017 15:69832277-69832299 AAGGGAGAAGGGAAGGGGGAAGG + Intergenic
1130164182 15:81436201-81436223 GAGGGAGAATATAGGGAGGTTGG - Intergenic
1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG + Intergenic
1131183546 15:90256633-90256655 AAGGGAGAAAGAAAGAAGGAAGG - Intronic
1131213294 15:90516313-90516335 AAGGAAGAAAGGAAGGAGGAAGG + Intergenic
1131443405 15:92475853-92475875 AATGGATAAGTTAAGGAGGAAGG - Intronic
1131449289 15:92525872-92525894 AAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1131491157 15:92864094-92864116 AAGGAAGAAAATAATAAGGATGG + Intergenic
1131727163 15:95239323-95239345 AAGGAAGAACACAAGGAGAGAGG + Intergenic
1131729689 15:95266987-95267009 GAGGGAGAAAATAACGAGGATGG - Intergenic
1131874784 15:96793127-96793149 AAGTGAGAACATAGAGAGTATGG - Intergenic
1132421890 15:101677042-101677064 AAGTGAGAACATATGGAGTTTGG + Intronic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1132868200 16:2104156-2104178 AAGGGAGAAGAAGAGGAGCAGGG + Intronic
1132997537 16:2830969-2830991 AAGGGAGAAGGTAGGGAGGACGG - Intronic
1133649149 16:7794013-7794035 AAGGGATAATATAAGGAGAGTGG + Intergenic
1133666185 16:7970429-7970451 AAAGGAGAAGAAAAGGAGAAAGG - Intergenic
1134235031 16:12459003-12459025 AAGGGAGAAAGGGAGGAGGAAGG - Intronic
1135547812 16:23377575-23377597 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
1135563952 16:23497539-23497561 AAGAGAGAACACAAGGGCGAGGG + Intronic
1135770445 16:25214337-25214359 AAGGGAGAAAGGAAGGAGGAAGG - Intergenic
1135851454 16:25967712-25967734 AAGTGAGAAGAGAAGGAAGAGGG + Intronic
1135904706 16:26500960-26500982 AAGGGAGAAGAGAATGAGAAGGG + Intergenic
1135938744 16:26803019-26803041 AAGGAAGAAGAGAAGGAGGAAGG + Intergenic
1135938758 16:26803079-26803101 AAGGAAGAAAAGAAGGAGGGAGG + Intergenic
1136221673 16:28833320-28833342 AAGGGAGAAGACAAAGATGAGGG + Exonic
1136699268 16:32116729-32116751 ATGGGAGAGAATAAGGAGGGCGG + Intergenic
1136799759 16:33059900-33059922 ATGGGAGAGAATAAGGAGGGCGG + Intergenic
1136956399 16:34791742-34791764 AAGAGAGAAAGAAAGGAGGAAGG + Intergenic
1137662334 16:50219674-50219696 GAGGGAGAAGAAAAGGGGGAGGG - Intronic
1137781845 16:51103973-51103995 AAGGGAGAACAGAAAAGGGAAGG - Intergenic
1137944282 16:52718695-52718717 AAGAGAGAAAATAAAGAGAAAGG + Intergenic
1138010158 16:53371992-53372014 AAGGAAGAAGAAAGGGAGGAAGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1138418929 16:56886798-56886820 AAGGGAAAACACAAGGAGTGGGG - Intronic
1138442208 16:57041940-57041962 AGGGGAGAACATTAGCAGGTGGG - Intronic
1138621174 16:58212568-58212590 AAAGGAAAGAATAAGGAGGAAGG + Intergenic
1139209946 16:65067713-65067735 AAGGGAGAAGAGAAGAAGAAGGG + Intronic
1139632571 16:68239481-68239503 AAGGTAGAAAATCTGGAGGAAGG - Intergenic
1140438375 16:74967344-74967366 TAAGGAGATGATAAGGAGGAGGG + Intronic
1140731217 16:77858306-77858328 AAGGGAGGGCATAATGAGAAGGG + Intronic
1140799915 16:78476928-78476950 AAGAGGGAACTGAAGGAGGAAGG - Intronic
1140959654 16:79899802-79899824 AAGGGAGAAGAGAAAGAGGAGGG - Intergenic
1141289654 16:82706051-82706073 AAGAGAGAGAATAAGGAAGAAGG - Intronic
1141902636 16:87002684-87002706 TGGGGAGAACAGAGGGAGGAAGG - Intergenic
1142739093 17:1920185-1920207 AAGGCAGGTGATAAGGAGGAAGG + Intergenic
1143311132 17:5990230-5990252 GAGGGAGGAAAAAAGGAGGAAGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143974752 17:10821600-10821622 AGGGGAGGACAGAAGAAGGAGGG - Intergenic
1145710081 17:26963364-26963386 ATGGGAGAAAAGAAGGAGGGCGG + Intergenic
1146291771 17:31612906-31612928 AAAGGAGAGGAGAAGGAGGAGGG - Intergenic
1146979508 17:37146707-37146729 AAGGGAGAGAAGAAGGAGGGGGG + Intronic
1147192952 17:38748007-38748029 AAGGGAGAAAGAAAGGCGGACGG + Intronic
1147341864 17:39757138-39757160 AAGAGAGAACACAATGATGATGG + Intergenic
1147460069 17:40562696-40562718 AAGGAGGAAGATGAGGAGGAAGG - Intronic
1147572246 17:41578599-41578621 AAGAGACAACATGAGGAAGAAGG - Intergenic
1148228190 17:45914044-45914066 AAAGGATAAAAAAAGGAGGAGGG + Intronic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1149109211 17:53006812-53006834 AAAGTAGAACATAATGAGTAGGG + Intergenic
1149180096 17:53925977-53925999 AAGGCAGAAAATGAGGAGTAAGG - Intergenic
1149513638 17:57263278-57263300 AAGGGAGAAGAGAACAAGGAGGG - Intronic
1150129887 17:62663250-62663272 AAGGAAGAAACTAGGGAGGAAGG - Intronic
1150427282 17:65086716-65086738 AAGGGAGAACAGGAAGGGGAAGG - Intergenic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150829605 17:68507406-68507428 AAGTGAGAACATAAGGTGTTTGG - Intergenic
1151345799 17:73500499-73500521 GAAGGAGAACAGAAGGAAGATGG - Intronic
1203183875 17_KI270729v1_random:93306-93328 AAGAGAGAAAGAAAGGAGGAAGG + Intergenic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153750417 18:8223886-8223908 AAGAGAGAACACTAGGAAGAAGG - Intronic
1154224890 18:12494399-12494421 ATGGTAGAACAGAAGGAGCATGG - Intronic
1154345800 18:13542644-13542666 CAGGGAGAAGATAAGGAGGCGGG + Intronic
1154515863 18:15164744-15164766 AAGTGAGAAAGGAAGGAGGAAGG - Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155363509 18:25027832-25027854 TAGGGAAAACAAAAGGAAGAAGG + Intergenic
1155484052 18:26321790-26321812 AATGTAGAACATAAGGACTATGG - Intronic
1156190608 18:34715941-34715963 AGGGGAAAGCAAAAGGAGGAAGG + Intronic
1156608088 18:38692661-38692683 AAGGGAGAACACAGGAAGAAGGG + Intergenic
1156636680 18:39039315-39039337 AAGGAAGGACAGAAGGAGGGAGG + Intergenic
1156883513 18:42108115-42108137 AAGGAAGAGAACAAGGAGGAGGG + Intergenic
1157084992 18:44570980-44571002 AAGGAAGAACATGTGGAGGAGGG + Intergenic
1157424784 18:47575720-47575742 GAGAGAGAACATAAGCACGAGGG - Intergenic
1157843708 18:50982837-50982859 AAGGGAGGGGAAAAGGAGGAGGG - Intronic
1157948619 18:52009283-52009305 AAGGGAGAAAGTACAGAGGAAGG + Intergenic
1158033467 18:52995661-52995683 AACTGAGAACTTAAGGAGGCTGG - Intronic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1158674687 18:59507480-59507502 AAGGAAGAACATGAGGCAGAAGG - Intronic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1159147785 18:64477363-64477385 AAAAGAGAACATAAGGCGAAAGG - Intergenic
1159343582 18:67169302-67169324 AAGAGAGAAAGAAAGGAGGAAGG + Intergenic
1159725128 18:71947995-71948017 AAAGGAGAACAAGAAGAGGAAGG + Intergenic
1160072767 18:75643011-75643033 AAAGGAGAACCCAGGGAGGAGGG + Intergenic
1160709575 19:544849-544871 AAGGGGGAACGAAAGGAGGGAGG - Intronic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162026687 19:7898335-7898357 AAGAGAGAAAATGAGGGGGATGG - Intronic
1162137021 19:8561697-8561719 AAGATAGAAAAAAAGGAGGAAGG - Intronic
1162164954 19:8745997-8746019 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162166025 19:8753461-8753483 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162167091 19:8760917-8760939 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162169100 19:8774673-8774695 AAGGAAGGACAGAAGGAAGAGGG - Intergenic
1162783528 19:13020168-13020190 AGGGGAGAAGAGAAGGAGGCTGG + Intronic
1163093206 19:15035780-15035802 AAGGAAGAAAAAAAAGAGGAAGG + Intergenic
1163198471 19:15743415-15743437 AAGAGAGAAAAAAAGGAGGTTGG + Intergenic
1163376619 19:16937025-16937047 AAGGGAGAAAGGAAAGAGGAAGG - Intronic
1164292415 19:23880209-23880231 AAAGGAGAAAGAAAGGAGGAGGG + Intergenic
1164592462 19:29514065-29514087 AAGAGGGAGGATAAGGAGGAAGG + Intergenic
1164643597 19:29843383-29843405 AAGGGAGAGGAAGAGGAGGAGGG + Intergenic
1164794424 19:31014689-31014711 AAGGAAGAAAAAAAGGAGGGAGG + Intergenic
1165470812 19:36003466-36003488 GAGGAAGAGGATAAGGAGGAAGG + Exonic
1166531097 19:43544036-43544058 AAAGAAGACCATCAGGAGGATGG - Intronic
1166692761 19:44833578-44833600 AAGGAGGAAGAAAAGGAGGAAGG + Intergenic
1166731223 19:45060130-45060152 AGGGGAGAAGATAATGAGCAAGG - Intronic
1167117546 19:47496998-47497020 AAGGGGGCAGATGAGGAGGAAGG + Intronic
1167191220 19:47991522-47991544 AAGAAAGAAGAAAAGGAGGAGGG - Intronic
1167452677 19:49581372-49581394 AGGGGAGGGGATAAGGAGGAGGG - Exonic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1167801846 19:51748173-51748195 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1167964346 19:53131604-53131626 TAGGGAGAAAATAAAGGGGAAGG - Intronic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925221976 2:2149100-2149122 AAGGAAGAAAATAAGGAAGGAGG - Intronic
925507696 2:4586744-4586766 AAAGGAGAAAGGAAGGAGGAAGG - Intergenic
925625903 2:5841966-5841988 AAGGGAGAAATAAAGGAGGAGGG + Intergenic
925791158 2:7489026-7489048 AAGGGAGGAAGGAAGGAGGAAGG + Intergenic
925991850 2:9260644-9260666 AAGGGAGAAGAAAGGCAGGAAGG - Intronic
926008822 2:9392838-9392860 AAGGGAGGAGAGACGGAGGAAGG + Intronic
926211803 2:10876686-10876708 AAGAGAGAGAAAAAGGAGGAAGG - Intergenic
926429151 2:12768085-12768107 AAAGGAGAGCAAAAGGAGGGAGG + Intergenic
926553218 2:14325615-14325637 AAGGGAGGAAAGAAGGAGAAGGG + Intergenic
926576109 2:14584025-14584047 AAGGGAGATACTAACGAGGAGGG - Intergenic
926592842 2:14758084-14758106 AAGGGGGAACATATTCAGGAGGG + Intergenic
927000654 2:18791149-18791171 AAGAGAGAAAAAAAGAAGGAAGG - Intergenic
927275346 2:21257771-21257793 AAGGGAGGACAGAAAAAGGAAGG - Intergenic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
928274088 2:29883083-29883105 AAGGGAGAGAGGAAGGAGGAAGG + Intronic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
929850259 2:45581243-45581265 ATGTGAGAGCATAAGGAGGTAGG - Intronic
930084063 2:47480221-47480243 AAGGGGGAAGGGAAGGAGGAAGG - Intronic
930218348 2:48720313-48720335 AAGGCAGAAGACATGGAGGAGGG - Intronic
930343859 2:50152913-50152935 GAGGGAGAAGAGAAGGAGAAAGG - Intronic
930364284 2:50419595-50419617 AAGGAAGAAAATGAGAAGGAAGG + Intronic
930654220 2:53992159-53992181 AAGGAAGAAAAAAAGTAGGAAGG - Intronic
931137250 2:59416801-59416823 AAAGGAGAACAAAAGGAAGAAGG + Intergenic
931192805 2:60022101-60022123 AAGGGAGAAGGCAAGGGGGAGGG + Intergenic
932174482 2:69586999-69587021 AAGGCAGAAGATATGGAAGAAGG - Intronic
932260445 2:70322412-70322434 AATGGAGTACATAAAGAGGAAGG + Intergenic
933091220 2:78119845-78119867 GAGGGAGAGAATAAGGAGGAAGG + Intergenic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
933892462 2:86784375-86784397 AAGAAAGAACAAAAGGAAGAAGG + Intergenic
934119306 2:88824927-88824949 ATGGGAAGAGATAAGGAGGATGG + Intergenic
934263651 2:91498371-91498393 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
935063286 2:99626527-99626549 AAGGGAGAAGGGAGGGAGGAAGG - Intronic
935552635 2:104474595-104474617 AAGGGATATTATAAAGAGGATGG - Intergenic
935626659 2:105177269-105177291 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
935847715 2:107184834-107184856 AAGGGAGAAGGGCAGGAGGAAGG + Intergenic
936118626 2:109722610-109722632 AAGGGAGAGCATCAGAAGAATGG - Intergenic
936162772 2:110097450-110097472 ATGGGAAGAGATAAGGAGGATGG + Intronic
936233567 2:110724931-110724953 AAGGAAGAACGGAGGGAGGAAGG + Intergenic
936344037 2:111661671-111661693 AAGGGAGAATATTAGTAGGAAGG - Intergenic
936445362 2:112590547-112590569 AAGGGAGACAATAGAGAGGAAGG + Intergenic
936527991 2:113255154-113255176 AAGGAAGAAAAAAAGAAGGAAGG + Intronic
936658220 2:114513002-114513024 GAAGGAGAAGAAAAGGAGGAAGG + Intronic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937677071 2:124603050-124603072 AAGGAAGAAAAGAAGAAGGAAGG - Intronic
937915408 2:127096538-127096560 AAGTTAGGACATAGGGAGGAAGG - Intronic
938043430 2:128095425-128095447 AAGGAGGAAGAGAAGGAGGAGGG - Intronic
938708281 2:133953026-133953048 AAGGGAGAACAGAAACAGGAAGG + Intergenic
938869897 2:135464267-135464289 AAAGAAGAACAAAAGGAGGTAGG - Intronic
939232035 2:139440157-139440179 AAGGGAGAAGAGAAAGAGGGAGG - Intergenic
939523321 2:143260845-143260867 AATGGAGAACAGAGGAAGGATGG - Intronic
939603882 2:144228556-144228578 AAAGGAGAAAAGAAGGAGAATGG + Intronic
939673048 2:145037502-145037524 AAGAGAGAAAATAGGGAAGAAGG - Intergenic
939722293 2:145668824-145668846 AATGGAGACTAGAAGGAGGAGGG + Intergenic
939884286 2:147664439-147664461 AAGGGAGAAAGTGAGGAGGCTGG - Intergenic
940314039 2:152308779-152308801 AAAAAAGAACATAAGGAAGAAGG + Intergenic
940527506 2:154835683-154835705 AAGGGAGAGAGAAAGGAGGAAGG - Intronic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
940723195 2:157304523-157304545 AAGGGAGAAAACAAGGAAGCTGG - Intronic
940990512 2:160091887-160091909 CAGTGGGAAAATAAGGAGGAAGG - Intergenic
941306501 2:163875486-163875508 GAGGGAGATCATAAGGAAGATGG - Intergenic
941592279 2:167434712-167434734 AAGGGAAAAAATAAGGGGGGGGG - Intergenic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942826441 2:180182542-180182564 AAGTGAGAACATAAGGTATATGG + Intergenic
943585553 2:189735138-189735160 AAGGGTGCACATGAGGAGTAAGG - Intronic
943936969 2:193931666-193931688 AAGGGAGAAAGGAAGGAAGAGGG + Intergenic
944522503 2:200586374-200586396 AAAGGGGAACATAAGGAAGGTGG - Intronic
945022650 2:205589567-205589589 AAGGGAGTAAATAAAAAGGAAGG - Intronic
945309673 2:208296640-208296662 AAGGGAGGAAATAAGGACTAAGG + Intronic
945752480 2:213804957-213804979 AGGGAAGAACATAATGAGAATGG + Intronic
945843550 2:214916233-214916255 AAGAGAGAAAGTAGGGAGGATGG - Intergenic
945911184 2:215651448-215651470 AAGGAAGAAAGGAAGGAGGAAGG + Intergenic
946045297 2:216816036-216816058 AGGGAAGAAGAGAAGGAGGATGG - Intergenic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946625225 2:221604428-221604450 AAGAGACAATATAAGGTGGAAGG - Intergenic
946831891 2:223735853-223735875 AAGTTTGAACATGAGGAGGAGGG - Intergenic
946832773 2:223742884-223742906 AATGGAGAGCATGGGGAGGATGG - Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947099779 2:226607453-226607475 AAGGGCAAACATAAAAAGGACGG + Intergenic
947786765 2:232829684-232829706 AAGGGGGACCATCAGAAGGAAGG - Intronic
948181966 2:235989400-235989422 AGGTGAAAACATCAGGAGGAGGG + Intronic
948209595 2:236183052-236183074 AAGGAGGAAGACAAGGAGGAGGG - Intergenic
948289921 2:236817265-236817287 AAGGGAGAAAGGAAGGAGGGAGG - Intergenic
948790527 2:240374339-240374361 AAGGGACCAGAGAAGGAGGATGG + Intergenic
948791954 2:240383734-240383756 AAGAAAGAACAAAAGGAAGATGG - Intergenic
949063802 2:241976911-241976933 AAGGAAGAACAGAAAAAGGATGG - Intergenic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169461196 20:5797160-5797182 AAGGAAAAACAAAAGGGGGAAGG + Intronic
1169812758 20:9625250-9625272 GAGTGAGAACATCAGGATGAAGG - Intronic
1170194987 20:13680505-13680527 AAGTGAGAACATAGAGAGCAAGG - Intergenic
1170508945 20:17057422-17057444 AAGGGATAACACAAGGACAAGGG + Intergenic
1170731103 20:18975442-18975464 AAGGGAGAAAAAGAGGAAGAGGG - Intergenic
1170980452 20:21207429-21207451 AAGGAGGAAGATGAGGAGGAGGG - Intronic
1171156316 20:22877933-22877955 AATGGTGAACACAAGAAGGAGGG - Intergenic
1171360295 20:24582373-24582395 AAGGGAGGACATATGGGGGGAGG - Intronic
1171370932 20:24661519-24661541 GAGGGAGGAAAAAAGGAGGAAGG + Intronic
1171943967 20:31359286-31359308 AAGGCAGAACAAAGGGAAGAAGG + Intergenic
1172858093 20:38023911-38023933 CAGGAAGAACATGCGGAGGAGGG + Intronic
1172947384 20:38699998-38700020 AAGAGAGAAAAAAAGGAGAAAGG + Intergenic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173564125 20:44027322-44027344 ACGGGGAAACATAAGAAGGAGGG - Intronic
1174320300 20:49736437-49736459 AATGGAGAACAAAAGTGGGAAGG - Intergenic
1174753948 20:53139929-53139951 ATGAGTGAACATAAAGAGGATGG - Intronic
1175293671 20:57894652-57894674 AAGGAAGAAGGGAAGGAGGAAGG + Intergenic
1175714273 20:61245329-61245351 AAAGGAGACCCTAAGGAAGAAGG - Intergenic
1176901065 21:14442824-14442846 AATGGAAAACATAAGAAGGAAGG + Intergenic
1177724728 21:24952057-24952079 AAGTGAGACCATCAGGAGAAGGG - Intergenic
1178163945 21:29950273-29950295 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1179141139 21:38726530-38726552 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1179215866 21:39366817-39366839 AAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1179255906 21:39715018-39715040 AAGGGAGAAAAAAGGAAGGAAGG - Intergenic
1179266219 21:39805800-39805822 AATGGAGAATATAAAGGGGATGG + Intergenic
1180927076 22:19562883-19562905 AAGGGAGACCCTAAGGAGAGTGG - Intergenic
1181539634 22:23566398-23566420 ACGGGAGAACGGGAGGAGGAGGG + Intergenic
1182411232 22:30188734-30188756 AAAGGAAAAAATAAGGAGGTGGG - Intergenic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1183106073 22:35616024-35616046 AAGGGAGACCCAAAGGACGACGG + Intronic
1183328157 22:37205465-37205487 AAGGGAGAAGAGGAAGAGGAAGG - Exonic
1184001172 22:41674708-41674730 AAGGGAGGATAAAAGGATGAAGG + Exonic
1184262604 22:43328017-43328039 AAGGGAAACCACAAGGAGGTTGG + Intronic
1184318084 22:43714331-43714353 AAGGAAGGATAGAAGGAGGAAGG + Intronic
1184692327 22:46122958-46122980 AAGCGAGAACAGAGGGAGGTGGG - Intergenic
1185226693 22:49657510-49657532 AAGAGAGAACGTGAGGGGGAGGG + Intronic
1203289113 22_KI270735v1_random:17240-17262 ATGGGAGAAAAGAAGGAGGGCGG - Intergenic
949355761 3:3179337-3179359 AACTCAGAACACAAGGAGGATGG + Intronic
949914418 3:8947372-8947394 GATGGAGAACCTCAGGAGGATGG - Intronic
950077834 3:10199758-10199780 AAGGGAGACCGAGAGGAGGAAGG + Intronic
950768836 3:15294431-15294453 AAGGGAGGAAGAAAGGAGGATGG - Intronic
950905055 3:16530519-16530541 AGGGAAGAAGAGAAGGAGGAGGG - Intergenic
950943000 3:16912974-16912996 AAGGGAGAAGAACAGAAGGAAGG - Intronic
951119014 3:18901545-18901567 AGGAGTGAACATCAGGAGGAGGG + Intergenic
951353422 3:21634309-21634331 AAGGGAGAAAGGAAAGAGGAAGG + Intronic
951520875 3:23609831-23609853 AAGGAAGAAGGGAAGGAGGAAGG + Intergenic
951534185 3:23726531-23726553 AAGAAAGAAAAGAAGGAGGAAGG + Intergenic
951914295 3:27783184-27783206 AGGGGAGAAGGGAAGGAGGAAGG + Intergenic
952274593 3:31865061-31865083 AAGGGAGAAGAAAAGAAGGGAGG + Intronic
952303033 3:32121164-32121186 AAGGGAGGAGAAAAAGAGGAGGG - Intronic
952661739 3:35858725-35858747 AAGGGAGACCCCAAGAAGGAAGG + Intergenic
953049845 3:39331042-39331064 AAGGGAGAAAAAAAGAAGGAAGG + Intronic
953611183 3:44448912-44448934 AAGGGAGAAGAAAAGCAAGATGG + Intronic
954793718 3:53150722-53150744 AGGGGAGAAGATCTGGAGGAAGG - Intergenic
954906469 3:54067514-54067536 AAGTGAGAAGAGAGGGAGGAAGG - Intergenic
955314648 3:57926333-57926355 AAGGAAGAGGATAAGGAGGAAGG - Intronic
955407729 3:58636019-58636041 AAAGGAGAAAAGAAGGATGATGG - Intronic
956162570 3:66370687-66370709 AAAGCAGAACATAAGCAGAAGGG - Intronic
956203694 3:66733962-66733984 AGGGGAGAACACTAGGATGAAGG + Intergenic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
956639353 3:71400910-71400932 AGGAGAACACATAAGGAGGAGGG + Intronic
957507435 3:81140912-81140934 AAGGGAGAAGGGAAGAAGGAAGG + Intergenic
957749746 3:84398773-84398795 AAGCAAGAAAATAAAGAGGAAGG - Intergenic
957878380 3:86178764-86178786 AAGGAAGACCATATTGAGGAGGG - Intergenic
957944219 3:87041801-87041823 AAGAGAGAAGACAAGGAGGGAGG - Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958181580 3:90067464-90067486 AAGGAAGAAAACAAGGAGAAGGG + Intergenic
958906001 3:99942895-99942917 AGGGGAGAAAAGAAGAAGGAAGG + Intronic
959182131 3:102994609-102994631 AAGGAAGAATAGAAGGAAGATGG + Intergenic
960411178 3:117326908-117326930 GGGTGAGAAAATAAGGAGGAGGG - Intergenic
960654978 3:119993208-119993230 AAGCCAGAACATAATGAGGTTGG + Intronic
960942027 3:122941164-122941186 CAGGCAGAAGAAAAGGAGGAAGG + Intronic
960942585 3:122944286-122944308 AAGGGAGAACAGAAGCACAAAGG - Intronic
961340161 3:126212417-126212439 AAGGGAGGAAAGAAGGAGGGAGG + Intergenic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
961985216 3:131124574-131124596 AAGGGAGAAGAGGAGGAGAATGG + Intronic
962004444 3:131333785-131333807 AATGGAGAACAAAAGAAGGCAGG + Intronic
962611102 3:137076889-137076911 ATGGGAGAAAAAAATGAGGAGGG + Intergenic
962705991 3:138045213-138045235 AAGGCAGAACAAAAGGAGCCTGG + Intergenic
962957357 3:140278489-140278511 AAAGGAGGCCAGAAGGAGGAGGG - Intronic
963003973 3:140708772-140708794 AAGAGAGAGGATGAGGAGGAAGG + Intergenic
963159448 3:142135637-142135659 AAGGGAGAACATATGGTGTTTGG + Intronic
963180914 3:142355077-142355099 ATGGGGGAAGATAGGGAGGAGGG + Intronic
963583736 3:147158573-147158595 AAGGAAGAAAAGAAAGAGGAAGG + Intergenic
963952130 3:151214488-151214510 AAGGAAGAACAGAGGGAGGGAGG - Intronic
964486403 3:157189374-157189396 AAGAAAGAACAAAAGAAGGAAGG + Intergenic
965153902 3:165020340-165020362 CAAGAAGAACATAAAGAGGAAGG + Intronic
965474375 3:169136774-169136796 AAGGGGGAAAATAAGAAAGAAGG + Intronic
965515855 3:169620175-169620197 AGGGGAGTACAAAAGAAGGAAGG - Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
966444560 3:179987275-179987297 AAGGGAGGAATGAAGGAGGAAGG - Intronic
967277971 3:187795271-187795293 GAGGGAGGAGGTAAGGAGGAAGG + Intergenic
967277979 3:187795314-187795336 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
967334808 3:188332061-188332083 AAGAGAGAAGGAAAGGAGGAGGG - Intronic
967627126 3:191699735-191699757 AAGGAAGAGAAAAAGGAGGAGGG + Intergenic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
968682533 4:1931062-1931084 AAGAGAGGACACAAGAAGGAAGG + Intronic
968837537 4:2976210-2976232 AAGGAAGAAGGGAAGGAGGAGGG - Intronic
969088852 4:4677342-4677364 AATTGAGAAGGTAAGGAGGAGGG - Intergenic
969498449 4:7539562-7539584 AAGGAAGAAAACAAGGAGGGAGG - Intronic
969798094 4:9541550-9541572 AAGTCAGAACAAGAGGAGGAGGG + Intergenic
970189637 4:13501473-13501495 AAGGAAGAACATAGGGCAGATGG - Intergenic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
971172205 4:24244975-24244997 AATGGAGAAAAAAAGAAGGATGG + Intergenic
971723911 4:30283533-30283555 AAAGGAGAACAAAGGAAGGAGGG - Intergenic
971865169 4:32160513-32160535 AAGGAAGGAGAGAAGGAGGAAGG - Intergenic
971989478 4:33872746-33872768 AAGGGAGAAAATAAAAAGGAAGG - Intergenic
972598553 4:40551597-40551619 AAGGAAGTACACAAGGAAGAGGG + Intronic
972998086 4:44908097-44908119 AAGGCAGAACTTCAGCAGGAAGG - Intergenic
973076908 4:45940413-45940435 AAGGAAGAAAAGAAGGGGGAAGG + Intergenic
973686302 4:53373460-53373482 ATGGAAGTACATAAAGAGGAAGG + Intergenic
974012899 4:56623711-56623733 AAGAGAAAAAATGAGGAGGAAGG - Intergenic
974247611 4:59340740-59340762 AAGGGAGAAGGGAGGGAGGAAGG + Intergenic
974554089 4:63420795-63420817 AAGGAAGAAAAGAAGAAGGAAGG - Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
975362639 4:73489240-73489262 AAGGGAGAAGGTAAGGAAAAAGG - Intronic
976126079 4:81835053-81835075 AAGGAGGAACAGAGGGAGGAAGG + Intronic
976449747 4:85174543-85174565 AAGGGAGCACATCATGGGGAAGG - Intergenic
976554467 4:86433771-86433793 AAGGGAGCATTGAAGGAGGAAGG + Intronic
977156784 4:93583760-93583782 AAGTGAGAACTGAAGGAGAATGG - Intronic
977178749 4:93846722-93846744 CAGGAAGAAGATAAAGAGGAGGG - Intergenic
978377760 4:108093781-108093803 AAGGGAGAAAATATCAAGGATGG + Intronic
978468721 4:109037976-109037998 AATGGATAAAAGAAGGAGGAAGG + Intronic
979168638 4:117570642-117570664 AAGGGAGAACATAAGTTAGGTGG - Intergenic
979281762 4:118876608-118876630 AAAAGAGAAAAGAAGGAGGAGGG - Intronic
979931191 4:126632961-126632983 AAGGGAGAAAAGAAGGGAGAGGG + Intergenic
980190677 4:129520487-129520509 GAGGAAGAAGAGAAGGAGGAGGG + Intergenic
980449762 4:132955855-132955877 GAGTGAGGACATAAAGAGGAAGG + Intergenic
980875640 4:138659410-138659432 GAGGGAGAAGAGAAGCAGGAGGG + Intergenic
981210712 4:142100754-142100776 AAGGGAGAGCATGATGATGAAGG + Intronic
981470867 4:145132873-145132895 AAGGGAGAAAGGAAGGAGAAAGG - Intronic
981609506 4:146578168-146578190 AGGGGAGAACATAAAAAGGTAGG + Intergenic
981956770 4:150484744-150484766 AAGGGAGAGGGTAAGGGGGAGGG - Intronic
982058477 4:151577922-151577944 AAGGGAGAAGATGAGGAAGTTGG - Exonic
982135151 4:152268235-152268257 TAGGGAGAAAAAAAGCAGGATGG + Intergenic
982154994 4:152510518-152510540 AAGGGAGGAGAGAAAGAGGAGGG + Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982718759 4:158837853-158837875 AAGGGAGCACAGATGGTGGAGGG + Intronic
982884903 4:160766363-160766385 AAGGGAGGAAAGAAGAAGGAAGG + Intergenic
983500940 4:168499241-168499263 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
984050994 4:174865113-174865135 CATGGAGAACACAAGGAGAAAGG + Intronic
984687365 4:182685217-182685239 AGGGAAGAAGAGAAGGAGGAAGG - Intronic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984911237 4:184676394-184676416 AAGGGAGAAGGGAAGGGGGAAGG - Intronic
984911249 4:184676425-184676447 AAGGGAGAAGGGAAGGGGGAAGG - Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985797395 5:1973118-1973140 AAGGAAGAAGAGAAGAAGGAAGG - Intergenic
986118309 5:4803041-4803063 AAGAGAGAAAAGAAAGAGGAAGG + Intergenic
986236847 5:5918717-5918739 AAGGAAGAAGAGGAGGAGGAAGG + Intergenic
986627571 5:9736928-9736950 TAGGGAGAACTTAATGAGAAAGG - Intergenic
987246504 5:16054382-16054404 AAGGGGGAACAAAAGGAAGAAGG + Intergenic
987722146 5:21650833-21650855 AAGGAAGGTCAAAAGGAGGAAGG - Intergenic
987851289 5:23358754-23358776 AAGGAAGAGGATGAGGAGGAGGG - Intergenic
987953299 5:24704196-24704218 AATGGAGAACACAATGAGAAAGG - Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
989100320 5:37817125-37817147 TAGGGAGATCACATGGAGGAAGG + Intronic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
990156937 5:52888236-52888258 AAGCAAAAACATAAGAAGGAAGG + Intronic
991208796 5:64080857-64080879 TAGGGACACCAAAAGGAGGATGG - Intergenic
991409588 5:66332936-66332958 AAGGGAGAACAGAAGCAGTGAGG - Intergenic
992256712 5:74928703-74928725 AAGGAAGAAGGAAAGGAGGAAGG - Intergenic
992475417 5:77097142-77097164 AAGGAAGAAGAGAAGGAGGGAGG + Intergenic
992552588 5:77873361-77873383 AAGGAAGGAAAGAAGGAGGAAGG - Intergenic
992823884 5:80528287-80528309 AAGGGGGAAAAAAAGAAGGAAGG + Intronic
993775722 5:91993274-91993296 AAGGGAGAAAAGAGAGAGGAAGG + Intergenic
994213742 5:97113966-97113988 AAAGGAGAACAACAGGAGGGAGG - Intronic
994372734 5:98985775-98985797 AAGGGAAAAAGAAAGGAGGAAGG + Intergenic
994588978 5:101749901-101749923 AAGGGAGCCCATGATGAGGACGG - Intergenic
994791840 5:104237153-104237175 GAGTGAGAACAGAAGGAGGTGGG + Intergenic
995150344 5:108836804-108836826 AAGGAAGAAGATAAAGAAGAGGG - Intronic
995369199 5:111399785-111399807 AAGAAAGAACATACCGAGGAAGG - Intronic
995885328 5:116888152-116888174 AAGGGAGAGCAGCAGGAGGGTGG + Intergenic
996034585 5:118744002-118744024 AGGGAAGAAGAGAAGGAGGAAGG + Intergenic
996155794 5:120098440-120098462 GCTGGAGAACATACGGAGGAAGG - Intergenic
996313740 5:122137694-122137716 AAGGGAGAGCAAAAGGAGATAGG + Intronic
996502526 5:124232538-124232560 AAAGGAGAAAAAAAGAAGGAAGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
997509946 5:134447186-134447208 AAGAAAGAACAGGAGGAGGAGGG + Intergenic
998587310 5:143440537-143440559 AAGGAAGGAGATAAGGAAGAAGG - Intergenic
998664868 5:144285391-144285413 AAGAGAGAACATTAAGAGGCTGG - Intronic
999990361 5:157044351-157044373 AAGGGAGAAAGAAAGGACGAAGG + Intronic
1000299242 5:159940445-159940467 AAGAGAAAACATCAGGAGTAAGG - Intronic
1000974984 5:167754892-167754914 AAGGGAGCAGAAAGGGAGGAGGG + Intronic
1001690884 5:173631540-173631562 GAAGGAGGAGATAAGGAGGAGGG - Intergenic
1001711303 5:173780559-173780581 TTTGGAGAACAAAAGGAGGAAGG - Intergenic
1001747009 5:174099752-174099774 ATGGAAGAACATTAGGATGAGGG - Intronic
1001914471 5:175548036-175548058 AAGGGAGAACAAAAGGATTGGGG - Intergenic
1001919424 5:175588692-175588714 AGGGGAGGAGAAAAGGAGGAGGG + Intergenic
1002102353 5:176863772-176863794 AAGGGGGTAAAGAAGGAGGAGGG - Intronic
1002189180 5:177469948-177469970 AAGGGAGAAGAGAAAGAGGAGGG + Intronic
1002511761 5:179724747-179724769 AAGGGAGATGAGGAGGAGGAAGG + Exonic
1003737778 6:8896863-8896885 AAGGAAGAAAAGAAAGAGGAAGG - Intergenic
1004479004 6:16001078-16001100 AGGGGAGATGATGAGGAGGAAGG + Intergenic
1005378816 6:25213143-25213165 AAGTGAGAACACATGGAGGAAGG + Intergenic
1005500609 6:26426104-26426126 AAGGAAGAAGAAAAGGATGAGGG - Intergenic
1005505137 6:26463094-26463116 AAGGAAGAAAAAAAGGATGAGGG - Intronic
1005702066 6:28412078-28412100 AAGGAAGAAAGAAAGGAGGAAGG + Intergenic
1006101594 6:31689214-31689236 AAGGGATAACATAGGGGGAATGG - Intronic
1006826633 6:36940634-36940656 GAGGGAGAAGAAAAGGAGGCGGG + Intergenic
1007741052 6:44009655-44009677 AAGGGAGAAGGGAAGGAGGGAGG + Intergenic
1007821496 6:44563663-44563685 AGGGGACAACAAAAGGAAGATGG + Intergenic
1008127264 6:47682589-47682611 CAGGGAGAAGATAATGTGGAAGG - Exonic
1008614646 6:53214721-53214743 AGGGGAGAACAGTGGGAGGAGGG - Intergenic
1008663099 6:53689421-53689443 AAGGGAGACCAAAAGAAGAATGG - Intergenic
1009514935 6:64603265-64603287 AAGAAAGAAGAGAAGGAGGATGG - Intronic
1009704938 6:67238580-67238602 AGGGGAGAAGAAAAGAAGGAAGG + Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009917789 6:70017618-70017640 AAGGGAAAACATAAGAAGCTGGG + Intronic
1009957004 6:70467700-70467722 AAAGGAGAAAAGAAGGAGAAAGG - Intronic
1010192693 6:73209907-73209929 AATGGAGAAGACAAGGATGAAGG + Exonic
1010335744 6:74681419-74681441 AGGGGATTTCATAAGGAGGAAGG + Intergenic
1010524218 6:76880568-76880590 AAAGGAGAATAGAAGGTGGAGGG + Intergenic
1010591043 6:77712673-77712695 AAGGAACAACAAAAGGAGGCCGG + Intronic
1010892723 6:81334239-81334261 AAGGGAGCACATATGGAAGGAGG + Intergenic
1010995861 6:82531677-82531699 GTGGGAGAAAAGAAGGAGGATGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012152665 6:95774497-95774519 AAGGAAGAACATAAGCAGACAGG + Intergenic
1012572925 6:100753418-100753440 AAGTGACATGATAAGGAGGAAGG + Intronic
1012961770 6:105629869-105629891 AAGGCAGCACATAAGAAAGAGGG + Intergenic
1013330720 6:109097298-109097320 AATGGAGAACTAATGGAGGAGGG - Intronic
1013661518 6:112302120-112302142 AAGGTAGAAGATATGTAGGATGG - Intergenic
1014818505 6:125959982-125960004 ATGGCAGAAAATAAAGAGGAAGG + Intronic
1014884637 6:126764791-126764813 AGGGGAGAACAGATGGAAGAGGG + Intergenic
1014931403 6:127340802-127340824 AATCTAGAAAATAAGGAGGAGGG + Intronic
1015392998 6:132703879-132703901 AATGGAAAACAAAAGGAGCAGGG + Intronic
1015872880 6:137794787-137794809 AAGTGGGAAGAAAAGGAGGAAGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017276437 6:152574479-152574501 AAGTGAGAGCAAGAGGAGGAAGG - Intronic
1017307326 6:152934266-152934288 AATGGAGAACAGAAGGAATAGGG + Intergenic
1018036924 6:159889572-159889594 AAGGCAGAAAAGAAGGAGCACGG - Intergenic
1018069957 6:160155555-160155577 AAGGGAGAAAGGAAGAAGGAGGG + Intronic
1018083834 6:160283865-160283887 AAGAAAGAACATAAGGAAAAAGG - Intergenic
1018473467 6:164117497-164117519 AAGAGAGAACAAAAGGAAAATGG - Intergenic
1019327603 7:445993-446015 GATGGAGAAAAGAAGGAGGAGGG + Intergenic
1019334897 7:478438-478460 AAGGGAGGACAAAGGGAGGAAGG + Intergenic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019828834 7:3305572-3305594 AAGGGAGTAGGTTAGGAGGAGGG - Intronic
1020080090 7:5282410-5282432 AAGGGAGGAGAGCAGGAGGAGGG + Intronic
1020656970 7:10939981-10940003 AAGGGAAAACATTAGGAGAGCGG + Intronic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021163771 7:17308205-17308227 AAGAGAGAAAAGAAGAAGGATGG - Intronic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1022098399 7:27155024-27155046 AAGAAAGAGCATAAGGACGAAGG - Exonic
1022182017 7:27929915-27929937 AATGCAGAAAATATGGAGGAAGG - Intronic
1022216061 7:28262787-28262809 AAGGAAGGAAAGAAGGAGGAGGG - Intergenic
1022624790 7:32024201-32024223 AAGGGAGGAAACAGGGAGGAAGG + Intronic
1023306986 7:38841018-38841040 AAATGAGAACAAAAGGGGGAAGG - Intronic
1023449269 7:40265462-40265484 AAGGAAGAAAAGAAGGAGGGGGG - Intronic
1024525288 7:50343236-50343258 AAGGGAAAGAAAAAGGAGGAAGG - Intronic
1025056841 7:55772040-55772062 ACGGGAGGATGTAAGGAGGAAGG + Intergenic
1025157031 7:56616372-56616394 TAGGCAGAACCTAAGAAGGAGGG + Intergenic
1025198831 7:56949806-56949828 AAGGGAGGAGAGCAGGAGGAGGG - Intergenic
1025673115 7:63627127-63627149 AAGGGAGGAGAGCAGGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026394396 7:69936873-69936895 AAGGGAGAGAAAAAGGAGAAAGG - Intronic
1026800599 7:73397737-73397759 AAGGGGGAAGAAAAGGAGAAGGG + Intergenic
1026890858 7:73981417-73981439 AAGGAAGAAGAAAAGAAGGAAGG + Intergenic
1026962832 7:74420054-74420076 AAGGAAGAAGAGAAGGAGGGAGG - Intergenic
1027815086 7:82958392-82958414 AAAGGAGAAGAAAAGAAGGAGGG - Intronic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028210568 7:88069196-88069218 AAGGAGAAACATAGGGAGGAAGG - Intronic
1028267242 7:88741399-88741421 AAGGGTGAACAAAAGGAGAGTGG - Intergenic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029273548 7:99391344-99391366 AAGGAAGAAAAAAAGGAGGGAGG - Intronic
1029786618 7:102798210-102798232 AGGGAAGTAAATAAGGAGGAAGG + Intronic
1030164518 7:106540441-106540463 AAGGAAGAAAGAAAGGAGGAAGG - Intergenic
1030337858 7:108344942-108344964 GAGGGAGAAGATAAGAAGGAAGG + Intronic
1031257074 7:119466820-119466842 AAGGGAGTAAATAAGAAGAAGGG + Intergenic
1031363365 7:120874109-120874131 AAAGGAGAAGAAAAGGAGAAAGG + Intergenic
1031729784 7:125285075-125285097 AAGGCAGGACAGAAGGAGGGAGG + Intergenic
1031828609 7:126598524-126598546 AAGTGAGGACATTAGGAAGAAGG - Intronic
1032150265 7:129422999-129423021 ATTCGAGAACATGAGGAGGAGGG - Intronic
1032457243 7:132082639-132082661 CAAGGAGAACATAATTAGGAAGG - Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1034040314 7:147870772-147870794 AAAATGGAACATAAGGAGGATGG + Intronic
1034691341 7:153016584-153016606 AAGGAAAAACATCAGGCGGACGG - Intergenic
1035278568 7:157763284-157763306 AAGGGAGAGAAAAATGAGGAGGG - Intronic
1035601534 8:899969-899991 AAGGCAGAAGACATGGAGGATGG + Intergenic
1036509280 8:9385545-9385567 AAAGTAGAACACAAGGAGGAAGG + Intergenic
1036718066 8:11144993-11145015 AAGGGAGAAGGGAGGGAGGAAGG + Intronic
1036897854 8:12650152-12650174 AAGTCAGGACAAAAGGAGGAGGG - Intergenic
1036962921 8:13265670-13265692 AAGGAAGAAGAGAAGGAAGAAGG - Intronic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1037172341 8:15907954-15907976 AAGTGAGCAAATTAGGAGGAAGG - Intergenic
1037476938 8:19267195-19267217 AAGGGAGAAGAGTGGGAGGAGGG + Intergenic
1037704483 8:21307661-21307683 AAAGGATAACTTAAGCAGGATGG + Intergenic
1037744246 8:21630412-21630434 AAAGGAGATGATTAGGAGGATGG + Intergenic
1038294240 8:26276318-26276340 AAGTGAGAATATCTGGAGGATGG + Intergenic
1039024050 8:33238459-33238481 AAGTGAGAAGATAAGGAGCTTGG + Intergenic
1039382626 8:37100247-37100269 GAGGGAGAAAGTAAGGAAGAGGG - Intergenic
1039623684 8:39025400-39025422 CAGGGTGAACATGAGGAGTAAGG - Intronic
1039802432 8:40970887-40970909 CAGGAAGAAGATAAGGTGGAAGG - Intergenic
1040464596 8:47682721-47682743 AAGGTATAACATAAGGAATAGGG + Intronic
1040787273 8:51180464-51180486 TAGAGAGAAGATAAGGAGGAAGG - Intergenic
1040980822 8:53244761-53244783 TAAGGAGAACAGAAAGAGGATGG + Intronic
1041387273 8:57318001-57318023 AAGGGAGAAGAGAGGCAGGAAGG - Intergenic
1041696269 8:60740226-60740248 AAGGCAGGACCTAAGCAGGAAGG - Intronic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041815903 8:61970711-61970733 AAGGAAGAAGAAAAGGAGAAGGG - Intergenic
1042117891 8:65452127-65452149 AAGGTAGAATAAAAGGAGGGAGG - Intergenic
1042502716 8:69526851-69526873 AAGGAAGGAAAGAAGGAGGAAGG + Intronic
1042624845 8:70746909-70746931 AAGGGAGAAGACAGGGAGGAGGG - Intronic
1043267524 8:78285470-78285492 AAGGAAGAGCATAAGGCAGAGGG + Intergenic
1043485380 8:80693922-80693944 AAGGTAGAATAGAAGGAGGGAGG + Intronic
1043531771 8:81159157-81159179 TGGAGAGAACATCAGGAGGAAGG - Intergenic
1044220659 8:89665293-89665315 AAGAGAAAACATGAGGGGGAAGG - Intergenic
1044390255 8:91641594-91641616 AATGAAGAGCATAAGGAGGCAGG - Intergenic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045254204 8:100506010-100506032 AAGGGAGAAGATCAGGAGTTCGG - Intergenic
1045398980 8:101792361-101792383 AAGGAAGATGAAAAGGAGGATGG - Intronic
1045582794 8:103499386-103499408 GAGGGAGAACGTGAGGAGGGAGG - Intergenic
1045755114 8:105533702-105533724 GAGGGAGAAAGTAAGGAGGGAGG - Intronic
1046092951 8:109524828-109524850 AAGGAAGGACAGAAGGAGGGAGG - Intronic
1046186610 8:110729735-110729757 AAGGGAGAAAAGAAGGAAAATGG + Intergenic
1046623836 8:116556625-116556647 GAGAGAGAAAATAAGGATGAGGG + Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047348575 8:124051880-124051902 AAGGGAGAAAATTTTGAGGATGG + Intronic
1047622533 8:126622567-126622589 AAGGGAGAAAATAAGGAGAAAGG - Intergenic
1047703998 8:127479193-127479215 AGGGGAGAGAAAAAGGAGGAAGG + Intergenic
1047928600 8:129704409-129704431 AAGGGAGGAGAGAAGGAGGTAGG - Intergenic
1048437361 8:134431056-134431078 AAAGAAAAACATAAGGAGCATGG + Intergenic
1048551653 8:135438887-135438909 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048551657 8:135438914-135438936 AAGGAAGAAGAGAAGGAAGAAGG + Intergenic
1048629027 8:136220370-136220392 GGGGGAGAAAATAATGAGGAGGG + Intergenic
1048687923 8:136925118-136925140 AAGGGAGAACATAATGATAAAGG + Intergenic
1049066437 8:140320047-140320069 AAGGAAAAACCTAAGGAAGAAGG + Intronic
1050048333 9:1572845-1572867 AAGGGAAAACATAAAAAGGCAGG - Intergenic
1050290161 9:4145730-4145752 GAGGGGGAACAAAGGGAGGAGGG - Intronic
1050753684 9:8973207-8973229 GAGGGAGGAGAGAAGGAGGAGGG - Intronic
1051262214 9:15275656-15275678 AAGGGAGGACATAAGGAGCTTGG + Intronic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052434592 9:28409922-28409944 AAGGGAGAAGGAAAGGAAGAGGG + Intronic
1052434607 9:28409982-28410004 AAGGGAGAAGGAAAGGAAGAGGG + Intronic
1052540230 9:29802242-29802264 AGGGGGGAAAAAAAGGAGGAGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1054821837 9:69530473-69530495 AAGTGAGAACATGAGGAGTTTGG - Intronic
1055037674 9:71835830-71835852 AAGGAAGAAAAGAAGAAGGAAGG - Intergenic
1055130685 9:72770867-72770889 GAGGAAGAACAAAAGGAAGAAGG - Intronic
1055703454 9:78971818-78971840 AATGGAGAAAAGAAGGAGGGAGG + Intergenic
1055950346 9:81724409-81724431 AAGGAAGAATCAAAGGAGGAGGG - Intergenic
1056472034 9:86915048-86915070 AAGGGAGAATGGAAAGAGGAAGG + Intergenic
1057716076 9:97497429-97497451 AAATGAGAACAGAAAGAGGAAGG + Intergenic
1059038337 9:110784865-110784887 AAGGAAGAAGAGGAGGAGGAAGG - Exonic
1059642493 9:116231335-116231357 AAGGAAGAAGATAAGGAAGGGGG - Intronic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059730351 9:117050921-117050943 AAAGGACAACATATGGGGGAGGG - Intronic
1059873685 9:118607530-118607552 AGGGGAGAAGGAAAGGAGGAGGG - Intergenic
1059876897 9:118645272-118645294 AAGGCAGGAAATAGGGAGGAAGG - Intergenic
1060116139 9:120942517-120942539 AAGGGAGAAAGGAAGGAGGGAGG + Intergenic
1060777196 9:126383682-126383704 AAGAGAGAACAGATGGGGGAGGG + Intronic
1062074738 9:134579769-134579791 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074755 9:134579811-134579833 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1062074773 9:134579854-134579876 AAGGGGGAAGAGGAGGAGGAGGG + Intergenic
1185575559 X:1169266-1169288 AGTGGAGAAGAAAAGGAGGAGGG + Intergenic
1185766839 X:2732498-2732520 AAGAGAGAAAAGAAGGAGGGAGG - Intronic
1186020076 X:5245211-5245233 AAGGAAGAAGAAAAGAAGGAAGG - Intergenic
1186111945 X:6266901-6266923 AAGGGAGGAAAGAGGGAGGAGGG + Intergenic
1186258500 X:7749578-7749600 AAGGAAGAAAGGAAGGAGGAAGG + Intergenic
1186828798 X:13369191-13369213 AAAGAAGAAAATAAGGGGGAAGG - Intergenic
1187075090 X:15927061-15927083 ATGGGAGCAGAAAAGGAGGAAGG + Intergenic
1187422855 X:19151337-19151359 AAGGGAGAAGAGATAGAGGAAGG - Intergenic
1187830287 X:23374239-23374261 AAGGGAGGAGGGAAGGAGGAAGG - Intronic
1188048646 X:25457435-25457457 AAGTCAGAAAATAATGAGGATGG - Intergenic
1188050415 X:25478536-25478558 GAGGGAGAGCAAGAGGAGGAAGG - Intergenic
1188425361 X:30040778-30040800 AAGAGAGAAAAGAAGAAGGAAGG - Intergenic
1188566880 X:31536707-31536729 AGGGGAGAAGGGAAGGAGGATGG - Intronic
1188747262 X:33861497-33861519 GAGAGAGAACATAAAGAGGAGGG + Intergenic
1189102080 X:38201316-38201338 AAGGGAGAAAGAAAGAAGGAAGG + Intronic
1189161114 X:38809900-38809922 AATGCAGAACAGAGGGAGGAAGG - Intergenic
1189166517 X:38866459-38866481 AAGGAAGTAAACAAGGAGGAGGG - Intergenic
1189961192 X:46326420-46326442 AAGAGAAAACACTAGGAGGATGG - Intergenic
1190071315 X:47282179-47282201 AAGGGAGAAAGGAAGGAGGAAGG - Intergenic
1190641020 X:52482761-52482783 AAGGAAGAGGAAAAGGAGGAAGG - Intergenic
1190646652 X:52530104-52530126 AAGGAAGAGGAAAAGGAGGAAGG + Intergenic
1190703049 X:53002417-53002439 AAGGGAGAGAATGTGGAGGAAGG + Intergenic
1191039894 X:56068036-56068058 AAGGGAGACCATGAGGCTGAAGG - Intergenic
1191054341 X:56227038-56227060 AAGGGAGAGAATAAAGAGGGTGG - Intergenic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1192227157 X:69237223-69237245 AAATGAGAACACAAGGAGGAAGG - Intergenic
1192546996 X:72022511-72022533 AAGTGAGGACACAAGGAGAAGGG - Intergenic
1194145966 X:90263378-90263400 AAGGAAGAACATAAGAAGCATGG + Intergenic
1194499396 X:94660936-94660958 AAGAGAGAACATCAGGGGCAAGG - Intergenic
1194988114 X:100513238-100513260 AAGGGAGAATGAAAGAAGGATGG - Intergenic
1195067395 X:101250186-101250208 AAGAGAGAATATCAGGGGGAGGG - Intronic
1195097916 X:101523999-101524021 AAGGCAGGACATAAGGATAAAGG - Intronic
1195427146 X:104747321-104747343 AAGGGAGGAGGGAAGGAGGAAGG - Intronic
1195479288 X:105324230-105324252 AATGGAGTACAGAGGGAGGAAGG + Intronic
1195860003 X:109373529-109373551 AAGGGTGAAAATAAGTATGAAGG - Intronic
1196145635 X:112313918-112313940 AAGGGAGATCAAAAGGAAGTGGG + Intergenic
1196267704 X:113671079-113671101 AAGGAAGAAAATAAGGAAAATGG - Intergenic
1197269029 X:124405837-124405859 AAGGAAGAACAGAAGAAGAAAGG - Intronic
1197453851 X:126652446-126652468 AAAGGATAACATAAGGAAGGAGG - Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1197902296 X:131387406-131387428 AAGTGAGAACATAACGAGTTAGG + Intronic
1198197050 X:134373510-134373532 GCGGGAGAAGACAAGGAGGATGG + Intronic
1198381227 X:136085315-136085337 AAGGGCTAACATATGGAAGAGGG - Intergenic
1198441717 X:136669770-136669792 AAGTGAGTAGAAAAGGAGGAGGG - Intronic
1198518748 X:137431762-137431784 AAGGAAGAACAAAGGAAGGAAGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1199029972 X:142986134-142986156 AATGGAGAAGCTAAGGATGAGGG - Intergenic
1200491710 Y:3832670-3832692 AAGGAAGAACATAAGAAGCATGG + Intergenic
1200838947 Y:7760849-7760871 AGGGGAAAATATAAGGAGCAAGG + Intergenic