ID: 946171327

View in Genome Browser
Species Human (GRCh38)
Location 2:217897730-217897752
Sequence ATGTAGAGGTGGTGAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946171327 Original CRISPR ATGTAGAGGTGGTGAGCAGA TGG Intronic
900347185 1:2215389-2215411 ATGCAGAGGCGGAGAGCAGGAGG + Intergenic
902799967 1:18823213-18823235 ATGTAGTGGTGAGGAGCAGTGGG - Intergenic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903673702 1:25051561-25051583 AGGTGGAGGTGGAGTGCAGAGGG - Intergenic
905886038 1:41492534-41492556 ATGGGGAGGTGGCGAGTAGATGG - Intergenic
908599964 1:65728128-65728150 ATGTGGAGGTGGTCACCAGGAGG - Intergenic
909837603 1:80276598-80276620 ATGGAGAGGTGGAAAGGAGATGG - Intergenic
911356644 1:96829216-96829238 AAGAAGAGCTGGTGACCAGAAGG + Intergenic
911878663 1:103204086-103204108 ATGTAGGCGTGGTTAGCAGAAGG + Intergenic
912310372 1:108614712-108614734 AGGTAGAGATGATGAGAAGAGGG - Intronic
912446253 1:109739395-109739417 TAGTAGAGGTGGCGGGCAGAAGG - Intronic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912584768 1:110752326-110752348 ATCAAGAAGTGGTGAGCTGAAGG - Intergenic
913528538 1:119715907-119715929 CTGCAGAGGATGTGAGCAGATGG + Intronic
914222979 1:145696929-145696951 ATGTAGTGCTGCTGTGCAGATGG - Intronic
914958918 1:152189098-152189120 TGGTAGAGGTGGGGAGCCGAGGG + Intergenic
915713560 1:157923916-157923938 ATGTAGATCTGGTGAGAGGATGG + Intergenic
916335030 1:163661454-163661476 ATTGACAGGTGGTGAGCAGGTGG + Intergenic
917271179 1:173276348-173276370 TGGTAGAGGTGGAGAGGAGAAGG - Intergenic
918117688 1:181510860-181510882 AGGAAGAGGTGGGGAGTAGAGGG + Intronic
920359893 1:205407384-205407406 AGGTAGAGGAGGGGAGCTGAAGG + Intronic
920634898 1:207692459-207692481 ATGGAGAGGTGGTCACCAGGAGG - Intronic
920737167 1:208543247-208543269 AGGTGGAGGAGGTGAGAAGACGG + Intergenic
920747015 1:208638408-208638430 AGGGAGGGGTGGTGTGCAGAGGG - Intergenic
921261488 1:213388644-213388666 ATTTAGGGGTGATGAGGAGATGG - Intergenic
921543386 1:216446383-216446405 AATTAGAGATGGTAAGCAGATGG - Intergenic
923678457 1:236100182-236100204 ATGCAGAGGTGGTGGGAAGAAGG - Intergenic
1064961224 10:20967079-20967101 GTGTAGAGCTGGTGAGCTGTAGG - Intronic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1068012759 10:51475152-51475174 ACATAGAGGTAGGGAGCAGAAGG - Intronic
1068263701 10:54619577-54619599 ATGCAGAGATGTTAAGCAGAGGG + Intronic
1070407342 10:76108712-76108734 TTGGATAGGTGCTGAGCAGAGGG - Intronic
1070735035 10:78857459-78857481 AGGAAGGGGTGGTGAGGAGATGG - Intergenic
1070848466 10:79543160-79543182 ATACAGAGCTGGTGAGGAGAAGG + Intergenic
1071534641 10:86418017-86418039 ATTTAGAAGGGGTCAGCAGAGGG - Intergenic
1072811470 10:98465978-98466000 ATGGAGACCTGGGGAGCAGAGGG - Intronic
1074147026 10:110725962-110725984 AGGCAGTGGTGCTGAGCAGATGG + Intronic
1074818969 10:117165266-117165288 ATGCAGAAGCAGTGAGCAGACGG - Intergenic
1075870693 10:125771046-125771068 AGATTGAGGTGGTGCGCAGAGGG + Intronic
1076504108 10:130960612-130960634 ATGGAGGAGGGGTGAGCAGAGGG + Intergenic
1077038975 11:509454-509476 ATGTATAGGTGCTGAGCGCACGG + Intergenic
1077253186 11:1569717-1569739 ATTTCTAGGTGCTGAGCAGAAGG - Intronic
1077321909 11:1946567-1946589 GTGGAGAGGGGGTGAGCAAACGG + Intergenic
1077363136 11:2149696-2149718 ATGTGGAGGTGGTGGGGAGTGGG + Intronic
1077528146 11:3081094-3081116 CTGGAGAGGTGGTGAGGAGGTGG + Intergenic
1078332948 11:10440966-10440988 ATGGAGAGGAGCTGAACAGAAGG + Intronic
1078414011 11:11150338-11150360 TTGGAGTGGTTGTGAGCAGAAGG + Intergenic
1078896781 11:15603846-15603868 GTGTAGAGGTGAGGAGTAGATGG + Intergenic
1079324620 11:19480979-19481001 ATGTTGTGGGGCTGAGCAGATGG + Intronic
1080005149 11:27398765-27398787 TTGCAGAGGTGGTTACCAGATGG + Intronic
1080677336 11:34439870-34439892 ATGTAGAGGGAGTGACCAGGTGG + Intronic
1081632988 11:44701938-44701960 AGGTAGATGTGGTGGGCAGAAGG - Intergenic
1086783176 11:90932110-90932132 AGGTAGTGGTGGAGAGAAGATGG - Intergenic
1202804925 11_KI270721v1_random:1880-1902 GTGGAGAGGGGGTGAGCAAACGG + Intergenic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1092999034 12:13978327-13978349 TTGTAGACGTGGTGAGAACATGG + Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1095477129 12:42596986-42597008 ATGGAGAGCTGGTGGGGAGAAGG + Intergenic
1095733978 12:45536112-45536134 ATGGGTAGGTGGAGAGCAGATGG - Intergenic
1096836921 12:54357035-54357057 TTGGAGAGGGGGTGAGCATAAGG + Intergenic
1097402637 12:59148159-59148181 AAGGAGAAGTGGTGAGCAAAGGG - Intergenic
1098888383 12:75983226-75983248 ATGTAGAAGAGCTGAGCTGAAGG - Intergenic
1099089610 12:78288901-78288923 ATGTAGAATTGGTGAGTTGATGG + Intergenic
1100483807 12:95005341-95005363 ATGTAGTGTTGGTGAGGAGGTGG - Intergenic
1101111387 12:101489913-101489935 ATGGGGAGGTGATGAGCAAAGGG + Intergenic
1101467314 12:104961096-104961118 ATGTGGAGGAGGAGATCAGAAGG + Intergenic
1101647899 12:106648149-106648171 ATGAAGAAGTGGTTAGCAGATGG + Intronic
1102245554 12:111353589-111353611 AAGTAGAGGAGGAGTGCAGAAGG + Intergenic
1102940434 12:116936772-116936794 ACGGGGATGTGGTGAGCAGAAGG + Intronic
1103027478 12:117585245-117585267 ATGGAGAGGTGGTGATAATAAGG - Intronic
1103966310 12:124642053-124642075 ATGTAGGGGTGTTGGGCAGAAGG + Intergenic
1104226617 12:126841097-126841119 AGGAAGAAGTGGAGAGCAGATGG - Intergenic
1104534170 12:129602901-129602923 ATGGAGAGGTGCTGAGCAAAAGG + Intronic
1105766331 13:23563418-23563440 ATGAAAAGTTGGAGAGCAGAAGG + Intergenic
1106103319 13:26713097-26713119 ATGTAGAGTTGGGCAGCAGTGGG + Intergenic
1107249625 13:38343112-38343134 AAGTGGAGGTTGTGAGCTGATGG - Intergenic
1107666602 13:42697211-42697233 ATGTCGAGGAAGGGAGCAGATGG - Intergenic
1109097530 13:58136814-58136836 ATGGAGAAGTGGTAAGCAGAGGG + Intergenic
1109198029 13:59400630-59400652 AAGTAGAGGAGGTGTGCTGAGGG - Intergenic
1110566086 13:76959016-76959038 AAGGAGAAGTGCTGAGCAGAAGG + Intergenic
1111324287 13:86671690-86671712 ATATTGAAGTGGTGATCAGAAGG - Intergenic
1112186673 13:97134487-97134509 GGGGAGAGGTGGGGAGCAGAAGG - Intergenic
1112896574 13:104306579-104306601 ATGGGGACGTGGTGAGAAGATGG + Intergenic
1115487806 14:33929297-33929319 TTGGAGTGGTGGTTAGCAGATGG - Intronic
1115711140 14:36052383-36052405 ATGTAAAGGAGGTGAGAAGCTGG - Intergenic
1117987086 14:61397143-61397165 ATGTAGGGGTGGAGAGGAGGGGG + Intronic
1118096665 14:62545341-62545363 AGGTAGTGGTGGTGAGCCCAAGG + Intergenic
1118158687 14:63267167-63267189 AAGGTGAGGTGGTGGGCAGAGGG - Intronic
1118828328 14:69405023-69405045 ATGGAGAAGTGCTGAGCAAAAGG + Intronic
1120663601 14:87279506-87279528 AAGAACAAGTGGTGAGCAGAGGG - Intergenic
1120687534 14:87555216-87555238 GTGTAGAGGGGGTGAGAAAACGG - Intergenic
1121321699 14:92995273-92995295 CTGTGGAGTGGGTGAGCAGAGGG - Intronic
1122238470 14:100346075-100346097 AAGTAGAGGAGGGGATCAGAAGG + Intronic
1122625082 14:103080930-103080952 ATGAACAGGTGCTGAGCGGATGG + Intergenic
1122835615 14:104429436-104429458 CTGGAGAGGGTGTGAGCAGATGG - Intergenic
1124077528 15:26460575-26460597 GTGTAGGGGTAGTGGGCAGATGG - Intergenic
1124089709 15:26586900-26586922 ATGGGGAGGTGATGAGCAAAGGG + Intronic
1125093318 15:35821002-35821024 AATTTGAGGTGGTGAGAAGAGGG - Intergenic
1125726618 15:41871510-41871532 GTGCAGAGGTGCTGAGAAGAGGG + Exonic
1126427066 15:48539176-48539198 ACGTAGTGATGGGGAGCAGATGG - Intronic
1127038089 15:54941932-54941954 TGGTAGAGGTGGAGAGAAGAGGG - Intergenic
1128161378 15:65424864-65424886 CTGGAGAGGTGGTGAGCACAGGG - Intergenic
1128799760 15:70489940-70489962 CTGTAGGGGTGGGGAGCTGAGGG + Intergenic
1129742016 15:77993879-77993901 ATGTTGAGTTGGGGAGCAGCAGG - Intronic
1132064854 15:98722526-98722548 ATATGGAGGTGGGGGGCAGAGGG - Intronic
1136643854 16:31591686-31591708 GTGTAGGGGTGGGGAGCAGAAGG - Intergenic
1136661751 16:31769084-31769106 GTGTAGGGGTGGGGAGCAGAAGG + Intronic
1138795513 16:59963465-59963487 AGGTAGGGGTGATGAGCGGAAGG + Intergenic
1139110743 16:63887526-63887548 AAGTAGAGGAGGTGAGTAGGAGG + Intergenic
1139956934 16:70697659-70697681 CTGCAGAGGTGGGGAGGAGATGG - Intronic
1144171536 17:12664126-12664148 ATGTAGAAGAGGGAAGCAGAAGG + Intergenic
1144968567 17:19093115-19093137 ATGTAGAAGTGCAGAGGAGAAGG + Exonic
1147555935 17:41479141-41479163 ATGCAGAGGAGGTGAGCATGGGG - Intronic
1148150329 17:45393258-45393280 ATGAAGAGGAGTCGAGCAGAGGG - Intergenic
1148197150 17:45722219-45722241 ATGAAGACCTGCTGAGCAGAAGG - Intergenic
1148390662 17:47270005-47270027 ATGGAGAAGTGCTGAGCAAAGGG + Intronic
1149083091 17:52681621-52681643 ATGTAAAGGTCGTGAGCAGGGGG - Intergenic
1151261672 17:72920586-72920608 TTGTAGAGGGGGTGGGAAGAGGG - Intronic
1151415435 17:73959334-73959356 GTGTAGAGGTGTTGAGTAGGAGG - Intergenic
1152055750 17:78024727-78024749 AACTAGTGGTGGTGAGGAGAGGG - Intronic
1152417671 17:80173248-80173270 ATGGAGAGGCAGAGAGCAGAGGG - Intronic
1152650545 17:81490521-81490543 ATGTGGAGGGGGTAGGCAGAGGG - Intergenic
1155878089 18:31111703-31111725 ATGTAGAGGAGGGAGGCAGACGG + Intergenic
1155884108 18:31186635-31186657 ATCAAGAAGTGGTGAGCAGAGGG + Intergenic
1156130382 18:33965668-33965690 AAGGAGAAGTGCTGAGCAGAAGG - Intronic
1157306445 18:46521029-46521051 AGGTTGAGGTGGGGAGCAGCAGG - Intronic
1158300434 18:56046284-56046306 GTGCAGAGGTGGTGAGAAGAAGG - Intergenic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1159660311 18:71088057-71088079 ATGGAGAGGATGTGAGCAAAAGG - Intergenic
1159852918 18:73547710-73547732 AAGGAGAGGTGTTGAGCAAATGG - Intergenic
1159927018 18:74278524-74278546 AAGGAGAGGTGGTGAGAAGGGGG - Intronic
1163161972 19:15470159-15470181 AGGCAGAGGTGGGGAGGAGAAGG - Intronic
1163197584 19:15733908-15733930 ATGGAGAGGAAGGGAGCAGATGG + Intergenic
1163454908 19:17400835-17400857 AGGTGGAGGTGGTGAGCAAGGGG + Intergenic
1163654758 19:18539284-18539306 AAGTAGATGGGGTGAGCCGAGGG + Intronic
1164771212 19:30810646-30810668 AGGTAGAGATGGTGACCAGCAGG - Intergenic
1164998668 19:32742983-32743005 CTGTAGAAGTGCTGAGCAGGAGG + Intronic
1166173377 19:41048194-41048216 TTGGAGGGATGGTGAGCAGAGGG - Intergenic
1166917749 19:46207167-46207189 ATGTGGAGGTGCTGAGAGGATGG - Intergenic
1166993002 19:46704483-46704505 CTGAAGAGCTGGTGAGGAGATGG - Exonic
1167250607 19:48396707-48396729 AAGGTGAGGTGGTGGGCAGAGGG + Intronic
1167388685 19:49180061-49180083 ATGTAGTGGAGGTGAGCAATAGG - Intronic
1167718519 19:51160847-51160869 AGGCAGAGGAGGGGAGCAGAGGG + Intergenic
927119195 2:19938888-19938910 AGGTAGAGGAGTTGAGGAGATGG - Intronic
927405164 2:22758169-22758191 CTGAAGAGGTGCTGAGCAGAAGG - Intergenic
927474846 2:23405365-23405387 ATGATGAGGTGATGAGTAGATGG - Intronic
928461128 2:31473659-31473681 CTGAGGAGGTGGTTAGCAGAGGG + Intergenic
928718581 2:34092685-34092707 ATGTAGAGATGCTAAGTAGATGG - Intergenic
930390888 2:50760786-50760808 AGGCAGATGTGGTAAGCAGATGG + Intronic
930418354 2:51118344-51118366 AAGTAGTGGTGGCAAGCAGAGGG - Intergenic
931439977 2:62282419-62282441 ATGTAGAGGTGTTGAGGGGTGGG + Intergenic
931568128 2:63638155-63638177 ATGAAGAGATGGTGGGCAAAGGG + Intronic
933412052 2:81939083-81939105 GTGGAGAGGTTGTGAGTAGATGG - Intergenic
934516546 2:94991662-94991684 ATGTAGAGGTTGTGAACAGAGGG - Intergenic
935368518 2:102320273-102320295 CTGCAGAGGTGGTGAGCATCTGG - Intronic
936162150 2:110091970-110091992 ATGCAGAGGTCATGAACAGAGGG + Intronic
936182512 2:110279384-110279406 ATGCAGAGGTCATGAACAGAGGG - Intergenic
936548711 2:113415987-113416009 AAGGAGAGGTGCTGAGCAAAAGG - Intergenic
937259691 2:120577430-120577452 ATTTAGGGATGGTGAGTAGAAGG - Intergenic
937335880 2:121062151-121062173 ACGGAGAGGTGGAGAGCAGGCGG + Intergenic
939053676 2:137335538-137335560 ATTTAGAGGTTGTGAGCATAGGG - Intronic
939971991 2:148672602-148672624 ATTAAGCGGTGGTGAGCAAAAGG - Intronic
940026012 2:149209167-149209189 TTGTAAAGGTGGTGAGAAGGCGG + Intronic
941595185 2:167467575-167467597 TTGTAGAGCAGGGGAGCAGAAGG + Intergenic
942061206 2:172230229-172230251 ATGTAGAGGTTTGGAGTAGAAGG - Intergenic
942413261 2:175733572-175733594 GTGTGGAGGTGGTGAGGTGATGG + Intergenic
942991282 2:182206537-182206559 ATGAAGAGGTGGAGCACAGAGGG - Intronic
945575699 2:211525823-211525845 CTGTAGTGGTGGTGACCACAGGG + Intronic
946171327 2:217897730-217897752 ATGTAGAGGTGGTGAGCAGATGG + Intronic
946194397 2:218024475-218024497 CTGCAGAGGTGGGGAGCTGATGG + Intergenic
946667662 2:222067680-222067702 AGGTAGAGGTTAGGAGCAGAGGG - Intergenic
948274731 2:236699670-236699692 CTGGAGAGATGGTGAGAAGATGG + Intergenic
948902613 2:240964056-240964078 GTGCAGAGCTGGGGAGCAGAGGG + Intronic
1170293962 20:14804387-14804409 TTGTAGAGGATCTGAGCAGATGG + Intronic
1170349585 20:15424287-15424309 ATTTTGAGGTGGTAAACAGATGG - Intronic
1170576635 20:17667740-17667762 AAGTAGCAGTGATGAGCAGATGG - Intronic
1170813866 20:19696763-19696785 AGGAAGAGGTGGTCAGCTGAGGG - Intronic
1171264481 20:23759735-23759757 ATGGTGAGGAGGTGAGCAGGAGG + Intergenic
1171400967 20:24872820-24872842 CTTTAGAGCTGGTGAGCAGCTGG + Intergenic
1172049909 20:32109621-32109643 CTGTAGTGGCGGTCAGCAGAGGG - Exonic
1172908204 20:38385265-38385287 AAGGAGAAGTGCTGAGCAGAAGG - Intergenic
1174050630 20:47765027-47765049 ATTTGGAGGTGGAGAGAAGATGG - Intronic
1175440719 20:58989306-58989328 ATGGAGAGGTGGTCAGCCCAGGG + Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1178278994 21:31264894-31264916 ATGTGGAGGTGGTTTGTAGATGG - Intronic
1178612671 21:34098488-34098510 ATGTAGAGGCTGTGTACAGATGG - Exonic
1179220990 21:39407318-39407340 TTCTAGAGCTGGTGAGAAGATGG + Intronic
1179417278 21:41208745-41208767 AGGCAGAGATGGGGAGCAGAGGG - Intronic
1179484666 21:41702231-41702253 AAGGAGAGGTGCCGAGCAGAAGG + Intergenic
1179498384 21:41790521-41790543 TTATAGAGGTAGAGAGCAGATGG + Intergenic
1180825486 22:18858161-18858183 ATGAGGATGTGGTGGGCAGAGGG - Intronic
1181049472 22:20231769-20231791 ATGGAGAGCTGGAGAGCAGCTGG + Intergenic
1181187246 22:21116386-21116408 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181211952 22:21294107-21294129 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181397545 22:22632779-22632801 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181651861 22:24263279-24263301 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181705516 22:24647460-24647482 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1182886287 22:33776939-33776961 ATGCAGAGATGGTCAGCACATGG + Intronic
1183027643 22:35077792-35077814 ATTTAGAGGTGGGGTGAAGAAGG - Intronic
1183743865 22:39682354-39682376 AGGTAGAGGAGGTGAGAGGAAGG + Intronic
1183777032 22:39972948-39972970 GTGTGGAGTTGGTGGGCAGATGG + Exonic
1183876707 22:40789062-40789084 AAGTAGAGATGGTCAGAAGATGG - Intronic
1184292317 22:43503981-43504003 AAATAGAGGTGGTGAGAAGAGGG + Intronic
1203215002 22_KI270731v1_random:1325-1347 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1203275634 22_KI270734v1_random:84064-84086 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
950359084 3:12437665-12437687 AGGATGAGGGGGTGAGCAGAAGG - Intergenic
950626390 3:14250428-14250450 AGGGAGAGGGGGTGAGGAGAGGG - Intergenic
950912811 3:16612647-16612669 ATGTAGAGCTGGTGGTCAAAAGG - Intronic
953749823 3:45600659-45600681 CTGCAGAGGTGGGGTGCAGAGGG + Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954901323 3:54022374-54022396 GTGGAGAGGTGGTGAGATGAGGG + Intergenic
955516177 3:59728758-59728780 ATGTTGAGGTGCTGTGCAGGAGG + Intergenic
955779811 3:62472544-62472566 GTGAAGAGGTGCAGAGCAGAGGG + Intronic
957765878 3:84622844-84622866 AAGGAGAGGTGCTGAGCAAAAGG + Intergenic
958820814 3:98971628-98971650 ATGTAGAGGAAGTCAGTAGAAGG + Intergenic
959496610 3:107059303-107059325 ATGTAGATGTGTTTGGCAGAGGG - Intergenic
960118201 3:113919131-113919153 AATTAGGGGTGCTGAGCAGAAGG + Intronic
961475667 3:127144921-127144943 ATGTACAGCTGGTGAGGAGCAGG - Intergenic
961620533 3:128220627-128220649 AGTTAGAAGTGGGGAGCAGAAGG - Intronic
962342350 3:134596257-134596279 CTGTAAAGGTGGGTAGCAGAGGG - Intergenic
962594939 3:136932498-136932520 ATGTAGATGAAGTGAACAGATGG + Intronic
963035217 3:141019829-141019851 AGGGAGAGCTGGTGGGCAGAGGG + Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
965465277 3:169022178-169022200 ATAAAGAGATGGTGAACAGATGG + Intergenic
965768634 3:172157588-172157610 ATTTAGAGATGGAGAACAGATGG - Intronic
965879551 3:173372033-173372055 ATGCAGAAGAGGTCAGCAGATGG + Intergenic
966474584 3:180329178-180329200 ATGTAGAGGCAGTGTGGAGAGGG - Intergenic
967607276 3:191462209-191462231 AAGGAGAGTTGGTGAGTAGAGGG + Intergenic
968946108 4:3665344-3665366 ATGTATATGTGGGGAACAGATGG - Intergenic
969199528 4:5591509-5591531 CTGCAGAGGTGCAGAGCAGAGGG + Intronic
971331848 4:25688229-25688251 ATGGAGGGGTGGGGAGCAGGAGG - Intergenic
972635136 4:40877469-40877491 ATGTAGGGGTGGGGTGCTGAGGG + Intronic
973115371 4:46451158-46451180 ATGTGGAGGTAGTGAGGAGAAGG + Intronic
973159176 4:46994008-46994030 TGGTAGCGGTGGTGAGGAGAGGG + Exonic
973175673 4:47202233-47202255 ATGGAGAAGCGCTGAGCAGAGGG - Intronic
975547723 4:75577161-75577183 ATGTACTGGTGGGGAGCAGTGGG - Intergenic
977626862 4:99197381-99197403 ATGTAGAGGAGGGGATCAAAAGG - Intergenic
977657297 4:99536686-99536708 ATGTAGAGGAGCAGGGCAGATGG + Intronic
978524187 4:109647881-109647903 AGGAAGAGGTGCTGGGCAGATGG + Intronic
979145509 4:117241552-117241574 ATGAAGAGCTAGTGAGCAGGTGG + Intergenic
979972541 4:127154806-127154828 CTGCACAGGAGGTGAGCAGAAGG + Intergenic
982069479 4:151682911-151682933 GTGCAGAGGAGGGGAGCAGAAGG - Intronic
983671870 4:170246961-170246983 AGGTAAAGGAGGTGAGCAGCAGG + Intergenic
984691898 4:182735500-182735522 ATGTGGAGGTGGTGGGGAAAGGG + Intronic
985641020 5:1063606-1063628 AGGTGGAGGTGGGGAGGAGAAGG - Intronic
985818890 5:2146677-2146699 AGGTAGTGATGGTGAGGAGATGG - Intergenic
986079769 5:4378158-4378180 ATGTTGATGTGATGAACAGATGG + Intergenic
988474007 5:31566668-31566690 ATGGAGAAGTGCTGAGCAAAAGG + Intergenic
988583639 5:32490387-32490409 GTTTTGAGGTTGTGAGCAGATGG + Intergenic
989179463 5:38562136-38562158 ATGGAGAGGGGCAGAGCAGAGGG - Intronic
989377165 5:40776484-40776506 ATTTAGGGGTGGTCAGCATATGG + Intronic
990723908 5:58731959-58731981 TTGCAGAAGTGGTTAGCAGAAGG + Intronic
991600077 5:68343359-68343381 ATGGAGAAGTGGTGGGCAGTGGG - Intergenic
992030972 5:72721296-72721318 AAGGATAGGAGGTGAGCAGATGG - Intergenic
994992391 5:107013811-107013833 AGAAAGAGGAGGTGAGCAGAAGG - Intergenic
997455163 5:134011440-134011462 ATGGAGAGGTGATGATCAAAGGG - Intergenic
997461382 5:134054887-134054909 TGCTAGAGGTGGCGAGCAGAGGG + Intergenic
997691766 5:135832141-135832163 AGGTGGAGGTGTTGAGTAGAGGG + Intergenic
998256937 5:140595024-140595046 GTGGAGAGGTGGTGAGCGCAGGG - Intergenic
999085017 5:148880276-148880298 ATGTAGAGGAGGTGAGACAAAGG + Intergenic
999666741 5:153920613-153920635 ATGGGGAGGTGGGAAGCAGAAGG - Intergenic
1004825114 6:19411516-19411538 CAGTAGTGGTGGGGAGCAGAGGG - Intergenic
1006318282 6:33304027-33304049 TGGTAGAGGTGGAGGGCAGAGGG + Intronic
1008342114 6:50379897-50379919 ATGTACAGGTGATGATCTGATGG - Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1009622872 6:66098039-66098061 ACAGAGAGGTGGTCAGCAGATGG + Intergenic
1010061412 6:71626765-71626787 ATGTAGAGATGCTTAGAAGATGG - Intergenic
1010605826 6:77888923-77888945 AAGTAGAGGTGCTGAGCAAAGGG - Intronic
1014550334 6:122782793-122782815 AGATGGAGGTGGGGAGCAGAGGG + Intronic
1014685175 6:124488662-124488684 ATGTTGAGATGATGAGCAGATGG + Intronic
1015724292 6:136284857-136284879 ATGCAGAGGAGGTGGGCAGGGGG + Intronic
1016010251 6:139132078-139132100 ATGTAGAGGTGGGAGGCAGCTGG + Intergenic
1016384901 6:143521278-143521300 GGGTAGAGGTGCTGAGCAGTGGG + Intergenic
1016687650 6:146899680-146899702 ATGGAGAGGTGGTGATCAAAGGG - Intergenic
1017903050 6:158734673-158734695 ATGTCGGGGTGGTGAGGACATGG - Intronic
1018030178 6:159835571-159835593 ATTTAGACGTGGTGAGCAATGGG - Intergenic
1019435602 7:1020747-1020769 CTGCAGGGGTGGTCAGCAGACGG - Intronic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1021580523 7:22148124-22148146 ATGTAGAGGTGTTGAGGTGGAGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022259185 7:28687773-28687795 AGGTGGAAGTGGGGAGCAGAGGG + Intronic
1023037238 7:36142826-36142848 ATGTACAGATGGTGCTCAGAGGG - Intergenic
1023500681 7:40846088-40846110 AGGCAGAGGAGGTGAGGAGAAGG + Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023988616 7:45113643-45113665 ATGTTGAGGTGGGGAGAATAGGG + Intergenic
1024011684 7:45272133-45272155 ATGTAGAAATGGTAAGGAGAAGG - Intergenic
1024046521 7:45589301-45589323 GTGTGGTGGTGGTGTGCAGATGG + Intronic
1026540831 7:71278683-71278705 AAGGAGAAGTGCTGAGCAGAAGG + Intronic
1026833531 7:73623916-73623938 AGGTAGAGGTGGGGCGCAGGCGG + Intronic
1028275517 7:88852008-88852030 ATATAGTGGTGGTGAAAAGAGGG + Intronic
1028466773 7:91161207-91161229 GTGTAGAGGTAGGGAGTAGACGG + Intronic
1028663361 7:93310619-93310641 ATGTAGAAGAAGTGAACAGAGGG - Intronic
1029201257 7:98840604-98840626 ATGTAGAGCCGGTGAGAAGCTGG + Intergenic
1032545615 7:132739259-132739281 CTGGAGAGGTGGTGGGGAGAGGG - Intergenic
1034226596 7:149489667-149489689 AAGTGGAGGTGGTGAGCTGACGG + Intronic
1034226859 7:149491056-149491078 ATGTGCAGGAGGTGAGGAGAAGG + Intronic
1034238583 7:149592058-149592080 ATGTGCAGGAGGTGAGGAGAAGG + Intergenic
1034242001 7:149617814-149617836 ATGTGCAGGAGGTGAGGAGAAGG + Intergenic
1034634888 7:152559437-152559459 AGGTAGGGGTGGTGACCAGAGGG - Intergenic
1035496606 7:159333255-159333277 ATGTAGAGCCAGTGAGCTGAGGG - Intergenic
1036713309 8:11097283-11097305 ATGTAGAAGTGGTGAGTGGGAGG - Intronic
1037610306 8:20470450-20470472 ATGAAGGGGAGGTGAGCAGCAGG + Intergenic
1038166369 8:25088483-25088505 ATAGAGAGGTGGCCAGCAGAGGG + Intergenic
1039831902 8:41222019-41222041 GTGGAGAGGTGGGGAGCACATGG + Intergenic
1041750946 8:61260514-61260536 ATGGAGAGGTGGAGAGGAGATGG - Intronic
1042193438 8:66211390-66211412 AAGGAGAGGTGCTGAGCAAAAGG + Intergenic
1042685744 8:71438644-71438666 ATGTGGAGAGTGTGAGCAGATGG + Intronic
1043333543 8:79146308-79146330 ATGTAGAGGTGGAGAAAAGGCGG + Intergenic
1045174315 8:99704996-99705018 ATGTAGAGGGGAAGAACAGATGG + Intronic
1046158678 8:110330445-110330467 ATGTAGAAGTGGTGAGAAGGTGG + Intergenic
1046256070 8:111697439-111697461 GTGTAGAGTTGGGGAGAAGAGGG + Intergenic
1046776832 8:118173321-118173343 TTATGGAGGTGGAGAGCAGAAGG + Intergenic
1047111379 8:121792995-121793017 AGGTAGGGGTGGTTATCAGAAGG + Intergenic
1047544481 8:125802679-125802701 ATGTAGTGATGCTGAACAGATGG + Intergenic
1048110344 8:131461288-131461310 ATCTAGATCTGGTGAGCAAAAGG - Intergenic
1048651251 8:136480926-136480948 GAGTAGAGGTGATGAGCAGTGGG - Intergenic
1049272884 8:141705434-141705456 ATGGAGAGGTGATGGGGAGATGG + Intergenic
1049904287 9:201187-201209 AAGGAGAGGTGCTGAGCAAAAGG + Intergenic
1051258952 9:15243114-15243136 AGGAAGAGGTGGTGTACAGATGG - Intronic
1053747240 9:41211164-41211186 AAGGAGAGGTGCTGAGCAAAAGG + Intergenic
1054480044 9:65654196-65654218 AAGGAGAGGTGCTGAGCAAAAGG - Intergenic
1056863615 9:90210138-90210160 GTATAAAGGTGGTTAGCAGACGG + Intergenic
1056916294 9:90749309-90749331 GTATAAAGGTGGTTAGCAGACGG - Intergenic
1057880408 9:98788637-98788659 ACGGGGTGGTGGTGAGCAGAAGG - Intronic
1058941771 9:109820078-109820100 ATGTAAAGGAGGTGAGGAAAAGG + Intronic
1059420422 9:114187080-114187102 AAGGAGATGTGGTCAGCAGAGGG + Intronic
1059462588 9:114443516-114443538 AAGTAGAGGTGGGAATCAGAAGG - Intronic
1059551681 9:115235549-115235571 ATGGTGAGGAGGTGAGCTGATGG - Intronic
1060468063 9:123925295-123925317 AGGTAGGGGTGGTTAGCAGAGGG - Intronic
1060992336 9:127856295-127856317 ATGGAGAGTTCTTGAGCAGAAGG + Intergenic
1061514015 9:131078111-131078133 ATGCAGAGGTGATGAGTATAAGG - Intronic
1062488705 9:136793710-136793732 AGGAAGAGGTGGAGACCAGACGG + Intronic
1202783372 9_KI270718v1_random:21943-21965 AAGGAGAGGTGCTGAGCAAAAGG + Intergenic
1185634761 X:1543559-1543581 ATGTCGGGGTGGTCAGCAGCTGG + Intergenic
1185764533 X:2715009-2715031 GTCTAGAGGAGGTGAGCAAATGG + Intronic
1185783424 X:2868527-2868549 ATGGAGAGGTGGGGAGAATAGGG - Intronic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1187393072 X:18898230-18898252 ATGTTGAGGTGGGAAGGAGATGG - Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187591105 X:20718281-20718303 ATCAAGAGCTTGTGAGCAGAAGG + Intergenic
1189098447 X:38164050-38164072 AAGAAGGGGTGGTGAGAAGAAGG - Intronic
1190076675 X:47322096-47322118 ATTTAGAGGTGGAGAGCAGGTGG + Intergenic
1191919296 X:66237563-66237585 ATGTACATGTGGTGATGAGAAGG + Intronic
1193638716 X:83985078-83985100 ATGGAGAGCTGGTGAGCTCAGGG - Intergenic
1195076857 X:101335651-101335673 CTGTAGTGGGGGTGAGGAGAAGG + Intergenic
1197485488 X:127045276-127045298 ATGTAGAGGTGCTAAGTATATGG - Intergenic
1197663539 X:129198919-129198941 AAGTACAGGTGGGGAGGAGATGG - Intergenic
1197860704 X:130966897-130966919 ATGCAGAGGTGGTGAGAGAAAGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1199173899 X:144762076-144762098 ATCCAGATGTGATGAGCAGATGG - Intergenic
1199794710 X:151183053-151183075 GTGGAGAGGTGGTGGGGAGAGGG + Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic
1202282614 Y:23205983-23206005 ATGTAGAGCTGGTGGTCAAAAGG - Intergenic
1202283277 Y:23212536-23212558 ATGTAGAGCTGGTGGTCAAAAGG + Intergenic
1202382849 Y:24292447-24292469 ATGAAGAAGTGCTGAGCAAAGGG - Intergenic
1202434288 Y:24820368-24820390 ATGTAGAGCTGGTGGTCAAAAGG - Intergenic
1202434951 Y:24826922-24826944 ATGTAGAGCTGGTGGTCAAAAGG + Intergenic
1202487935 Y:25377678-25377700 ATGAAGAAGTGCTGAGCAAAGGG + Intergenic